ID: 1017438123

View in Genome Browser
Species Human (GRCh38)
Location 6:154436943-154436965
Sequence ATATGTATCCTTCAAATTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017438122_1017438123 1 Left 1017438122 6:154436919-154436941 CCTTGCAGGAGAAAAGAAGCAGC 0: 1
1: 0
2: 2
3: 28
4: 399
Right 1017438123 6:154436943-154436965 ATATGTATCCTTCAAATTAGAGG 0: 1
1: 0
2: 3
3: 13
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017438123 Original CRISPR ATATGTATCCTTCAAATTAG AGG Intronic
900202251 1:1414407-1414429 AAATGTAACCTTAAAATTTGAGG - Intergenic
905378889 1:37545631-37545653 TTATGTATTTTTTAAATTAGGGG - Intronic
909614013 1:77586525-77586547 ATTTGTTGGCTTCAAATTAGAGG - Intronic
910486999 1:87725537-87725559 ATATGTATCTTTGAAATCAGAGG - Intergenic
912075988 1:105876133-105876155 AAATGTTTCCCTCAAATAAGTGG + Intergenic
915149671 1:153820535-153820557 GAATGTATCTTTGAAATTAGAGG - Intronic
916581992 1:166117157-166117179 ATATGTCTCCTTAAACTAAGGGG - Intronic
917034526 1:170732862-170732884 ATAGGTATCCCTCAAATTAGTGG - Intronic
917603242 1:176598638-176598660 AAATATATTCTACAAATTAGTGG - Intronic
917880065 1:179326270-179326292 ATGTATATCCTTCAAATTCTAGG + Intronic
919027254 1:192190397-192190419 ATATATGTCCTTGAAATTAAAGG - Intergenic
1063084629 10:2805364-2805386 TTATGTTTCCTTAAATTTAGGGG - Intergenic
1067036079 10:42918302-42918324 ATATTTCTCCTTCAATTTATTGG + Intergenic
1067307140 10:45074400-45074422 ATAAGTATCCTTCAAACTGCAGG - Intergenic
1069021739 10:63496101-63496123 CTATGTTTCCTACAAATGAGTGG - Intergenic
1069063953 10:63923167-63923189 ATATTTAACCTTCCATTTAGTGG - Intergenic
1069393723 10:67965254-67965276 ATATGTATTATTAAAATGAGGGG - Intronic
1069493820 10:68885007-68885029 ATAAGTATCCTTCAAAAGAGGGG + Exonic
1070473913 10:76813608-76813630 TTCTGTATCATTCAAATTTGAGG + Intergenic
1074176269 10:111006668-111006690 ATCTGTATCTTTAAAATTTGCGG - Intronic
1074494053 10:113963537-113963559 CTATGAATCCTTCAAAAGAGAGG - Intergenic
1075542608 10:123328205-123328227 AAATGTATCCTGCAAATAAGAGG + Intergenic
1079086011 11:17445440-17445462 ATTTGTATGCTTTAAATGAGTGG + Intronic
1079173423 11:18117452-18117474 ATATATATTTTTTAAATTAGCGG + Intronic
1080245023 11:30170015-30170037 ATCTGTATGTTTCAAAGTAGAGG - Intergenic
1080372695 11:31670261-31670283 AAATGTACCCTTCAAATTGAGGG + Intronic
1081236962 11:40658150-40658172 ATATGTGTCCTTTATATTATAGG + Intronic
1083542593 11:63523765-63523787 CTGTCTATCTTTCAAATTAGAGG + Intergenic
1087717923 11:101630699-101630721 CTATGTATGGTACAAATTAGGGG + Intronic
1087896494 11:103592115-103592137 GGATGCATCCTTCAAATTATTGG + Intergenic
1087955940 11:104288182-104288204 AAATGTATCCTTTAAGGTAGTGG + Intergenic
1091059005 11:132444385-132444407 ATGTGTATCCTTCAAAAGAAGGG - Intronic
