ID: 1017462325

View in Genome Browser
Species Human (GRCh38)
Location 6:154663043-154663065
Sequence TGGTACAAGAGCCCTTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017462325_1017462332 4 Left 1017462325 6:154663043-154663065 CCAACCCAAGGGCTCTTGTACCA No data
Right 1017462332 6:154663070-154663092 GAAAAGGAATAATGTTTCAGAGG No data
1017462325_1017462333 5 Left 1017462325 6:154663043-154663065 CCAACCCAAGGGCTCTTGTACCA No data
Right 1017462333 6:154663071-154663093 AAAAGGAATAATGTTTCAGAGGG No data
1017462325_1017462334 15 Left 1017462325 6:154663043-154663065 CCAACCCAAGGGCTCTTGTACCA No data
Right 1017462334 6:154663081-154663103 ATGTTTCAGAGGGAATGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017462325 Original CRISPR TGGTACAAGAGCCCTTGGGT TGG (reversed) Intergenic
No off target data available for this crispr