ID: 1017442216

View in Genome Browser
Species Human (GRCh38)
Location 6:154474897-154474919
Sequence CTGTGAGTGAGTCAGAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 304}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017442212_1017442216 5 Left 1017442212 6:154474869-154474891 CCTCCTGTGCCTGCTGACTTGAC 0: 1
1: 0
2: 1
3: 23
4: 262
Right 1017442216 6:154474897-154474919 CTGTGAGTGAGTCAGAAAGTTGG 0: 1
1: 0
2: 2
3: 25
4: 304
1017442215_1017442216 -4 Left 1017442215 6:154474878-154474900 CCTGCTGACTTGACAGTGGCTGT 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1017442216 6:154474897-154474919 CTGTGAGTGAGTCAGAAAGTTGG 0: 1
1: 0
2: 2
3: 25
4: 304
1017442213_1017442216 2 Left 1017442213 6:154474872-154474894 CCTGTGCCTGCTGACTTGACAGT 0: 1
1: 0
2: 1
3: 10
4: 163
Right 1017442216 6:154474897-154474919 CTGTGAGTGAGTCAGAAAGTTGG 0: 1
1: 0
2: 2
3: 25
4: 304
1017442211_1017442216 10 Left 1017442211 6:154474864-154474886 CCTTTCCTCCTGTGCCTGCTGAC 0: 1
1: 0
2: 4
3: 62
4: 646
Right 1017442216 6:154474897-154474919 CTGTGAGTGAGTCAGAAAGTTGG 0: 1
1: 0
2: 2
3: 25
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017442216 Original CRISPR CTGTGAGTGAGTCAGAAAGT TGG Intronic
901842836 1:11964621-11964643 CTGTGGGAGAGACAGAAAGCGGG - Intronic
902524665 1:17048591-17048613 CTGTGCCTGAGGCAGATAGTAGG + Intronic
902777780 1:18685650-18685672 CTGTGAGTGAGTGAGCCAGGTGG - Intronic
903759205 1:25685955-25685977 CAGTGAGTCAGTGAGAATGTTGG - Intronic
903827420 1:26156134-26156156 CTGGGAATGAGGCAGGAAGTAGG + Intergenic
905677925 1:39842638-39842660 GTATGAGTTAGTCAGAAGGTGGG - Intronic
906556711 1:46719440-46719462 CTGTGTGAGAGTCAGAGAGGCGG - Intergenic
906998102 1:50819621-50819643 GTGTGAGTGAGTCAGTCAGTCGG - Intronic
908186160 1:61654943-61654965 CTGGGGGTGTGTCTGAAAGTGGG - Intergenic
908448450 1:64225304-64225326 CTGTGAGAGAATCAGTAAGAAGG + Intronic
912041573 1:105397616-105397638 GTGTGAGGGAGAAAGAAAGTAGG + Intergenic
912939100 1:114029454-114029476 CTGTGAGTGCCTCATAAAGGAGG - Intergenic
914223040 1:145697310-145697332 GAGTGAGTGAGACAGAAAGGAGG + Intronic
914449177 1:147775507-147775529 CTGGGAGATAGTCTGAAAGTGGG + Intergenic
914695725 1:150077646-150077668 CTGTGGGTGAGAGAGAAAGATGG - Intronic
915309222 1:154999095-154999117 CTGAGAGTAACTGAGAAAGTTGG - Intergenic
915625178 1:157110022-157110044 GTGTGAGTTGGACAGAAAGTAGG - Intergenic
915916570 1:159944305-159944327 CAGTGAGTGAGTCAGGCACTTGG + Intronic
916269797 1:162928142-162928164 CAGTGAGGGAGGCAGGAAGTTGG + Intergenic
916979217 1:170115567-170115589 CTGTGAGTGACTCAGGAATCTGG - Intergenic
917320954 1:173780985-173781007 CTGTGAGTGAGAGAGAGAGAGGG + Intronic
917713222 1:177708606-177708628 CAGTGAGTCAGTCAGAGTGTTGG - Intergenic
917838926 1:178962052-178962074 CTGTGAGTTACTGAGATAGTGGG - Intergenic
918126157 1:181585816-181585838 CAGTGAGTGAGGCGGAAAGTAGG + Intronic
919274032 1:195389055-195389077 CAGTGATGGAGCCAGAAAGTGGG - Intergenic
919306666 1:195848669-195848691 ATGTGAGTGATCGAGAAAGTTGG + Intergenic
