ID: 1017441842

View in Genome Browser
Species Human (GRCh38)
Location 6:154471856-154471878
Sequence TATGATGGCCACTATGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017441842_1017441852 30 Left 1017441842 6:154471856-154471878 CCAGTTCCATAGTGGCCATCATA 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1017441852 6:154471909-154471931 AGCCCATTACACTTGGCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 107
1017441842_1017441851 29 Left 1017441842 6:154471856-154471878 CCAGTTCCATAGTGGCCATCATA 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1017441851 6:154471908-154471930 TAGCCCATTACACTTGGCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1017441842_1017441849 -7 Left 1017441842 6:154471856-154471878 CCAGTTCCATAGTGGCCATCATA 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1017441849 6:154471872-154471894 CATCATACTGGGGGTTTTGATGG 0: 1
1: 0
2: 1
3: 8
4: 108
1017441842_1017441850 23 Left 1017441842 6:154471856-154471878 CCAGTTCCATAGTGGCCATCATA 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1017441850 6:154471902-154471924 TCTACATAGCCCATTACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017441842 Original CRISPR TATGATGGCCACTATGGAAC TGG (reversed) Intronic
904313101 1:29642033-29642055 TATGAGGGACACTATGGTTCAGG - Intergenic
905132813 1:35773986-35774008 TATGAAGCCCTCTATGGGACAGG - Intergenic
912099096 1:106184146-106184168 TATGGAAGCCACTTTGGAACTGG + Intergenic
913471514 1:119192018-119192040 TATGCTGGGCACTATGGGAAAGG - Intergenic
916477288 1:165182546-165182568 TGTGGAGGCAACTATGGAACTGG + Intergenic
917108126 1:171515817-171515839 AATGATGACAACTATGGACCTGG + Exonic
918899569 1:190396549-190396571 ATTGATGGCCACTTTAGAACTGG - Intronic
920279296 1:204830726-204830748 TGTGGTTGCCACTGTGGAACAGG + Intronic
1064844954 10:19641516-19641538 AATGATGACCAATATGGTACTGG - Intronic
1068218994 10:54019428-54019450 TATGATGGTCCCCATGGGACAGG + Intronic
1069396139 10:67990992-67991014 AATGATGATCACTATAGAACAGG - Exonic
1073591669 10:104763581-104763603 TATGATGGCCACTCTCCATCAGG + Intronic
1074210894 10:111334012-111334034 TAGGATGGCCACTGTGGAGATGG + Intergenic
1076465166 10:130675492-130675514 TATGATGGCCAATAAGAATCTGG + Intergenic
1079149808 11:17887518-17887540 TATCATGGCTACTAGGGAAAGGG - Intronic
1080607674 11:33877148-33877170 TATGGTGGCCTCCATGGGACAGG + Intronic
1087385412 11:97463223-97463245 TATGAAAGTCACTTTGGAACTGG + Intergenic
1092605380 12:10112432-10112454 TCTGATGGCCACCATGTCACTGG - Intergenic
1094488279 12:30941996-30942018 TTTCATGGCCACTTGGGAACAGG + Intronic
1108193576 13:47968998-47969020 CAGTATGGACACTATGGAACTGG - Intronic
1109490970 13:63099879-63099901 TATGGAAGCCACTTTGGAACTGG + Intergenic
1109764302 13:66873480-66873502 TATCAAGCCCACAATGGAACAGG - Intronic
1109913627 13:68950294-68950316 AATGATTGCCAGTATGGAATAGG - Intergenic
