ID: 1017434954

View in Genome Browser
Species Human (GRCh38)
Location 6:154407079-154407101
Sequence TGGCCACAAGGTCCCACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017434942_1017434954 27 Left 1017434942 6:154407029-154407051 CCACCACCCTGAATGTGGGCACC 0: 1
1: 0
2: 0
3: 21
4: 189
Right 1017434954 6:154407079-154407101 TGGCCACAAGGTCCCACCTGTGG 0: 1
1: 0
2: 2
3: 17
4: 171
1017434943_1017434954 24 Left 1017434943 6:154407032-154407054 CCACCCTGAATGTGGGCACCATA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1017434954 6:154407079-154407101 TGGCCACAAGGTCCCACCTGTGG 0: 1
1: 0
2: 2
3: 17
4: 171
1017434946_1017434954 6 Left 1017434946 6:154407050-154407072 CCATACCTTTACTGCTCTCCTCC 0: 1
1: 0
2: 2
3: 32
4: 386
Right 1017434954 6:154407079-154407101 TGGCCACAAGGTCCCACCTGTGG 0: 1
1: 0
2: 2
3: 17
4: 171
1017434945_1017434954 20 Left 1017434945 6:154407036-154407058 CCTGAATGTGGGCACCATACCTT 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1017434954 6:154407079-154407101 TGGCCACAAGGTCCCACCTGTGG 0: 1
1: 0
2: 2
3: 17
4: 171
1017434948_1017434954 1 Left 1017434948 6:154407055-154407077 CCTTTACTGCTCTCCTCCCTGGA 0: 1
1: 0
2: 1
3: 39
4: 411
Right 1017434954 6:154407079-154407101 TGGCCACAAGGTCCCACCTGTGG 0: 1
1: 0
2: 2
3: 17
4: 171
1017434944_1017434954 21 Left 1017434944 6:154407035-154407057 CCCTGAATGTGGGCACCATACCT 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1017434954 6:154407079-154407101 TGGCCACAAGGTCCCACCTGTGG 0: 1
1: 0
2: 2
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017434954 Original CRISPR TGGCCACAAGGTCCCACCTG TGG Intronic
900292665 1:1930066-1930088 TGGCCACACGGTCCCCACTGAGG + Exonic
900596990 1:3484450-3484472 TGCCCACCAGATGCCACCTGTGG + Intergenic
901794988 1:11674907-11674929 TGGCCACGAGGCCCCACCTGTGG - Intronic
905465586 1:38150812-38150834 TGACCACAAGGTCCCACAATAGG - Intergenic
905611620 1:39357455-39357477 TGGCCACAATCTCACACCTGAGG + Exonic
905889758 1:41511651-41511673 TGGACATGAGTTCCCACCTGAGG + Intronic
913254302 1:116939978-116940000 TAACGACAAGGTCCCAGCTGAGG - Intronic
917220169 1:172720229-172720251 TGGACACATGGTTGCACCTGAGG - Intergenic
922668588 1:227492500-227492522 TGTCTCCAAGGTCCCACCTTGGG + Intergenic
922671006 1:227508797-227508819 TGTCCCCAAAGTCCCACCTCTGG + Intergenic
924243437 1:242060765-242060787 TGTCCTCAACGTCCCACCTCAGG + Intergenic
924514808 1:244757067-244757089 TGATCACAAGGTCCCACCATAGG + Intergenic
1063284579 10:4671654-4671676 TGGCCATAAGCTCTCACCTCTGG - Intergenic
1066100757 10:32116361-32116383 ATGCCACATGATCCCACCTGAGG + Intergenic
1068836879 10:61565665-61565687 TGACCACAAGGTCCCACAATAGG + Intergenic
1070647064 10:78209274-78209296 TGGGCCCAAGGCCCCACCTGGGG + Intergenic
1071793444 10:88980689-88980711 TGGCCAAAATGTCCCCCCTCTGG + Intronic
1071937281 10:90545956-90545978 TGGTCACAAGGTCCCACAATAGG - Intergenic
1074882221 10:117667986-117668008 TGGCCACTTGGTCACAGCTGGGG + Intergenic
1075861769 10:125683285-125683307 GAGCCACCAGGTCCCAGCTGAGG + Intergenic