919942766 1:202299718-202299740 CTGTGAGTGAGACAGCATGAAGG + Intronic
920774547 1:208923403-208923425 CTGTGAGTGATACAGAAAAGGGG - Intergenic
921068792 1:211642198-211642220 CTGTGTGTGGGTCAGCAAGGTGG - Intergenic
921295009 1:213693253-213693275 ATATGAGTCAGTCAGAAAGGAGG - Intergenic
922095906 1:222442615-222442637 CTGGGAGAGAGTCAGAAGGATGG + Intergenic
922874059 1:228926181-228926203 CTGTGTGTGAGTGAGAAGGTAGG + Intergenic
923244088 1:232114212-232114234 CTCTGGGTGAGTCAGTGAGTGGG - Intergenic
923434007 1:233951369-233951391 CTCTGGGTGAGTCAGTGAGTGGG - Intronic
923635959 1:235696617-235696639 CTTTTAGTGAGTCAGTATGTGGG + Intronic
924800091 1:247323052-247323074 CTGTGTGGCAGTCAGAAAGCTGG + Intronic
924857181 1:247885196-247885218 CTCTGGGTGAGTCAGTGAGTGGG + Intergenic
1063347934 10:5328453-5328475 CAGTGGGAGAGTCAGACAGTGGG + Intergenic
1064315683 10:14253907-14253929 CTGTGAGAGAGAGAGAAAGCTGG - Intronic
1065444903 10:25788278-25788300 CTGTGAGTAAGGCAGAGAGTTGG + Intergenic
1065476542 10:26144403-26144425 CAATCAGTGAGTCAGAAAGAAGG - Intronic
1065686648 10:28291964-28291986 CTCTGGGTGAGTCAGTGAGTGGG - Intronic
1066441433 10:35443130-35443152 CTCTGGGTGAGTTAGCAAGTGGG + Intronic
1066806334 10:39259348-39259370 GTGTGAGCGATGCAGAAAGTGGG + Intergenic
1068232324 10:54184346-54184368 CTGTGACTGATTCAAAAATTGGG + Intronic
1068265424 10:54642212-54642234 CTGTCAATGAATCAGGAAGTAGG + Intronic
1070972821 10:80581582-80581604 CTGTGAGTGACACAGCAAGAAGG + Intronic
1072502498 10:96032121-96032143 CTGTAAGTGAATCAAAAATTGGG - Exonic
1073485184 10:103812731-103812753 GTGTGAGTGTGTCAGATGGTGGG - Intronic
1074917759 10:117973985-117974007 CTGTCTGTGAGCCAGAAATTAGG - Intergenic
1075861816 10:125683572-125683594 CTGTGAGTGAGTCCTGAGGTTGG - Intergenic
1076026168 10:127115291-127115313 CTGTGTGTGAGTCAGTGAATGGG + Intronic
1076158130 10:128219431-128219453 GTGTGAGTGAGTGAGTGAGTGGG - Intergenic
1078152809 11:8773559-8773581 TTGAGACAGAGTCAGAAAGTGGG + Intronic
1078778970 11:14419315-14419337 CAGTGAGTGTGTCAGGAAGCCGG + Intergenic
1078899163 11:15625459-15625481 CTGTGAGTGAGTCAGGAACAAGG + Intergenic
1079498190 11:21070101-21070123 CTTGGAGTGACTCAGTAAGTAGG - Intronic
1081343833 11:41958235-41958257 ATGTCAGTGAGTCATAAATTTGG - Intergenic
1083259921 11:61517372-61517394 CTGTGAGTGAGTCGGGCAGAAGG + Intronic
1083828464 11:65216531-65216553 CGGTGAGTGAGTGAGTGAGTGGG + Intergenic
1083847817 11:65346212-65346234 AAGTGAGTGAGACAGACAGTCGG - Intronic
1087273519 11:96137671-96137693 GTGTGAGTGTGTCTGAAAGACGG + Intronic
1087833050 11:102840486-102840508 CTGTGAGTGAGTGATAGAGTGGG + Exonic
1090225719 11:125071094-125071116 CTGTTAGTGACTCAGATAGGAGG - Intronic
1093563400 12:20571532-20571554 CTGAGAGTTAATCAGAATGTAGG - Intronic
1094416293 12:30219174-30219196 CTCTGGGTGAGTCAGTGAGTGGG - Intergenic
1095222785 12:39637408-39637430 TTGGGAGTGAGCTAGAAAGTGGG - Intronic
1100164687 12:91903007-91903029 CTTTGAGTGTGACAGAAACTTGG - Intergenic
1100527335 12:95432115-95432137 CTGTGAGGAAGTCAGAAGGCAGG + Intergenic
1101576385 12:106000900-106000922 GTGTGAATGAGTCAGTGAGTTGG - Intergenic
