ID: 1017447704

View in Genome Browser
Species Human (GRCh38)
Location 6:154523122-154523144
Sequence GTAGACACTCAACTCCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017447704_1017447706 -1 Left 1017447704 6:154523122-154523144 CCAACAAGGAGTTGAGTGTCTAC No data
Right 1017447706 6:154523144-154523166 CCACCAGCTCCTACTGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017447704 Original CRISPR GTAGACACTCAACTCCTTGT TGG (reversed) Intergenic
No off target data available for this crispr