1110609209 13:77470400-77470422 AAAGCTGGCCACTATGGAGCAGG + Intergenic
1115944317 14:38642950-38642972 TATGAAAGCAACTTTGGAACTGG + Intergenic
1117940071 14:60953800-60953822 TAGGATGGCTACTATGAAAAAGG - Intronic
1121717370 14:96085890-96085912 TTTGATGGCCATTTTGAAACAGG + Intronic
1121721166 14:96109619-96109641 TATCATGGCCACTGTGGGACAGG + Intergenic
1122365652 14:101193509-101193531 AATGAGGGCCACTATGGCAGTGG - Intergenic
1128763119 15:70232470-70232492 TCTGATGGCCACTCTGGGGCAGG - Intergenic
1142024486 16:87805102-87805124 TATGATGACCACTATGACATGGG - Intergenic
1144299384 17:13909398-13909420 TATGAAAGCAACTTTGGAACTGG + Intergenic
1144538623 17:16115849-16115871 TATGGAGGCGACTTTGGAACTGG - Intronic
1148712635 17:49692873-49692895 TCTGTTGGCCACTCTGGGACAGG + Intergenic
1151028938 17:70712752-70712774 TTTCATGGACACTATGGAAGAGG - Intergenic
1153181054 18:2434058-2434080 TATACTGGCCACTATGTAATTGG + Intergenic
1155811389 18:30240165-30240187 TCTGATGCCCACCATGGATCTGG + Intergenic
1156028770 18:32688825-32688847 TAGGAGGGCCACTGTGGAAGAGG + Intronic
1158003467 18:52645615-52645637 TATGATGTCCACAATGCACCTGG - Intronic
1165358730 19:35320457-35320479 CATGGTGGCTGCTATGGAACGGG - Intronic
925652788 2:6109545-6109567 AATGATGGCTACTCTGGAACAGG - Intergenic
927497495 2:23560751-23560773 GATGATGGCCACCAGGGCACAGG + Intronic
929050582 2:37833441-37833463 TAAAATGGCCACTGTGGAAATGG + Intergenic
934918408 2:98320420-98320442 TATGGAGGCAACTTTGGAACTGG + Intergenic
936987005 2:118321023-118321045 TATGATGGCCTTTAAGGAAATGG + Intergenic
940995194 2:160142149-160142171 TATGATTGCCTCTATTTAACTGG + Intronic
943297763 2:186160201-186160223 TATGAAAGCAACTTTGGAACTGG + Intergenic
943388689 2:187234078-187234100 TACCCTGGCCTCTATGGAACTGG + Intergenic
944860569 2:203812050-203812072 TATGATGGCATCTGTGGCACCGG + Intergenic
946962924 2:225003706-225003728 TAGGATGGCCATTAGGGATCAGG - Intronic
948924904 2:241089172-241089194 AATGATGGTCAGTATGAAACTGG - Exonic
1169643320 20:7779408-7779430 TATGGAGGCAACTTTGGAACTGG + Intergenic
1175824512 20:61929798-61929820 GAGGATGGCCACGATGGCACCGG - Exonic
1177532251 21:22375133-22375155 TGTGAAAGCCACTTTGGAACTGG - Intergenic
950881825 3:16328499-16328521 CTTGATAGCCACTCTGGAACTGG - Intronic
953969985 3:47339673-47339695 TATGATGTCCTGTATGTAACAGG - Intronic
959709029 3:109366536-109366558 TATGATGGCTACAATGTTACTGG + Intergenic
960294273 3:115924263-115924285 TTAGATGGCCACAATGGAAGAGG - Intronic
966057221 3:175709100-175709122 TACGATGGCCCCTGTAGAACTGG - Intronic
967359102 3:188609620-188609642 TATGAAGGCTACTATGCAGCAGG + Exonic
967558926 3:190895349-190895371 TGTGAAGGCAACTTTGGAACTGG + Intergenic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
971104383 4:23506555-23506577 AATGATGGCCACTCTGGATGGGG + Intergenic
972016514 4:34252714-34252736 TAATATGGCAAATATGGAACAGG - Intergenic