1102673645 12:114641130-114641152 CTGTGTGTGAGACACACAGTGGG + Intergenic
1103365189 12:120377132-120377154 CAGTGAGAAAGTGAGAAAGTGGG - Intergenic
1103593480 12:122008783-122008805 GGGTGACTGAGTCAGAAAGGTGG - Intergenic
1104160795 12:126178948-126178970 TTGTGTGAGAGTCAGAAACTGGG - Intergenic
1104825679 12:131707604-131707626 CTCTGGCTGAGACAGAAAGTAGG - Intergenic
1104827173 12:131720578-131720600 CAGTGAGTGATTCAGGATGTGGG - Intronic
1106138375 13:26991263-26991285 CTGTGAGACAGTAAGACAGTTGG + Intergenic
1106372749 13:29152573-29152595 ATGTGAGTGAGCTTGAAAGTGGG - Intronic
1106922201 13:34575558-34575580 CAGAGAGTGAGTCACAAAGAGGG + Intergenic
1106976003 13:35216386-35216408 CTGTGACTGAGTTAAATAGTTGG + Intronic
1107384757 13:39895987-39896009 CTGAGAGTGAGAAAGAAGGTGGG + Intergenic
1107801097 13:44108681-44108703 CTATGAAGGAGTCATAAAGTTGG + Intergenic
1109641498 13:65197970-65197992 CTGTGAAAGAGCCAGAAATTAGG + Intergenic
1110080547 13:71304649-71304671 CTGTGATTGAGGAATAAAGTGGG + Intergenic
1110360902 13:74624370-74624392 CAGTAATTGAGTCAGCAAGTAGG + Intergenic
1110698613 13:78520666-78520688 TTGTGAGAGAGTCAGTGAGTAGG - Intergenic
1110751664 13:79122021-79122043 CTGTGAGTCAGGCAGTAAATGGG - Intergenic
1111852983 13:93600585-93600607 GAGTGAGTGAGTTAGAGAGTGGG + Intronic
1113023903 13:105919498-105919520 CTGTGAGTGAGTTTGGAGGTGGG - Intergenic
1113694476 13:112334316-112334338 CTCTGGGTGAGTCAGGGAGTGGG - Intergenic
1115355055 14:32438211-32438233 CTGTGAGTGGTTCAGAAATCTGG + Intronic
1115917558 14:38332832-38332854 CTTTGAGTGAGTAAGAAGATAGG - Intergenic
1115948282 14:38690120-38690142 CTGGGACTGAGTCAGGAAATAGG + Intergenic
1117959410 14:61148248-61148270 CTGTGAGGGAGTCACAAAACTGG - Intergenic
1122092412 14:99349164-99349186 TTGTGAGGGAGTCAGAAAATGGG - Intergenic
1123798278 15:23795582-23795604 CTGAGAGTGAGTCAAACAGTTGG + Intergenic
1123802446 15:23835297-23835319 CTGAGAGTAAGTCAAATAGTTGG + Intergenic
1125347588 15:38733681-38733703 CTGTCAGTGAGCCAGGAAGTGGG - Intergenic
1126459272 15:48897746-48897768 GTGTGTGTGTGTCAGAAGGTGGG - Intronic
1128553713 15:68615725-68615747 CCATCAGTGAATCAGAAAGTGGG + Intronic
1128703433 15:69821122-69821144 CTGGGAGGGAGGCAGAAAGGAGG + Intergenic
1128783669 15:70379336-70379358 CTGTGTGTGATTCGGAAAGTAGG - Intergenic
1131868585 15:96738229-96738251 CAATGAGTGAGGCAGGAAGTAGG - Intergenic
1134739168 16:16527193-16527215 CTGTGAGTGAGTCACTGTGTGGG + Intergenic
1134928333 16:18184958-18184980 CTGTGAGTGAGTCACTGTGTGGG - Intergenic
1138298562 16:55907929-55907951 CAGTGAGTGGGACAGAAAGAGGG - Intronic
1138837995 16:60461222-60461244 AAATGAGTGAGTTAGAAAGTTGG - Intergenic
1138898917 16:61244652-61244674 CTGAGAGGGAGTCCGAAAGCGGG + Intergenic
1139371830 16:66473790-66473812 CTGTGAGTGTGTCTGACAGGTGG - Intronic
1141749709 16:85950138-85950160 CTGTGGGTGAGGGAGGAAGTAGG + Intergenic
1141791846 16:86242455-86242477 GTGTGAGTGTGTCAGAGTGTGGG - Intergenic
1142442416 16:90107499-90107521 TTGTGTGTTATTCAGAAAGTCGG + Intergenic
