ID: 1017444253

View in Genome Browser
Species Human (GRCh38)
Location 6:154493064-154493086
Sequence TCAGTGTTTTGGGGAGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017444253_1017444259 9 Left 1017444253 6:154493064-154493086 CCAATAGCTCCCCAAAACACTGA 0: 1
1: 0
2: 0
3: 19
4: 192
Right 1017444259 6:154493096-154493118 AAAGTACTGATCAGGTCTCTAGG 0: 1
1: 0
2: 0
3: 5
4: 123
1017444253_1017444260 10 Left 1017444253 6:154493064-154493086 CCAATAGCTCCCCAAAACACTGA 0: 1
1: 0
2: 0
3: 19
4: 192
Right 1017444260 6:154493097-154493119 AAGTACTGATCAGGTCTCTAGGG No data
1017444253_1017444257 1 Left 1017444253 6:154493064-154493086 CCAATAGCTCCCCAAAACACTGA 0: 1
1: 0
2: 0
3: 19
4: 192
Right 1017444257 6:154493088-154493110 TGTAAGCCAAAGTACTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017444253 Original CRISPR TCAGTGTTTTGGGGAGCTAT TGG (reversed) Intronic