1091126588 11:133105051-133105073 ATATGTATCCTTAAACTTTATGG + Intronic
1094050539 12:26215845-26215867 ATAGGAGTCCTTCAAATTGGGGG - Intronic
1095411218 12:41925687-41925709 ATATGTAGCTTCCAAACTAGAGG + Intergenic
1095512649 12:42969904-42969926 ATATGTTTCCGTAAAATGAGTGG + Intergenic
1095792588 12:46183895-46183917 AAATGTTTCCTAGAAATTAGTGG - Intronic
1097379368 12:58876693-58876715 TTCTGTATACATCAAATTAGGGG + Intronic
1103259576 12:119574955-119574977 ATCGGGATGCTTCAAATTAGAGG - Intergenic
1104077470 12:125402796-125402818 GTATGAATCCTTGAAATTATGGG - Intronic
1106733512 13:32566627-32566649 ATAGGAATTCTCCAAATTAGTGG - Intergenic
1107694593 13:42987683-42987705 ATATGTATACTTTAAAGCAGGGG - Intronic
1107766060 13:43735869-43735891 ATATCTATCCTTCCATTTAGGGG + Intronic
1108109467 13:47052664-47052686 CTATGTAACCTTCAAATTAGTGG + Intergenic
1111839918 13:93436713-93436735 AAATGTGTCCATCATATTAGTGG - Intronic
1113200476 13:107862957-107862979 ATATGTATCCCAAAAATTTGTGG + Intronic
1113328004 13:109301556-109301578 ATATGTCACCTTCAAAAGAGGGG - Intergenic
1115901902 14:38161028-38161050 AAATATATCCTTTAAATTTGTGG - Intergenic
1116687380 14:48057206-48057228 ATATTTATCCTTCAAATCAATGG - Intergenic
1116770345 14:49120083-49120105 ATATATATGCTTAAAAATAGAGG - Intergenic
1116997751 14:51341519-51341541 ATATATATTCTTCTAAATAGAGG - Intergenic
1116999427 14:51357044-51357066 ATATGTATCTTTCTAATCTGTGG - Intergenic
1119586427 14:75840238-75840260 ATATGTATACTTCAAGTTCTGGG + Intronic
1121420779 14:93812168-93812190 CTATGTATCCTACAAAGCAGGGG - Intergenic
1121516821 14:94557809-94557831 ATATGTATCCCTGGAGTTAGAGG - Intergenic
1123131656 14:105991506-105991528 GTATGTATACTTGAAATTAATGG + Intergenic
1123581887 15:21722697-21722719 GTATGTATACTTGAAATTAATGG + Intergenic
1123618536 15:22165297-22165319 GTATGTATACTTGAAATTAATGG + Intergenic
1123873417 15:24598939-24598961 ATATGTAGACCTCAAATAAGGGG - Intergenic
1124143902 15:27103209-27103231 ATATGTATACGTCAAAGAAGAGG - Intronic
1125118388 15:36122716-36122738 AAGTGTATCCTTGAAATGAGGGG - Intergenic
1125202200 15:37110192-37110214 ATATTTATCCCTCTAATTATAGG - Intergenic
1126212978 15:46120637-46120659 GTATGTATCCTTTGAAATAGTGG + Intergenic
1127060532 15:55178455-55178477 CTTTGTATCTTTCAAATTACTGG + Intergenic
1131020997 15:89098656-89098678 AAATGTACCCTTCTAAATAGTGG + Intronic
1132265214 15:100464175-100464197 ATATGTATCCTTGGAAGTAAGGG + Intronic
1133735911 16:8615627-8615649 ATCTGTTTCCTTCAAGTTAGTGG - Intergenic
1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG + Intronic
1142906588 17:3047251-3047273 ATATGTGACCTTCAGGTTAGGGG + Intergenic
1148005657 17:44426961-44426983 ATATGTATCTTTCAAATATAGGG + Intronic
