ID: 1017473424

View in Genome Browser
Species Human (GRCh38)
Location 6:154763157-154763179
Sequence AATGAAAAGCAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1054
Summary {0: 1, 1: 1, 2: 4, 3: 93, 4: 955}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017473424 Original CRISPR AATGAAAAGCAGAATGAGGA GGG (reversed) Intronic
900253941 1:1687075-1687097 AATAAAAAGAAGAAAGAAGATGG + Intronic
900439379 1:2645747-2645769 AATGCTAACCAGAATCAGGAGGG - Intronic
900908760 1:5579272-5579294 TCTGGAAAGCAGAATGAGCAAGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901631374 1:10649790-10649812 AAAGAAGCGCAGAAGGAGGAGGG + Intronic
902210924 1:14903922-14903944 GATGAGAAGCAGACTGCGGAAGG + Intronic
903106999 1:21089864-21089886 AATGGCAGGCAGAATTAGGAAGG - Intronic
903524647 1:23983903-23983925 AAAGAAAAGAAGAAAGAGGCCGG - Intergenic
903543694 1:24110794-24110816 AAGAAAGAGCAGAATGAGCAGGG - Intronic
903574135 1:24327595-24327617 AGTGAAAAGGAAAATGAGGGAGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904378682 1:30097053-30097075 AGTGCAAAGCAGAATGCTGAGGG - Intergenic
904792535 1:33034588-33034610 CATGAAATGCTGAATGAGCAAGG + Intronic
904856933 1:33505487-33505509 AATTAAAACCACAATGAGGCCGG - Intergenic
905203514 1:36329701-36329723 AATGAAAAAAAAAATGAGTAAGG + Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905507668 1:38493065-38493087 AAATAAAAGCAGAGTAAGGAAGG + Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906201232 1:43961586-43961608 AATGAAAAGTGGAAAGAGCACGG + Intronic
906584798 1:46966559-46966581 AATGAAGAAAAGAAAGAGGAAGG - Intergenic
907561258 1:55390611-55390633 AATTAAAACCACAATGAGGTAGG - Intergenic
907754863 1:57301658-57301680 AATGAAATGCAGCTTGTGGAAGG - Intronic
908481262 1:64541821-64541843 AAACAAAAACAGAATGAGGTGGG + Intronic
908778125 1:67661449-67661471 AATGAAAAGCAGGGGGAGGGTGG - Intergenic
909292798 1:73905259-73905281 ACTGAAGAGGAGAAAGAGGAAGG + Intergenic
909462900 1:75939667-75939689 AACCTAAAGCAGAATGATGATGG - Intergenic
909749378 1:79139708-79139730 AATGAAAAGCAAATTTAGCAGGG - Intergenic
910526284 1:88182569-88182591 AATGAGAAGCAGAATGACAAAGG + Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
912534866 1:110359715-110359737 AATGTAAAGGAGAAAGAGTAGGG + Intergenic
913074967 1:115334428-115334450 AAAGAAAATCAGAAAGAGTAAGG - Intronic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
916165464 1:161963301-161963323 TATGAAAAGAAGAATGACAAAGG + Exonic
916356088 1:163910235-163910257 AATTAAAACCACAATGAGGCTGG + Intergenic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
916754219 1:167753301-167753323 AATGTAAAGCAGGAAAAGGAGGG + Intronic
916928871 1:169553410-169553432 AATCAAAACCACAATGAGGCCGG + Intronic
916946951 1:169738595-169738617 AATGAAAAGAGGAAAGAAGACGG + Intronic
916960695 1:169885650-169885672 AATAAAATGCAGAAAGAGAAAGG + Intronic
916982379 1:170152730-170152752 GATGAAAAATATAATGAGGAGGG + Intronic
917138049 1:171806709-171806731 AAAGAAAAAGAGAAAGAGGAAGG - Intronic
917148735 1:171921964-171921986 AATGAAAAGAGCAATGAAGAAGG - Intronic
917221927 1:172741037-172741059 AATGAAAAACATAATGTGTAGGG - Intergenic
917695600 1:177520082-177520104 AAAGAAAAGCAGAATGAGCCTGG + Intergenic
917918199 1:179725834-179725856 AATGAAAACCAGAATGTAGCCGG - Intergenic
