ID: 1017438658

View in Genome Browser
Species Human (GRCh38)
Location 6:154442178-154442200
Sequence CGGAAAAGTCCCGCTTACGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 8}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017438658_1017438662 9 Left 1017438658 6:154442178-154442200 CCATCGTAAGCGGGACTTTTCCG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 1017438662 6:154442210-154442232 TATGTAATTCTGTAAATTGTGGG 0: 1
1: 0
2: 4
3: 27
4: 353
1017438658_1017438661 8 Left 1017438658 6:154442178-154442200 CCATCGTAAGCGGGACTTTTCCG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 1017438661 6:154442209-154442231 TTATGTAATTCTGTAAATTGTGG 0: 1
1: 0
2: 2
3: 40
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017438658 Original CRISPR CGGAAAAGTCCCGCTTACGA TGG (reversed) Exonic
1066267641 10:33791726-33791748 CGGACAATTCCAGTTTACGATGG - Intergenic
1152368553 17:79871129-79871151 CAGACAAGTGCAGCTTACGATGG + Intergenic
927148897 2:20184660-20184682 TGGAGAAGTCCCGCTTCCTAGGG + Intergenic
932675770 2:73779760-73779782 CGGACAAGTCAAGCTTGCGATGG + Intronic
940637986 2:156320829-156320851 AGGAAAAGTCCAGCTTCCGTCGG - Intergenic
979514198 4:121588304-121588326 AGGAAAAGTCAGGCTTACAAAGG - Intergenic
999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG + Exonic
1017438658 6:154442178-154442200 CGGAAAAGTCCCGCTTACGATGG - Exonic
1035132474 7:156668682-156668704 AAGAAAAGCCCCGCTGACGATGG - Intronic