1150744781 17:67807742-67807764 ATATGTATCAATAGAATTAGTGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153454708 18:5267797-5267819 ATATGTATCCCTGAACTTAAAGG + Intergenic
1154469506 18:14685086-14685108 ATATGTAATAATCAAATTAGGGG + Intergenic
1156567191 18:38205259-38205281 ATATGTAACATTCAAATCACAGG + Intergenic
1156900646 18:42297020-42297042 ATATGTATTCTTCAACATTGAGG - Intergenic
1157691690 18:49687641-49687663 ATGTGTGTCCTTATAATTAGAGG - Intergenic
1157798976 18:50603085-50603107 ATCTGTAACCTCCAGATTAGTGG - Intronic
1159335332 18:67057141-67057163 ATTTGTATCCTTCAAACATGAGG - Intergenic
1159427959 18:68313581-68313603 ATATGTATTGTTCAAAATACTGG + Intergenic
1160293607 18:77617568-77617590 GTATGTATCATTCTAATTATTGG - Intergenic
1160471951 18:79144315-79144337 CTCTGTATGCTTTAAATTAGTGG + Intronic
926455717 2:13066486-13066508 ATATTTATTGTTAAAATTAGTGG - Intergenic
929333014 2:40707509-40707531 ATATGTATACTTTAAATTCTGGG + Intergenic
929846121 2:45529887-45529909 ATCTGTATCCCTCAAATTTTTGG + Intronic
930882321 2:56285954-56285976 AAATATATCCTTCAAATCTGAGG - Intronic
931485783 2:62690232-62690254 ATATGTGTCTTTAAAAATAGGGG + Intronic
931521980 2:63107914-63107936 ATATATATTCTTAAATTTAGAGG + Intergenic
933122601 2:78559770-78559792 ATGTATTTCTTTCAAATTAGAGG + Intergenic
935512413 2:103992405-103992427 ATATGTATTATGCAAATAAGAGG - Intergenic
939267937 2:139899118-139899140 ATTTATATCATTTAAATTAGAGG + Intergenic
942526367 2:176857155-176857177 AAATGTATCTTTTAAATCAGAGG - Intergenic
944231491 2:197398114-197398136 ATGTGTATTTTTTAAATTAGGGG - Exonic
945121085 2:206458035-206458057 ATATTTATCCTGCAAATAAATGG - Intronic
946821855 2:223638038-223638060 TTATCTCTCCTTCAAATTAAAGG + Intergenic
947321227 2:228921134-228921156 ATATGGATCCTGGCAATTAGGGG + Intronic
948283995 2:236769899-236769921 ATTTGTATCCTTCAACCTAAGGG - Intergenic
1169635452 20:7686312-7686334 ATATGTCTCCTTCAAAATTCAGG + Intergenic
1170097388 20:12661846-12661868 TAATGTATCCTTAAAATTACAGG - Intergenic
1174953676 20:55071898-55071920 ATATGTATATATCACATTAGTGG - Intergenic
1176804996 21:13472564-13472586 ATATGTAATAATCAAATTAGGGG - Intergenic
1177412255 21:20745261-20745283 ATATGTCACTTTCAAATTTGGGG + Intergenic
1177620545 21:23586019-23586041 ATGTGTATCCTGCAAATAAGGGG + Intergenic
1177954488 21:27580249-27580271 ATATGTTTCCATTAAAGTAGAGG - Intergenic
1182727981 22:32463608-32463630 AAATGTAGCCTTCAAAACAGAGG + Intronic
1183472278 22:38016087-38016109 CTATGTTCCCTTCACATTAGGGG + Intronic
1184534499 22:45077452-45077474 ATTTGTCTCCTTCACATGAGTGG + Intergenic
949780589 3:7682434-7682456 ATATGTATATTTATAATTAGTGG + Intronic
951299712 3:20980112-20980134 ATATCTTTCCCTCAAATTATTGG - Intergenic
