ID: 1017463353

View in Genome Browser
Species Human (GRCh38)
Location 6:154672089-154672111
Sequence TTGCAGAGGCTGACCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017463348_1017463353 6 Left 1017463348 6:154672060-154672082 CCTAAAACTGTCTCTTTCTTTCA No data
Right 1017463353 6:154672089-154672111 TTGCAGAGGCTGACCCAGGAGGG No data
1017463346_1017463353 27 Left 1017463346 6:154672039-154672061 CCCAACAGGTTCTGGTAGATGCC No data
Right 1017463353 6:154672089-154672111 TTGCAGAGGCTGACCCAGGAGGG No data
1017463347_1017463353 26 Left 1017463347 6:154672040-154672062 CCAACAGGTTCTGGTAGATGCCT No data
Right 1017463353 6:154672089-154672111 TTGCAGAGGCTGACCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017463353 Original CRISPR TTGCAGAGGCTGACCCAGGA GGG Intergenic
No off target data available for this crispr