1143276055 17:5711686-5711708 CAGTATGTGAGTCAGAAATTAGG - Intergenic
1143412936 17:6723028-6723050 CGGTGAGTGAGGTGGAAAGTCGG - Intergenic
1143895449 17:10132868-10132890 CTGTGAGTCAGTTTGAAAGAAGG - Intronic
1144068325 17:11644004-11644026 CTGTAGGTGAGTCAGTGAGTGGG + Intronic
1144141326 17:12351727-12351749 TGCTGAGTGAGTCAGACAGTAGG + Intergenic
1145738940 17:27255892-27255914 CTGTGAAAGAGACAGAAAGAGGG + Intergenic
1147211541 17:38875077-38875099 GTGTGTGTGTGTGAGAAAGTGGG + Intronic
1147259782 17:39202570-39202592 CTGTGTGCAAATCAGAAAGTTGG + Intronic
1148198602 17:45732862-45732884 CTGTGTGTGAGGCAGACAATGGG + Intergenic
1148902776 17:50890935-50890957 CTTTTGGTGAGTCAGATAGTGGG - Intergenic
1148941320 17:51214616-51214638 TTGTGATTGAGTCAGGAATTGGG - Intronic
1149329480 17:55566701-55566723 ATGTGAGGGAGACAGAAAGAAGG + Intergenic
1149856668 17:60088715-60088737 CTGTGAGTGACTGAGAAAAAGGG + Intergenic
1150064443 17:62097172-62097194 CTGTGAGTGGCATAGAAAGTGGG - Intergenic
1150328129 17:64273231-64273253 GTGTGAGTGCCTCAGAAAGAAGG - Intergenic
1152137354 17:78512347-78512369 CTCTGAGTGAGTGTGAAATTTGG - Intronic
1152710122 17:81867226-81867248 CTGTGGCTGAGGCAGGAAGTAGG - Intergenic
1152858180 17:82678371-82678393 CACTGAGTGAGTCAGAAAACAGG + Intronic
1153200681 18:2644554-2644576 CAGTGAGTGATTTAAAAAGTTGG + Intergenic
1153566627 18:6425532-6425554 CTCTGAGTGAGCCAGTGAGTGGG - Intergenic
1154366327 18:13712644-13712666 CTGTCTGTGAGCCAGCAAGTGGG + Intronic
1155038003 18:22041645-22041667 CTGTGGGTGGGTCAAGAAGTTGG - Intergenic
1155050533 18:22143549-22143571 CTGTCAGTGGGTCAGCAGGTCGG - Intergenic
1155829879 18:30500697-30500719 CTGTCTGTGAACCAGAAAGTGGG + Intergenic
1156499345 18:37547312-37547334 CTGTGGCTGAGTGAGAAAGAAGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158361561 18:56679417-56679439 TTGTGAGTGCATCTGAAAGTGGG + Exonic
1158630506 18:59109994-59110016 CTGAGAATGAGTCTGAAATTGGG - Intergenic
1159696082 18:71557757-71557779 CTGTCAATGAGTTATAAAGTGGG + Intergenic
1160253737 18:77228466-77228488 CTGTGAGTGAATAAGACAGATGG + Intergenic
1160305328 18:77728687-77728709 ATGTGAGAGAGGGAGAAAGTGGG + Intergenic
1162473636 19:10887173-10887195 CTGTGGAGGAGTCAGAGAGTGGG - Intronic
1162884721 19:13688116-13688138 AGGTGAGTGAATAAGAAAGTGGG - Intergenic
1164913089 19:32027920-32027942 CAGTGAGTGAGTGACAGAGTGGG - Intergenic
1166395066 19:42433609-42433631 CTGAGAGTCAGGAAGAAAGTGGG + Intronic
925706021 2:6685331-6685353 GTGTGAGGGAGAGAGAAAGTGGG + Intergenic
926933901 2:18067683-18067705 CTGTTTGTGAACCAGAAAGTGGG + Intronic
927015775 2:18960150-18960172 CTCTGAGTAAGTCAGTGAGTGGG - Intergenic
927230100 2:20814210-20814232 CTGTCAGTGAGTCTGACAATGGG + Intronic
928411758 2:31059790-31059812 CTGTGTATGAGCCAGAAAGCAGG + Intronic
928767167 2:34661153-34661175 CAGTAACTGAGTCAGAAACTTGG + Intergenic
929448088 2:42015941-42015963 CTGTCTGTGAATCAGAAAGTGGG - Intergenic
929732996 2:44515603-44515625 CAGTGAGTGAGTCAGTGATTTGG + Intronic
934659943 2:96138030-96138052 CTGAGAGAGAGTCATAAGGTGGG - Intronic