952120371 3:30235821-30235843 AGATGTATCTTTAAAATTATTGG - Intergenic
953225507 3:41015591-41015613 ATATGTGTCCACCAAATTAAAGG + Intergenic
955824501 3:62931084-62931106 ATATTTCTTCTTCTAATTAGAGG - Intergenic
956853977 3:73257809-73257831 AAATGAATCCTTTAAATCAGGGG + Intergenic
957386652 3:79504217-79504239 AAATGTATCTTCCAAATCAGAGG - Intronic
958850090 3:99314513-99314535 GTAGGTATCCTTCTAATTAAAGG + Intergenic
959184969 3:103034964-103034986 ACATCTATCCTTAAAATAAGTGG - Intergenic
962475099 3:135748346-135748368 ATATGTCTCCTTCAATCTTGGGG - Intergenic
963436270 3:145271166-145271188 ATGTGTATCCTGCAATTTATTGG - Intergenic
963679611 3:148357721-148357743 ATATCTATCCTTTATAATAGGGG + Intergenic
964673256 3:159249981-159250003 ATAAGTAGCCTTCCAATTAATGG - Intronic
965667343 3:171109399-171109421 ATATGCATTCTTCTGATTAGTGG - Intronic
965989116 3:174794389-174794411 ATATGTATCCTTTACATTCTAGG + Intronic
969224856 4:5789019-5789041 ATATGTATCCTAAAAATTAGTGG - Intronic
970628761 4:17918813-17918835 AAATGTTTTCTTCAAATTGGGGG - Intronic
972958452 4:44421595-44421617 ATATATTTCCTTCCAATTGGTGG + Intronic
974365995 4:60949807-60949829 ATATTTAACCTTAAAATTACAGG - Intergenic
975159408 4:71108673-71108695 ATATATTTCCATCAAATTTGGGG + Intergenic
976006658 4:80438538-80438560 AAAGGTAACGTTCAAATTAGTGG - Intronic
976521045 4:86027113-86027135 ATATGTATGCTACACATTATGGG - Intronic
976576280 4:86675950-86675972 ATATTTAGACTACAAATTAGTGG - Intronic
976988407 4:91331083-91331105 AAATGTATCCTTCAAGATAAGGG + Intronic
977090123 4:92662277-92662299 ATATGCTTCCTTCTACTTAGAGG - Intronic
978391833 4:108235353-108235375 ATAAATAACCTTCAAATTATGGG - Intergenic
980160613 4:129157425-129157447 AAATCTCTCCTTCCAATTAGTGG + Intergenic
980321592 4:131286705-131286727 ATATGTATCATTTTAAATAGTGG + Intergenic
980516838 4:133875007-133875029 ATATGTACCCCTGAAATTAAAGG - Intergenic
980897388 4:138872969-138872991 AGATGTATGCTTCAAGTTTGGGG + Intergenic
981811971 4:148785749-148785771 ATAAGTATCCTTTAAATGAAGGG - Intergenic
983284857 4:165726636-165726658 ATATGTATAGTTCACATTTGTGG - Intergenic
983455717 4:167961423-167961445 ATATGTCTACATCAAAATAGTGG + Intergenic
984007737 4:174333750-174333772 GAATGTATCCTTCAAATTTTAGG + Intergenic
984575208 4:181439862-181439884 AAACGTATCCTTCAAATTTCTGG + Intergenic
986363880 5:7009785-7009807 AAATGTCTCCATCAAATTATGGG + Intergenic
987505745 5:18769068-18769090 ATATACATTTTTCAAATTAGGGG - Intergenic
987672448 5:21028668-21028690 CTATGTAGGCTTCAAATTTGAGG - Intergenic
988209763 5:28188038-28188060 ATACGTATTATTAAAATTAGTGG + Intergenic
988468852 5:31517516-31517538 ATATGTTTTTTTCAAATCAGAGG - Intronic
988631121 5:32932916-32932938 ATATGTATTCTTAAAACTAATGG + Intergenic