1076433841 10:130426145-130426167 AGTCCTCAAGGTCACACCTGGGG + Intergenic
1077184282 11:1229391-1229413 ATGCCAGAAGGTCCCACCAGAGG + Intronic
1077190177 11:1252696-1252718 TGGCCACAAGAGCCTGCCTGAGG - Intronic
1079329617 11:19522631-19522653 TGGCCACAAGGTGCCAGTGGGGG - Intronic
1083812998 11:65116067-65116089 TGGGCACATGCCCCCACCTGGGG - Exonic
1084198054 11:67537143-67537165 TGGCCATAAAGTCCCACCAAGGG + Intergenic
1084421231 11:69061668-69061690 TGGCCACTGGGACCCACCTGGGG - Intronic
1085328079 11:75623944-75623966 TGCCCACACTGTCTCACCTGCGG + Intronic
1088434093 11:109791390-109791412 TCCCCACAATGTCCCACATGGGG + Intergenic
1089385427 11:118064370-118064392 GGACCCCAAGGTCCCACCGGAGG + Intergenic
1094813644 12:34164254-34164276 TGTCCCCAAAGTCCCACCTCAGG - Intergenic
1097560314 12:61197106-61197128 TGGTCACAAGGTCCCACAATAGG + Intergenic
1097897782 12:64842829-64842851 TCGCCTCACAGTCCCACCTGTGG - Intronic
1103989079 12:124786270-124786292 TGGCCAGAGGGTCCGATCTGAGG + Intronic
1106765890 13:32913676-32913698 TGGCCCTAAGTTCCCACATGTGG + Intergenic
1108483922 13:50905914-50905936 TGGCCACAAGGAACTGCCTGTGG - Intergenic
1111179400 13:84642201-84642223 TAGCCACCAGGTCCTACTTGAGG + Intergenic
1111423760 13:88052312-88052334 TGGCCACCAGGTGCCAACAGGGG + Intergenic
1111988269 13:95087814-95087836 TGGTTCCCAGGTCCCACCTGGGG + Intronic
1113072833 13:106438389-106438411 TGGCGACCAGTTCTCACCTGGGG - Intergenic
1113730322 13:112637006-112637028 TGGCCTCCAGGTGCCACATGGGG - Intergenic
1114323794 14:21569092-21569114 TGGTCACAAGGTCCCACAATAGG + Intergenic
1119109262 14:71956446-71956468 TGATCACAAGGTCCCACAAGAGG + Intronic
1120350548 14:83352315-83352337 TGATCACAAGGTCCCACATTGGG - Intergenic
1121252875 14:92513112-92513134 AGGCCTCACGGTCCCACCTGGGG + Intergenic
1121434489 14:93910173-93910195 TGTCCACAAGGCCTCACCTCTGG - Intergenic
1122284558 14:100642951-100642973 AGGCCACAGGGGCACACCTGGGG + Intergenic
1124430920 15:29607902-29607924 TGGTCACAAGGTCCCACAATAGG + Intergenic
1126603456 15:50452030-50452052 TGGCCGCATGGTCCCAGGTGCGG + Intronic
1128061795 15:64739992-64740014 TGGCCAGACGGTCACAGCTGCGG + Exonic
1129139337 15:73582970-73582992 TGGTCACAAGGTCCCACAATAGG - Intronic
1130227021 15:82066736-82066758 TGGCAACAAGGGCCCTCCTCTGG - Intergenic
1132470971 16:102789-102811 TGGCCCCAAGGTCCCAGAGGAGG + Intronic
1132515767 16:365041-365063 TGGCCACAACATCCCAACTCTGG + Intergenic
1138123874 16:54422847-54422869 TGGGCACAAGGTATCACATGGGG + Intergenic
1138249008 16:55488321-55488343 GGTCCACAAGGTCCCACGGGAGG + Intronic
1139697482 16:68685429-68685451 TCGACACATGTTCCCACCTGTGG - Intronic
1142125382 16:88407694-88407716 TAGCCCCCAAGTCCCACCTGTGG + Intergenic
1142218342 16:88840899-88840921 TGGCCACAAGTTTCCAAATGAGG - Intronic
1143030238 17:3963733-3963755 TGGCCCCAGGGTCTCCCCTGAGG - Intronic
1144717821 17:17446649-17446671 AGGACCCAAGATCCCACCTGTGG - Intergenic
1149486535 17:57046659-57046681 GGGCCACATGGTCCCCTCTGGGG + Intergenic