917938911 1:179896678-179896700 AATAGCAGGCAGAATGAGGACGG + Intronic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918403316 1:184186772-184186794 AATTGAAAGCAGAATCTGGATGG + Intergenic
918582942 1:186153661-186153683 TATGAAATGCAGAATGAGCGGGG - Intronic
919266784 1:195278488-195278510 AAAGAAGAGAAGGATGAGGAAGG - Intergenic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920222805 1:204416658-204416680 AAAGAAAAGAAGAAAGAGGGAGG + Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
921066182 1:211623627-211623649 AATGGAAAGCCCCATGAGGACGG + Intergenic
921239479 1:213163851-213163873 AAAGCAAAGCAGAATCAGAATGG - Intronic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
921753584 1:218826067-218826089 AATGAAAAAGAGTATGAGAAAGG + Intergenic
922023635 1:221730077-221730099 AATTGAAAGGAGAAAGAGGAGGG - Intronic
922027833 1:221768405-221768427 CATGAAAAGCAGATTGAATAAGG - Intergenic
922117773 1:222631101-222631123 AAAGAAAAAAAGAAAGAGGAAGG - Intronic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922408335 1:225342375-225342397 AATCAAAATCAGAAAGTGGAAGG + Intronic
922503252 1:226111680-226111702 AGTGAAAGGTAGAATGGGGAAGG - Intergenic
922692143 1:227701952-227701974 AATGAAAAGCAAAAAAAGCAGGG + Intergenic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
923155716 1:231277429-231277451 AAGGAACAGCTGTATGAGGAAGG + Intronic
923860495 1:237887834-237887856 ACTGACAAGCAAAATGAGGTAGG - Intronic
924005148 1:239600763-239600785 AAGGAAAAGAAGAAAAAGGAAGG - Intronic
924675105 1:246167805-246167827 AATCAAAACCACAATGAGGCTGG - Intronic
1062966043 10:1608585-1608607 AAGGAAAAAAGGAATGAGGAAGG + Intronic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063650125 10:7927276-7927298 AATGGAGAGAAGAATGAGAATGG - Intronic
1063888121 10:10600380-10600402 AATAAAAAGCAGAATGGCAATGG - Intergenic
1063923110 10:10951143-10951165 AAAGAAAAGAAAAAGGAGGATGG - Intergenic
1064693902 10:17946470-17946492 AATGGAAAGCAAAAAGAGCAGGG + Intergenic
1065078898 10:22108424-22108446 AATTAAAACCACAATGAGGCCGG - Intergenic
1065171943 10:23039665-23039687 AATAAAAAGCAAATTTAGGATGG + Intergenic
1065321864 10:24517564-24517586 AACAAAAAGGAGAACGAGGAGGG - Intronic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067128149 10:43537792-43537814 AAAGAAAAGAAGAAGAAGGAAGG - Intergenic
1067345498 10:45435225-45435247 AAAAAAGAGCTGAATGAGGATGG - Intronic
1067741090 10:48896687-48896709 AATGCAAACCAGAGTTAGGAGGG - Intronic
1067814163 10:49459376-49459398 AATGAAAAGGGAAAGGAGGAGGG + Intronic
1067894148 10:50161604-50161626 AGTGAAAAACAGAAGTAGGATGG - Intergenic
1067912832 10:50364419-50364441 AGTGAAAAGCAGGATGGGGCTGG - Intronic
1067954697 10:50778657-50778679 AGTGAAAAACAGAAGTAGGATGG + Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068361724 10:55982457-55982479 GCTGAAAACCAGAATGAGAAAGG + Intergenic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069307222 10:66985608-66985630 AGTGGAAAGCAGAATGGAGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071039493 10:81289010-81289032 AATGAAAAACAGAAAAAGGCAGG + Intergenic
1071809573 10:89164761-89164783 AAAGAAATGAAGAAAGAGGATGG + Intergenic