989493562 5:42084932-42084954 TTATGTATCTTTCAAATTATAGG - Intergenic
990110504 5:52317430-52317452 AAATCTGTCCTTTAAATTAGTGG - Intergenic
991463830 5:66888635-66888657 ATATTGATTCTTCAAATTAGGGG + Intronic
991505041 5:67315830-67315852 ATACGTAGCCTTGAAAATAGAGG + Intergenic
992591172 5:78297010-78297032 ATATCTATTCTTCAAAAAAGAGG + Intergenic
993643329 5:90433031-90433053 ATATGTATCCTACAAAGATGAGG - Intergenic
994016361 5:94971137-94971159 TTTTGTATCCTTAAAATGAGGGG + Intronic
994183453 5:96793369-96793391 TTATTTATCCTTCACATTTGAGG - Intronic
996191732 5:120552084-120552106 ACATGTATCTTTCATAGTAGTGG + Intronic
997724644 5:136110343-136110365 ATATGTATCCTTGTCAATAGTGG + Intergenic
1000398562 5:160801490-160801512 ATGTCTATCTTTCCAATTAGAGG + Intronic
1001138021 5:169118617-169118639 CTATGTATCCTACAAATTCCTGG - Intronic
1001293589 5:170483633-170483655 AGCTGTATCCTGCAAGTTAGTGG + Intronic
1001584144 5:172821429-172821451 ATATGTATCCTCCCAATGGGTGG + Intergenic
1004138824 6:12995266-12995288 ATATATAACTTCCAAATTAGAGG + Intronic
1004851921 6:19708160-19708182 ATATTTATACTTCAAATTTGTGG - Intergenic
1005789980 6:29289861-29289883 ATGTGAATCCTTGAAATTTGAGG - Intergenic
1007045838 6:38773496-38773518 AGTTGTATTCTTCAAACTAGAGG - Intronic
1008323812 6:50151721-50151743 ATCTGTAGCATTCAAATTAAAGG + Intergenic
1009452807 6:63821467-63821489 ATATGTATCCCTGAAGTTTGAGG + Intronic
1010139349 6:72596296-72596318 ATATGTAACTTTCAAATCTGTGG - Intergenic
1012673186 6:102082551-102082573 ATATGTATCTTTGTAATTTGAGG - Intergenic
1015144084 6:129966318-129966340 ATATGTAGCCTGTCAATTAGAGG - Intergenic
1015146830 6:129996387-129996409 ATATGTATATTTTAAATTATTGG - Intergenic
1017438123 6:154436943-154436965 ATATGTATCCTTCAAATTAGAGG + Intronic
1020406620 7:7842710-7842732 ATATGTATTCTTCAGAATATTGG + Intronic
1020604116 7:10314383-10314405 ATATGTATTCTATATATTAGTGG + Intergenic
1021962365 7:25885549-25885571 ATATGTAACCTACAACTCAGTGG + Intergenic
1022757855 7:33312967-33312989 ATATGTATTTTTTAAATGAGTGG + Intronic
1023374499 7:39542532-39542554 ATATGTATTCTTTAAATGAATGG - Intergenic
1025205436 7:56990820-56990842 ATATGTATCAGTCATGTTAGGGG + Intergenic
1025666504 7:63586119-63586141 ATATGTATCAGTCATGTTAGGGG - Intergenic
1027780395 7:82513367-82513389 TTTTGTATCCTTCAGATTAGTGG + Intergenic
1027913709 7:84286518-84286540 ATATGAATCCATCAAACTATAGG - Intronic
1028705457 7:93839687-93839709 ATATTTACTCTTCAAATCAGAGG - Intronic
1030827774 7:114182264-114182286 ATATTAATGCTTCAAATTAATGG - Intronic
1031233577 7:119142769-119142791 GTATTTGTCCTTCAAACTAGTGG + Intergenic
1031565382 7:123290392-123290414 ATATGTATCCCTAAAATGAAAGG - Intergenic
1032812991 7:135441818-135441840 GTATGTATCTTTCAGTTTAGGGG + Intronic
