ID: 1017432032

View in Genome Browser
Species Human (GRCh38)
Location 6:154381016-154381038
Sequence ACACTGGCCCTGTTATGTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017432026_1017432032 -1 Left 1017432026 6:154380994-154381016 CCCTCAGTTAGGGAGCCCTATCA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1017432032 6:154381016-154381038 ACACTGGCCCTGTTATGTTCGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1017432025_1017432032 5 Left 1017432025 6:154380988-154381010 CCTTTACCCTCAGTTAGGGAGCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1017432032 6:154381016-154381038 ACACTGGCCCTGTTATGTTCGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1017432027_1017432032 -2 Left 1017432027 6:154380995-154381017 CCTCAGTTAGGGAGCCCTATCAC 0: 1
1: 0
2: 2
3: 4
4: 52
Right 1017432032 6:154381016-154381038 ACACTGGCCCTGTTATGTTCGGG 0: 1
1: 0
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017432032 Original CRISPR ACACTGGCCCTGTTATGTTC GGG Intronic