ID: 1017467706

View in Genome Browser
Species Human (GRCh38)
Location 6:154710187-154710209
Sequence ATACTTTCCAAGACCCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017467705_1017467706 -6 Left 1017467705 6:154710170-154710192 CCTGTTATTCACAGGGGATACTT No data
Right 1017467706 6:154710187-154710209 ATACTTTCCAAGACCCCCAGTGG No data
1017467704_1017467706 -5 Left 1017467704 6:154710169-154710191 CCCTGTTATTCACAGGGGATACT No data
Right 1017467706 6:154710187-154710209 ATACTTTCCAAGACCCCCAGTGG No data
1017467699_1017467706 14 Left 1017467699 6:154710150-154710172 CCAGAGAAGAACAGTAGTCCCCT No data
Right 1017467706 6:154710187-154710209 ATACTTTCCAAGACCCCCAGTGG No data
1017467703_1017467706 -4 Left 1017467703 6:154710168-154710190 CCCCTGTTATTCACAGGGGATAC No data
Right 1017467706 6:154710187-154710209 ATACTTTCCAAGACCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017467706 Original CRISPR ATACTTTCCAAGACCCCCAG TGG Intergenic
No off target data available for this crispr