976645987 4:87387870-87387892 AATGATGGGGACTATTGAACCGG - Intronic
976840362 4:89425810-89425832 TCTAATGGCCACTATGAAACAGG - Intergenic
977435354 4:96988543-96988565 TGTGAAAGCCACTTTGGAACTGG + Intergenic
977600453 4:98929094-98929116 TAAGATGGCGACTGTCGAACCGG - Exonic
982521096 4:156417533-156417555 TATGAAAGCAACTTTGGAACTGG - Intergenic
987715471 5:21563703-21563725 TATGATGGCCACGATAGAGAAGG + Intergenic
990651864 5:57909312-57909334 TATGATGACCACTATTAATCTGG + Intergenic
993569651 5:89521650-89521672 TATGAAAGCCGCTTTGGAACAGG - Intergenic
993890031 5:93462535-93462557 TGTGAAGGCAACTTTGGAACTGG + Intergenic
994900532 5:105763533-105763555 TATGAAAGCAACTTTGGAACTGG - Intergenic
997762427 5:136462670-136462692 AATGATGGTTGCTATGGAACAGG - Intergenic
1001007785 5:168069541-168069563 TCTGAGGGCCACAATGTAACAGG + Intronic
1005010019 6:21327073-21327095 TATGATGGCTACGATGTCACTGG + Intergenic
1005095149 6:22106329-22106351 TAAGATGGATACTATGGAACTGG - Intergenic
1009001252 6:57718341-57718363 TATGATGGCCACGATAGAGAAGG - Intergenic
1010343056 6:74780031-74780053 TATGATGGATACTATGAAAATGG + Intergenic
1010835733 6:80585794-80585816 TATGGAAGCCACTTTGGAACTGG + Intergenic
1011076750 6:83446623-83446645 AATGATGACCACTATGACACAGG + Intergenic
1013536826 6:111070316-111070338 TATGATGGCTGGCATGGAACAGG + Intergenic
1015624156 6:135162840-135162862 AAGAATGGCCACTAGGGAACTGG - Intergenic
1017441842 6:154471856-154471878 TATGATGGCCACTATGGAACTGG - Intronic
1018452456 6:163921895-163921917 TCTGATGGGCACTAGGGAACTGG - Intergenic
1018864250 6:167735039-167735061 TGTGATGACCCCTTTGGAACTGG - Intergenic
1023235563 7:38082406-38082428 TATGGGGGCAACTTTGGAACTGG - Intergenic
1028301589 7:89207139-89207161 TGTGGAGGCCACTTTGGAACTGG - Intronic
1031949328 7:127875734-127875756 CAGGATGTCCACCATGGAACAGG - Intronic
1037189765 8:16109510-16109532 TGTCTTGGCCACTATGGACCAGG - Exonic
1038894851 8:31770883-31770905 CATGATGGACACTAGGTAACAGG - Intronic
1039480580 8:37870349-37870371 TACGATGGTGACTATGGAAACGG + Intronic
1042669084 8:71240949-71240971 TATGAATGACAGTATGGAACTGG - Intronic
1046433412 8:114156620-114156642 TGTGAAGGCAACTTTGGAACTGG - Intergenic
1048865736 8:138760314-138760336 TATGATGGGCACTACGGATACGG + Intronic
1049880421 8:145058289-145058311 TACCATGGCAACTATGGACCAGG - Intergenic
1056112592 9:83410324-83410346 AATGATGGCAACAATGAAACTGG - Intronic
1194069724 X:89306434-89306456 TTTCAAGGCCACCATGGAACTGG + Intergenic
1194542485 X:95191135-95191157 TATGAAGGTGACTTTGGAACTGG - Intergenic
1194919752 X:99750321-99750343 TGTGAAGGCAACTTTGGAACTGG + Intergenic
1197093521 X:122567308-122567330 TATCATGCCCACTATGGTAGAGG + Intergenic
1198943608 X:141985485-141985507 TATGGAGGCAACTTTGGAACTGG + Intergenic
1199326576 X:146505094-146505116 ACTGATGGCCACTTGGGAACTGG + Intergenic
1200723871 Y:6640575-6640597 TTTCAAGGCCACCATGGAACTGG + Intergenic