935537148 2:104308082-104308104 CTGTTTATGAGCCAGAAAGTGGG - Intergenic
936143872 2:109965898-109965920 CTGTCTGTGAACCAGAAAGTGGG + Intergenic
936180554 2:110263859-110263881 CTGTCTGTGAACCAGAAAGTGGG + Intergenic
936200815 2:110405571-110405593 CTGTCTGTGAACCAGAAAGTGGG - Intronic
936521846 2:113216416-113216438 CTGGGATTGAGTCAGATAGAAGG - Exonic
937469020 2:122159327-122159349 CTGTGATGGAGCCAGAAAGGAGG + Intergenic
937519417 2:122693419-122693441 CGGTGAGTGGATCACAAAGTCGG - Intergenic
939525726 2:143291401-143291423 CTGTGAGTGAGTGAGTGAGGAGG - Intronic
942241442 2:173965958-173965980 CTGTGACTGAATCAGGAAGCTGG - Intergenic
944071505 2:195674977-195674999 CTGTGAGTGAGTCAGTGAGTGGG + Intronic
944559780 2:200924642-200924664 ATGTGAGTATGTCAGAAAATTGG - Intronic
945906079 2:215594947-215594969 CTCTGGGTGAGTCAGTGAGTGGG - Intergenic
945984691 2:216344208-216344230 CTGTGGATGAGTTAAAAAGTTGG - Intronic
946284672 2:218693978-218694000 TTGTGGGTAAGTCATAAAGTAGG + Exonic
946302866 2:218834998-218835020 CTGCGAGTGAGCCAAGAAGTAGG - Intergenic
947502840 2:230683804-230683826 TTGTGAGTGGGTAAGAAAGGAGG + Intergenic
948128811 2:235585019-235585041 CTCTCAGAGAGTCAGAAAGAAGG - Intronic
948545547 2:238726049-238726071 CTATCTGTGAGCCAGAAAGTGGG + Intergenic
948831488 2:240600533-240600555 CTGTGGGTGAGTCAGGAGGGTGG - Intronic
1169057956 20:2639295-2639317 CTCTGGGTGAGTCAGTGAGTGGG - Intronic
1170544087 20:17418564-17418586 CTGTGGTTGGGTCAGAAACTGGG + Intronic
1174125477 20:48301634-48301656 CTCTAAGTGAAGCAGAAAGTTGG + Intergenic
1174344512 20:49920082-49920104 ATGTTATTGAGCCAGAAAGTAGG + Intergenic
1174782519 20:53402817-53402839 AAGTGAGTGAGTCAGAAAGGAGG + Intronic
1176137419 20:63530340-63530362 CCGTGCGTGGGTCAGACAGTGGG - Intronic
1177942263 21:27425305-27425327 CTGTGTGTGTGGCAGAAAGGGGG + Intergenic
1179073331 21:38093926-38093948 CTTTGAGTGGGGTAGAAAGTAGG + Intronic
1181158054 22:20937159-20937181 CTGTGTGTGGGTGAGAAAGCTGG - Intronic
1183581829 22:38730924-38730946 GTGTGAGTGAGGAAGAAGGTGGG - Exonic
1184295767 22:43523854-43523876 ATATGATTGAGTCAGAAATTTGG - Intergenic
1184600475 22:45540448-45540470 CTGAGCGTAAGTCAGAAAGGAGG - Intronic
950003762 3:9678012-9678034 CAGAGAGTGAGTCAGGAAGTCGG - Exonic
950104764 3:10381083-10381105 CTCTGAGTCACCCAGAAAGTGGG - Intronic
950637284 3:14324008-14324030 CTGTGGGTCACACAGAAAGTGGG + Intergenic
952979483 3:38723305-38723327 CTGGGAGTGAGGCAGCAAGTGGG + Intronic
953025559 3:39142946-39142968 CTGTGGGTGAGCCAGCCAGTGGG + Exonic
955076904 3:55622282-55622304 CTGGGAATGAGTCAGAAATGTGG + Intronic
957021103 3:75127503-75127525 CTCTGGGTGAGTCAGTGAGTAGG - Intergenic
959079348 3:101783592-101783614 CTGTCAGTGATGCAGAAAGAAGG - Intronic
959417433 3:106092979-106093001 CTCTGGGTGAGTCAGAGAGTGGG + Intergenic
960116875 3:113903726-113903748 CTGAGACTGAGTCAGAAGGAAGG + Intronic
960573191 3:119205535-119205557 CTGTGAGTGAGGCTGAGCGTGGG + Intergenic
960881581 3:122351007-122351029 CTCTGGGTGAGTCAGTGAGTGGG - Intergenic
961004035 3:123392696-123392718 CTGAGAAAGAGACAGAAAGTTGG - Intronic
