ID: 1017467705

View in Genome Browser
Species Human (GRCh38)
Location 6:154710170-154710192
Sequence AAGTATCCCCTGTGAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017467705_1017467706 -6 Left 1017467705 6:154710170-154710192 CCTGTTATTCACAGGGGATACTT No data
Right 1017467706 6:154710187-154710209 ATACTTTCCAAGACCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017467705 Original CRISPR AAGTATCCCCTGTGAATAAC AGG (reversed) Intergenic
No off target data available for this crispr