1151060719 17:71090583-71090605 TGGCCACCAGGGCCTACTTGAGG - Intergenic
1151535419 17:74736606-74736628 TGCCCAGAATGTCCCACCAGGGG - Intronic
1152427100 17:80224009-80224031 GGGCCGCATGGTCCCATCTGTGG - Intronic
1155357632 18:24968877-24968899 TGGCCACCAGGTCCTTCATGTGG - Intergenic
1156578814 18:38351422-38351444 TGGCAACAAGGGGCCTCCTGCGG - Intergenic
1157757858 18:50234547-50234569 TGGTTACAAGGTCCCTCCTCAGG + Intronic
1157769649 18:50334663-50334685 TGGTTACAAGGTCCCTCCTCAGG - Intergenic
1158009580 18:52713462-52713484 TGGCCACCTGGTGCCACTTGGGG + Intronic
1160732549 19:647924-647946 GGGCCACATGGTCCCCTCTGGGG - Exonic
1161217751 19:3102950-3102972 GAGCCACAGGGCCCCACCTGGGG - Intronic
1161439815 19:4284604-4284626 AGGCCAAAAGGTTGCACCTGTGG + Intronic
1161960648 19:7521080-7521102 TGGCCACAATGTCCCATCTCCGG - Intergenic
1162232906 19:9282456-9282478 TGGACACAAGGTGGCTCCTGTGG - Intergenic
1163612362 19:18308127-18308149 TGGCCACATGCTCCCACCTCAGG - Intronic
1164524555 19:29003816-29003838 AGACCACAAGGTCCCATCAGGGG - Intergenic
1167093055 19:47357955-47357977 TGACCACAAGTACCCGCCTGAGG + Exonic
1168409594 19:56131226-56131248 GGGCCAAAAGCTGCCACCTGAGG + Intergenic
927135300 2:20092464-20092486 GGGCCACCACGACCCACCTGGGG + Intergenic
929575879 2:43051375-43051397 AGGCCACAACCTCCCACCTGGGG + Intergenic
932493942 2:72137518-72137540 TGGCCACTATGGCCCACGTGGGG - Intronic
932588121 2:73044908-73044930 CTGCCTCAAGGCCCCACCTGAGG + Intronic
933554866 2:83819553-83819575 TGGTCACAAGGTCCCACAATAGG - Intergenic
933765649 2:85706861-85706883 TGGACACAAGGTCCCACAGTGGG + Intergenic
934220102 2:90074639-90074661 AGTCCACAAGGTGCCTCCTGAGG - Intergenic
934655145 2:96113416-96113438 AGTCCACAAGCACCCACCTGGGG + Exonic
940471758 2:154110439-154110461 TGGTCACAAGGTCCCACAATAGG + Intronic
946409373 2:219508697-219508719 TGGGCACAGGGTCCCAGCAGCGG - Intergenic
946500580 2:220243089-220243111 TGGACACACTGCCCCACCTGGGG - Intergenic
948150733 2:235742683-235742705 TGGAGGCAAGGTCCCTCCTGTGG + Intronic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1170902302 20:20476812-20476834 TAGCCACAAGGTCCATCCAGAGG + Intronic
1171892505 20:30728840-30728862 TGGCCAGAAGCTCCAGCCTGCGG - Intergenic
1172024949 20:31942164-31942186 TGGCCACTAGTTCTGACCTGTGG - Intronic
1173427581 20:42956248-42956270 TTCCCACTAGGTCCCACCTCCGG - Intronic
1174095710 20:48087999-48088021 GGGCCACAAGGTCCCCCCTGTGG - Intergenic
1176510623 21:7745194-7745216 AGGCCGCCAGGCCCCACCTGCGG + Intronic
1178644736 21:34375723-34375745 AGGCCGCCAGGCCCCACCTGCGG + Exonic
1179025474 21:37675612-37675634 TGGCCACACGGCCTCTCCTGGGG - Intronic
1180968825 22:19804271-19804293 TGGCCTCCAGGTCTCATCTGCGG - Intronic
1181173524 22:21023359-21023381 TGGCCACGAGGTCCCCAATGCGG - Exonic
1181877450 22:25950899-25950921 TGACCACAAGGTCCCACAATAGG + Intronic
1182985547 22:34712885-34712907 TGGCCCCCAGGTCCCCTCTGAGG - Intergenic
1182986241 22:34720050-34720072 TGTACACTAGGTCACACCTGTGG - Intergenic