961197279 3:125013370-125013392 TTGTTTGTGAGACAGAAAGTGGG + Exonic
961781255 3:129321701-129321723 GTGTGAATGTGTAAGAAAGTGGG - Intergenic
962364017 3:134765465-134765487 CTGTGAGTGAGTGAATAAGGGGG + Intronic
962373719 3:134842193-134842215 CTGTCTATGAATCAGAAAGTGGG + Intronic
963523021 3:146380143-146380165 CTGTTAGTGAGTTGGAAAGTGGG - Intergenic
964981746 3:162691023-162691045 CTGTGTCTGAGTCTGAAAGAAGG - Intergenic
965103474 3:164332539-164332561 CTGTGAGGGAGAGAGGAAGTGGG + Intergenic
965868113 3:173230763-173230785 CTCTGGGTGAGTCAGTGAGTGGG + Intergenic
966143146 3:176779600-176779622 CTGTGAGTGAGTTAAAAATTTGG + Intergenic
968291743 3:197544511-197544533 CAGTGAGTGATTCATAAAGATGG - Intronic
968362688 3:198158459-198158481 TTGTGTGTTATTCAGAAAGTCGG + Intergenic
969328469 4:6458382-6458404 CTGTTTGAGAGTCAGGAAGTTGG - Intronic
969539256 4:7776173-7776195 TTGTGAGGGAGTCAGACACTTGG - Intronic
970139990 4:12971633-12971655 CTGTCTGTGAGACATAAAGTAGG - Intergenic
971267862 4:25110806-25110828 CTGAGAGGGAGTCAAAAGGTAGG + Intergenic
972275964 4:37558219-37558241 ACCTGAGTGAGTCAGAAAGAAGG - Intronic
973259514 4:48148038-48148060 CTATAAGAGAGACAGAAAGTAGG + Intronic
977314856 4:95433092-95433114 CTGTCAGTGTGGCAGAAAGGAGG - Intronic
978780762 4:112550923-112550945 CTGTGGCTGAGTCAGTGAGTGGG - Intronic
979458360 4:120951805-120951827 CTGTGTGTGAGAGAGAGAGTAGG - Intergenic
979516293 4:121613839-121613861 CAATGAATGAGGCAGAAAGTGGG - Intergenic
981249263 4:142579762-142579784 ATCTGAGTGAGTCAGCAAGCAGG - Intronic
981436768 4:144732830-144732852 TCTTGAATGAGTCAGAAAGTGGG + Intronic
982693690 4:158575639-158575661 CTGTCTGTGAACCAGAAAGTGGG + Intronic
982952824 4:161721568-161721590 CTCAGATTGAGGCAGAAAGTAGG + Intronic
983912546 4:173256171-173256193 CAGTGAGTGAGTCTTAAAGCCGG - Intronic
983975825 4:173932965-173932987 CTTTGAGTGCCTCTGAAAGTTGG + Intergenic
984381954 4:179005691-179005713 CTGAGAGTGAGGGAGAAAGGTGG + Intergenic
984784344 4:183554051-183554073 GTGTGGGTGAGTCTGAATGTGGG + Intergenic
985584993 5:726317-726339 CTGTGAGTGAGTCTATAAGGTGG + Intronic
985598497 5:810632-810654 CTGTGAGTGAGTCTATAAGGTGG + Intronic
986281695 5:6328515-6328537 CAGTGAAGGAGTCAGAGAGTGGG - Intergenic
986642434 5:9885725-9885747 CGGCCACTGAGTCAGAAAGTTGG + Intergenic
987484481 5:18507301-18507323 CTCTGGGTGAGTCAGTGAGTTGG + Intergenic
987519869 5:18967829-18967851 CTCTGGGTGAGTCAGTGAGTGGG + Intergenic
987886966 5:23825369-23825391 CTGTGGGTGAGTCAGCAAGTGGG + Intergenic
988109824 5:26805508-26805530 CTGTGATATAGTCAGAAACTTGG + Intergenic
988660024 5:33255769-33255791 TTGTGAGGGAGTGAGGAAGTAGG - Intergenic
988821236 5:34888163-34888185 CTGTCAATGAATCAGGAAGTGGG + Intronic
989288640 5:39734523-39734545 CTGTGACTTACTCAGAAACTAGG - Intergenic
989860592 5:46371421-46371443 CTGTGAGTGAGGCAGAAGATGGG + Intergenic
990255806 5:53967699-53967721 ATGTGAGTGAGGCTGAAACTAGG + Intronic
990661532 5:58020937-58020959 CAGTCTGTGAGCCAGAAAGTGGG + Intergenic
991917872 5:71623353-71623375 ATGGGAGTGAGCCAGGAAGTGGG - Intronic
993025911 5:82646073-82646095 CTCTGAGTCAGACAGAAAGAGGG + Intergenic
