ID: 1017465628

View in Genome Browser
Species Human (GRCh38)
Location 6:154691213-154691235
Sequence TCTGAATTGTCAGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017465626_1017465628 -3 Left 1017465626 6:154691193-154691215 CCAAATGGTAAGAAATTTAATCT No data
Right 1017465628 6:154691213-154691235 TCTGAATTGTCAGCCAGGTGCGG No data
1017465623_1017465628 28 Left 1017465623 6:154691162-154691184 CCTTAAATCTTTTTCTGGGAACC No data
Right 1017465628 6:154691213-154691235 TCTGAATTGTCAGCCAGGTGCGG No data
1017465625_1017465628 7 Left 1017465625 6:154691183-154691205 CCTCATCTCACCAAATGGTAAGA No data
Right 1017465628 6:154691213-154691235 TCTGAATTGTCAGCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017465628 Original CRISPR TCTGAATTGTCAGCCAGGTG CGG Intergenic
No off target data available for this crispr