1033949317 7:146763356-146763378 ATAAGCATCCTTGAAATTAGAGG - Intronic
1038952368 8:32429503-32429525 ATATGTATATTTCTAATTACAGG + Intronic
1040762844 8:50871906-50871928 ATATTTATCTGTAAAATTAGAGG + Intergenic
1040794368 8:51272837-51272859 TTAAGTATCCTGGAAATTAGAGG - Intergenic
1043405524 8:79928426-79928448 ATATATATACTCCAAATTGGGGG - Intronic
1043599683 8:81922331-81922353 ATATGTATCTTTCATAATAGAGG - Intergenic
1044376163 8:91473622-91473644 TTATATATTCATCAAATTAGTGG - Intergenic
1045881698 8:107048161-107048183 ATATGTATGCTTAAAAATAAAGG - Intergenic
1047609122 8:126503747-126503769 ATATGTATACTTAAAATGACTGG + Intergenic
1048663304 8:136632152-136632174 ATGTATATCCTTGAAGTTAGAGG + Intergenic
1049078447 8:140419998-140420020 TTTTATATCCTTCAAATTTGTGG - Intronic
1049120227 8:140730263-140730285 ATTTGTATACTTCTAATTTGGGG - Intronic
1050734383 9:8746892-8746914 ATATTTATATTTCAAAGTAGAGG + Intronic
1051127390 9:13820230-13820252 AAATATATTCTTCAACTTAGTGG - Intergenic
1051378582 9:16431502-16431524 ATATGTATACTTCATAATGGAGG + Intronic
1051983529 9:23054079-23054101 CTATCCATCTTTCAAATTAGGGG + Intergenic
1052153209 9:25146505-25146527 ATTTGTATCCTGCAACTTATTGG - Intergenic
1052195751 9:25712687-25712709 ACCTGTAGCCTTAAAATTAGTGG - Intergenic
1057337613 9:94167336-94167358 GTATGTATTCTTCAACTTACCGG + Intergenic
1058249442 9:102672888-102672910 ACATGAATACTTCAAATTATAGG - Intergenic
1059288767 9:113202457-113202479 ATATGTTTCCCTAAAATTAAGGG + Intronic
1061659382 9:132118509-132118531 ATCGGTATCCTTCATTTTAGAGG + Intergenic
1186010246 X:5123548-5123570 ATATCTATGCTTTAAATAAGAGG + Intergenic
1186086343 X:5994489-5994511 ATATGCATCCCTCAAACCAGGGG + Intronic
1186448130 X:9649580-9649602 AGATGTATAATGCAAATTAGAGG + Intronic
1187080761 X:15984601-15984623 ATGTGTATCTTTCAAGTAAGTGG + Intergenic
1188533824 X:31172522-31172544 AAAGGAATCCTTCAAATTAAAGG + Intronic
1189154208 X:38739875-38739897 TTATGCATCCTTCAAAATACAGG - Intergenic
1191270206 X:58455782-58455804 ACAAATATCCTTTAAATTAGTGG - Intergenic
1191649944 X:63526090-63526112 ACATGTATCCTACAACTTAAAGG - Intergenic
1193103824 X:77645463-77645485 AAAATTATCCTTCAAAATAGAGG + Intronic
1193443829 X:81575908-81575930 AAATGTATGCTTCAATTTAAAGG + Intergenic
1193511143 X:82400895-82400917 ATGTGTAATGTTCAAATTAGAGG + Intergenic
1195953435 X:110302940-110302962 AAATTTATACTTCAAATTTGGGG + Intronic
1196052774 X:111322895-111322917 TTATGAATCCTTTAAATAAGGGG + Intronic
1196218749 X:113087359-113087381 CTATGTATCCTTCAACTTCCAGG - Intergenic
1197457681 X:126698480-126698502 AAATGTATATTTCAAATGAGTGG - Intergenic
1198286870 X:135199790-135199812 ATTTGTATCCTTAGAAGTAGAGG - Intergenic
1201271171 Y:12255458-12255480 AAATGTATCTATCAAATTGGTGG - Intergenic