993273548 5:85826653-85826675 CTGTGGAAGAGTGAGAAAGTAGG + Intergenic
993534995 5:89072905-89072927 CTGTGCGTGATTCATAACGTGGG - Intergenic
993793070 5:92231700-92231722 ATGTGAGTGAGTGTGAAAGAAGG - Intergenic
994178146 5:96734465-96734487 CTGTGATAGAATAAGAAAGTGGG + Intronic
997225846 5:132208860-132208882 CAGTGAGTGAAGCAAAAAGTGGG + Intronic
997559961 5:134837683-134837705 CTGTCTGTGAATCAGAAAGCTGG + Intronic
1001453440 5:171843328-171843350 CTGTGTTCGAGGCAGAAAGTAGG - Intergenic
1003180075 6:3783626-3783648 CTGAGAGCGAGTCAGAAACGCGG - Intergenic
1003924769 6:10867432-10867454 CTCTGATTGAGTCAGTGAGTGGG - Intronic
1003944873 6:11065682-11065704 CTGTGAGGGAGTGAGGAAGCAGG - Intergenic
1004238375 6:13896031-13896053 CTATAAGTCAGTCTGAAAGTGGG - Intergenic
1004524765 6:16396702-16396724 CTCTGGGTGAGTCAGTGAGTGGG - Intronic
1004540849 6:16548300-16548322 CTCTGGGTGAGTCAGTGAGTGGG + Intronic
1004898764 6:20174548-20174570 CTCTGAGTGAGTCAGTGAGAGGG + Intronic
1004948794 6:20645148-20645170 CTCTGGGTGAGTCAGTGAGTGGG + Intronic
1006434449 6:34018994-34019016 CAGTGAGGGTGTCAGAAAGAGGG + Intronic
1007175273 6:39892126-39892148 GTGTGAGCCATTCAGAAAGTAGG + Intronic
1007331995 6:41119117-41119139 CTCTGACTAAGTCAGAAAGCAGG - Intergenic
1008450088 6:51641183-51641205 ATGTGAGTGAGTCATGAAGTAGG - Intronic
1008830981 6:55761536-55761558 CTGTGAGTGAAACAGCAAGGAGG - Intronic
1009475654 6:64087981-64088003 GAGTGTGTGAGCCAGAAAGTAGG - Intronic
1009480264 6:64148596-64148618 CTGTCAGTGAGGCAAACAGTTGG - Intronic
1012889614 6:104883351-104883373 CTATCATTGAGACAGAAAGTAGG - Intergenic
1015613315 6:135049211-135049233 CTGTCTGTGAGCCAGAAAGCGGG - Intronic
1016130514 6:140462748-140462770 TTGTAAGTGAGTCAGAAACATGG + Intergenic
1016422114 6:143896288-143896310 CAGTGAGTGAATGAGCAAGTGGG + Intronic
1017442216 6:154474897-154474919 CTGTGAGTGAGTCAGAAAGTTGG + Intronic
1018966624 6:168495194-168495216 CTCTGAGTGAGTCACAAAGGAGG + Intronic
1019252995 7:30252-30274 TTGTGTGTTATTCAGAAAGTCGG - Intergenic
1019676537 7:2316788-2316810 CAGTGAGTGAGTGAGTGAGTGGG - Intronic
1020390251 7:7649912-7649934 CTGTCTGTGAACCAGAAAGTGGG + Intronic
1020447258 7:8282308-8282330 TTTTGAGTGAGGCCGAAAGTGGG + Intergenic
1022061412 7:26799627-26799649 ATGTGAGTGATGCTGAAAGTGGG - Intronic
1022752652 7:33246856-33246878 TTGTGAGTGTGTCAGAATCTGGG - Intronic
1023603412 7:41903815-41903837 CTGTATGTGAACCAGAAAGTGGG - Intergenic
1024152323 7:46584707-46584729 TTGTGAGTGAAGGAGAAAGTTGG + Intergenic
1028185177 7:87775593-87775615 CTCAAAGTGAGTCAGTAAGTGGG - Intronic
1030001143 7:105064117-105064139 GTGTGATTGGGACAGAAAGTGGG + Intronic
1033927686 7:146483964-146483986 CTCTGGGTGAGTCAGTGAGTGGG - Intronic
1034371837 7:150605650-150605672 CTGTGAGTGACACAGAAGATGGG + Intergenic
1034974054 7:155437689-155437711 CTGTTAGTGAGGCAGGAAGCTGG - Intergenic
1035267824 7:157701655-157701677 TTGTGAGTGGGTCAGAGTGTAGG - Intronic
1036918315 8:12826708-12826730 CTTTCTGTGAATCAGAAAGTGGG - Intergenic
1038414934 8:27388234-27388256 CTCTGAGTGGGTCACAAAGTTGG - Intronic