1183153601 22:36056836-36056858 TAGCCACAAGGTACCATCTACGG - Intergenic
1184419098 22:44369242-44369264 TGGCCCCAAGCCCCCACCTGGGG - Intergenic
1184687417 22:46102931-46102953 TGGGCACATGCTCCCAGCTGGGG - Intronic
1185019466 22:48365704-48365726 TGCACCCAAGGTCCCAGCTGGGG - Intergenic
1185029523 22:48434357-48434379 TGGCCACCTGGTCCAACCCGGGG - Intergenic
1185222312 22:49635246-49635268 GGGACACAGAGTCCCACCTGGGG + Intronic
1185368012 22:50445804-50445826 TGGCTTCAACGTCCCACCAGGGG + Exonic
951365499 3:21777050-21777072 TGGCAACACGGTCCCATGTGGGG - Intronic
951961927 3:28335449-28335471 TGGCCACAAGCTCAAAGCTGGGG + Intronic
953720126 3:45347926-45347948 TGCCCACAAGGTGCCACCCGAGG - Intergenic
955452398 3:59083552-59083574 TTGCCACACTTTCCCACCTGGGG + Intergenic
956726047 3:72157259-72157281 TGGCCAGAAGGGCCAACCAGTGG + Intergenic
957503611 3:81091043-81091065 TAACCAGAAGGTCCCATCTGGGG + Intergenic
958933975 3:100238044-100238066 TGATCACAAGGTCCCACCATAGG - Intergenic
959837515 3:110937640-110937662 TAGAAACAAGGTCCCACATGTGG - Intergenic
961553357 3:127681224-127681246 GGGCCACAAGGTCCTCCCTGGGG - Intergenic
963931142 3:151005475-151005497 TGGCCCCAAAGACCCAGCTGAGG - Intergenic
963969965 3:151419277-151419299 TGACCACAAGGTCCCACAATAGG + Intronic
967213908 3:187194012-187194034 TGGCCAGTAACTCCCACCTGAGG + Intergenic
968577200 4:1373208-1373230 TGACCACAAGGTCCCACAAGAGG + Intronic
974368600 4:60985461-60985483 TGGCCACAAGGTAGCATCTAGGG + Intergenic
974615292 4:64272060-64272082 TGGCCACAAGCTCCGGCTTGGGG - Intergenic
975414609 4:74092336-74092358 TGGCCTCAAAGTCCAACCTCAGG - Intergenic
977651926 4:99480038-99480060 TGATCACAAGGTCCCACCATAGG - Intergenic
980446689 4:132919781-132919803 TGGCCACAAGGTCCCACAATAGG - Intergenic
984747117 4:183232381-183232403 TGGGCACAAGGTTCCCTCTGGGG - Intronic
987703866 5:21437905-21437927 TGGTCACAAGGTCCCACAATAGG - Intergenic
990329510 5:54712237-54712259 TGGCCACAGGGTCCAGGCTGAGG + Intergenic
990990071 5:61675653-61675675 TGTCCACAGTGTCCCCCCTGGGG + Intronic
993412245 5:87589118-87589140 TGATCACAAGGTCCCACCATAGG + Intergenic
995860960 5:116639958-116639980 TGGCCTAAAAGTCCCACCTTTGG - Intergenic
998269937 5:140697331-140697353 GGGCCACAAGGTGCCATGTGTGG + Exonic
1002419481 5:179138169-179138191 TGGCCACATCCTCCCTCCTGGGG + Intronic
1003136932 6:3441120-3441142 AGGCCCCATGGTCCTACCTGGGG - Intronic
1003457278 6:6294449-6294471 TGGTCACAAGGTCCCACAATAGG - Intronic
1006302067 6:33199152-33199174 TGGTCACAACCTCTCACCTGGGG + Exonic
1010769866 6:79816078-79816100 TGATCACAAGGTCCCACCATAGG - Intergenic
1011149106 6:84249366-84249388 TAGACACCAGGTCCTACCTGAGG - Intergenic
1013305386 6:108842524-108842546 TGATCACAAGGTCCCACCATAGG - Intergenic
1017053313 6:150414402-150414424 TGATCACAAGGTCCCACCATAGG - Intergenic
1017434954 6:154407079-154407101 TGGCCACAAGGTCCCACCTGTGG + Intronic
1019342176 7:513469-513491 TGGCCCCCTGGTCCCAGCTGGGG + Intronic
1019422101 7:955184-955206 TGCCCAGAGGGTCCCATCTGTGG - Intronic
1019447546 7:1079217-1079239 AGGCCACAGGGACACACCTGAGG + Intronic