1039410069 8:37347070-37347092 CTCTGGGTGAGTCAGTGAGTGGG - Intergenic
1039470359 8:37809625-37809647 CTGCGAGTGGGTCAGAGGGTGGG + Intronic
1039833416 8:41236115-41236137 CTGTCAGTGAGTCAGAGACCTGG + Intergenic
1041726029 8:61018068-61018090 CTGTGAGTCAGGCAGAGTGTGGG + Intergenic
1042409050 8:68441325-68441347 CTGAAAGTCAGTCAGAAAATAGG - Intronic
1042487972 8:69367419-69367441 TTGTGGAGGAGTCAGAAAGTCGG + Intergenic
1043403621 8:79908469-79908491 CTATGAGTGAGTCATAGCGTTGG + Intergenic
1043981052 8:86639997-86640019 CTGTGAGTGATTAAGAAAAATGG + Intronic
1044091077 8:88002382-88002404 CTATTTGTGAGCCAGAAAGTAGG + Intergenic
1044965094 8:97566822-97566844 TTGTGAGTTAGACAGGAAGTGGG + Intergenic
1047787297 8:128166281-128166303 CTGTGAGTGATTGACAGAGTAGG + Intergenic
1048542140 8:135352232-135352254 CTCTGTGTGAGTCAGGAAGAAGG - Intergenic
1048568636 8:135630842-135630864 CTGTGGGTGAGTGAGTGAGTGGG + Intronic
1048975948 8:139673154-139673176 GTGTGATAGAGACAGAAAGTAGG + Intronic
1049547182 8:143238307-143238329 CTCTGAGTGAGTCCGTTAGTGGG + Intergenic
1050278019 9:4020120-4020142 AGGTGAGAGAGTCAGAAAGTGGG + Intronic
1054881609 9:70150048-70150070 TTGTGAGTGACTCAGAAAGCTGG + Intronic
1055913377 9:81375757-81375779 CTGTCATTGGTTCAGAAAGTTGG - Intergenic
1056937954 9:90932200-90932222 TTGTAAGTGAGTCAGAAAACAGG + Intergenic
1056961451 9:91127834-91127856 CTCTGGGTGAGTCAGTGAGTGGG - Intergenic
1057560508 9:96124653-96124675 ATGTGCCTTAGTCAGAAAGTAGG - Intergenic
1058698953 9:107585315-107585337 CAGTGAGTGAGCCAGAGGGTTGG - Intergenic
1058806067 9:108593393-108593415 GTGTGAGTGAGCCAGAGAGCGGG - Intergenic
1058961506 9:109996641-109996663 CTGAGAGTGGGTCAGAAAACTGG - Intronic
1059451387 9:114373225-114373247 TTCTGAGTGAGGCAGGAAGTGGG - Intronic
1059700229 9:116768730-116768752 CTGTCTGTGAGCTAGAAAGTGGG + Intronic
1060137077 9:121167825-121167847 CTGTAAGAGAGTCACACAGTTGG - Intronic
1060533798 9:124366653-124366675 CTCTGGGTGAGTCAGTGAGTGGG - Intronic
1061761673 9:132855958-132855980 CTGTGATTGATTCAGAGTGTTGG + Intronic
1061848811 9:133402855-133402877 CTGTGGGTGAGCCAGAATGAGGG - Intronic
1062187500 9:135225947-135225969 CTGTGAGTGTGTGAGCACGTGGG - Intergenic
1062747375 9:138222122-138222144 TTGTGTGTTATTCAGAAAGTCGG + Intergenic
1203653454 Un_KI270752v1:921-943 CTGGGAGTGGGTAAGATAGTTGG + Intergenic
1187030699 X:15485285-15485307 CTGTGTCTGAACCAGAAAGTTGG - Intronic
1187479270 X:19640119-19640141 TTGTCAGGGAGTGAGAAAGTAGG - Intronic
1189202169 X:39205712-39205734 CAGTGAGTGATTAACAAAGTGGG + Intergenic
1190455775 X:50626591-50626613 CTGAGAGTGATTCAGTAAGTGGG - Intronic
1192863831 X:75108217-75108239 CTGTCTGTGAGTCAGGAACTAGG - Intronic
1193458633 X:81762113-81762135 CTGTCTGTGAATCAGAAAGTGGG - Intergenic
1194865739 X:99063904-99063926 CTGCAAGTGGGTCAAAAAGTGGG + Intergenic
1197525631 X:127559048-127559070 CTGTGAGTCAGTGATTAAGTGGG + Intergenic
1198174861 X:134145227-134145249 CGGTGGGAGAGTGAGAAAGTAGG - Intergenic
1198382280 X:136095149-136095171 CTCTGGGTGAGTCAGTGAGTGGG + Intergenic