1021989164 7:26125624-26125646 TGACCACAAGGTCCCACAATAGG - Intergenic
1022078468 7:26996968-26996990 TGGTCACAAGGTCCCACAATAGG - Intergenic
1024884025 7:54121955-54121977 TGATCACAAGGTCCCACAGGAGG + Intergenic
1025852198 7:65252473-65252495 TGTCCACAAGTTGCCACCTAAGG - Intergenic
1032118915 7:129142321-129142343 TGACCACAATGTCCCTCATGTGG - Intergenic
1033055384 7:138047853-138047875 CGGCCAGAAGGTTTCACCTGGGG + Intronic
1033590641 7:142805480-142805502 TGGTCACAAGGCCCCTCCAGTGG + Intergenic
1034137070 7:148780612-148780634 AGGCCACACGGGCTCACCTGGGG + Intronic
1035309156 7:157953771-157953793 TGGCCAAAGGATCCCTCCTGAGG + Intronic
1035310471 7:157964665-157964687 TGACCACCAGGGCCAACCTGAGG + Intronic
1037245290 8:16827719-16827741 TGACCACAAGGTCCCACAGTAGG + Intergenic
1039943660 8:42111961-42111983 TGGCCACAAAGGCCCCCATGAGG - Intergenic
1040296751 8:46152854-46152876 GGCCCACAAAGGCCCACCTGTGG + Intergenic
1040322697 8:46326664-46326686 TGGCCTCCAGCCCCCACCTGGGG + Intergenic
1040670394 8:49682775-49682797 TGGCCATAAGCTTTCACCTGAGG + Intergenic
1040858890 8:51978795-51978817 CTGCAACAAGGTCCCATCTGGGG + Intergenic
1040890408 8:52311180-52311202 TGCCCACAAGGTAGCCCCTGAGG - Intronic
1044150396 8:88769778-88769800 TGGTCACAAGGTCCCACAATAGG - Intergenic
1045414365 8:101951850-101951872 TGGCCACTTGGTCCTACCTGTGG - Intronic
1047130302 8:122012155-122012177 TGGCCTCCAGCTCCCATCTGTGG + Intergenic
1048028146 8:130605644-130605666 CGGTCAGATGGTCCCACCTGTGG - Intergenic
1049467230 8:142757120-142757142 TGGCCACAGCCTCCCACATGGGG - Intergenic
1049938950 9:526265-526287 TGCCCACCAGCTCCTACCTGTGG - Intronic
1053096237 9:35330459-35330481 AGGCCACCAGGTCTCCCCTGTGG + Intronic
1054356317 9:64066895-64066917 TGGCCAAAAGCTCCAGCCTGGGG + Intergenic
1057899904 9:98940478-98940500 GGGCCAAATGGTCCCAGCTGTGG - Intergenic
1058697759 9:107574243-107574265 TGGCCACGGGGCCCCACCAGAGG - Intergenic
1060406843 9:123377026-123377048 TGTCCTCAAGGTGCCACCGGAGG + Exonic
1060771510 9:126335475-126335497 TGGCCACAGGTTCCCTCCTTGGG + Intronic
1062218902 9:135403877-135403899 TGGGCCCAAGGTGCCACCTGGGG + Intergenic
1203561869 Un_KI270744v1:64360-64382 TGGCCAGAAGCTCCAGCCTGCGG - Intergenic
1185558198 X:1037804-1037826 TGATCACAAGGTCCCACCTTAGG - Intergenic
1190748194 X:53339102-53339124 AGGCCACAATGGCACACCTGGGG + Intergenic
1190798870 X:53770310-53770332 AGGCCACAATGGCACACCTGGGG + Intergenic
1193574101 X:83178589-83178611 TGATCACAAGGTCCCACAAGTGG + Intergenic
1194210623 X:91065037-91065059 TGACCACAAGGTCCCACAATAGG - Intergenic
1197404669 X:126035274-126035296 TGACCACAAGGCCCCACCATAGG - Intergenic
1198144557 X:133841986-133842008 TGGTCACAAGGTCCCACAATAGG - Intronic
1199082633 X:143593734-143593756 TGATCACAAGGTCCCACCATAGG + Intergenic
1199565535 X:149211886-149211908 TGGCCCCAAGGTACCACATGAGG + Intergenic
1200032460 X:153307342-153307364 TAGCCCCCAGGGCCCACCTGCGG - Intergenic
1200212318 X:154352217-154352239 AGCCCACAAGGTCCGAGCTGGGG - Exonic