1071851237 10:89572574-89572596 ACTGAATAGCAGTAGGAGGAAGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072830195 10:98649264-98649286 AATAGAAAGGAGAAAGAGGAAGG + Intronic
1073060399 10:100730298-100730320 AAAGAAAGGGAAAATGAGGAAGG - Intergenic
1073192066 10:101658568-101658590 AATGAAAAAGAAAATGAGGAAGG + Intronic
1073843942 10:107530726-107530748 AATGAAAGGCAGAATGACTGAGG + Intergenic
1074096359 10:110316878-110316900 AATGAAAAGTAGAAGAAAGAAGG + Intergenic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074268470 10:111929014-111929036 AAAAAAAAGCATAATTAGGAAGG + Intergenic
1074438946 10:113458319-113458341 AATGAAACCCAGAAAGAGAAAGG + Intergenic
1075339285 10:121632739-121632761 AATAAAAATAAGAATGAAGAGGG + Intergenic
1075397355 10:122137290-122137312 AAAAAAAAGCAGAATGAGCCTGG + Intronic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076150889 10:128161225-128161247 AAGGAAAGCGAGAATGAGGAAGG - Intergenic
1076238306 10:128882952-128882974 TCTGGAAAGCACAATGAGGAAGG + Intergenic
1076272409 10:129165934-129165956 AAAGAAGAGAAGAAGGAGGAAGG + Intergenic
1076598452 10:131640602-131640624 AATGGAAAACAGAAAGAGCAGGG + Intergenic
1077109722 11:856759-856781 AATCAAAAGCAGGATGAGCAGGG - Intronic
1077663364 11:4088487-4088509 GATGAAAATGAGAATGAGAATGG - Intronic
1077670057 11:4149113-4149135 AATCAAAACCACAATGAGGTAGG + Intergenic
1078417528 11:11178091-11178113 AATGAAAATGAGGAAGAGGATGG - Intergenic
1078603494 11:12754763-12754785 AAGGAAAACCTGAATCAGGATGG - Intronic
1079170244 11:18086829-18086851 AATGAAAAACAGTATGAGCCTGG + Intronic
1079687070 11:23372808-23372830 AATGAGAAGAAGAAAGAGAAGGG + Intergenic
1079743329 11:24092734-24092756 TATAAAAAGCAAAATGAAGAGGG + Intergenic
1079779045 11:24575254-24575276 TAAGAAAAGCAGAATTAGAAAGG - Intronic
1079797887 11:24829173-24829195 AATGAAATGAAGAATGACAAAGG + Intronic
1080181262 11:29429198-29429220 GAGGTACAGCAGAATGAGGAAGG - Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1080850976 11:36069886-36069908 AATGAAAAACGGAATGAGTAAGG + Intronic
1082648923 11:55762749-55762771 AATGAAAAGCAAAAAAAGGCAGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084685379 11:70691320-70691342 AAGGCAAGGGAGAATGAGGAGGG + Intronic
1084873812 11:72115994-72116016 AATGGAAAGCAGGGTCAGGATGG + Intronic
1084908172 11:72365021-72365043 AATCAAAACCACAATGAGGCTGG + Intronic
1086026476 11:82298430-82298452 AATGAAAATCAAAATAAAGAAGG + Intergenic
1086129452 11:83385292-83385314 AATGAAAAGCAAAAAAAGGGGGG + Intergenic
1087096911 11:94328016-94328038 AATGAATAGCTTAATAAGGAAGG - Intergenic
1087175875 11:95094698-95094720 AATGAAAAGAAGGCTGAGGTTGG - Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087406187 11:97733626-97733648 AATGAAAAGCAGAAAAAAGCAGG + Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087741206 11:101889229-101889251 AAAGAAAGGAAGAAAGAGGAAGG + Intergenic
1087930513 11:103972418-103972440 AATAAAAAGGAGAATGAGACAGG - Intronic
1088040368 11:105374464-105374486 AATCAACAGAAAAATGAGGAAGG + Intergenic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088168472 11:106967055-106967077 AATGAAAAGCAGAAAAATTATGG + Intronic
1088363708 11:109017457-109017479 AATGAAAAGCATTTTAAGGAGGG + Intergenic
1088550513 11:111008400-111008422 AATGAAAAACTACATGAGGATGG - Intergenic
1089169081 11:116500046-116500068 AATGGACAGCAGCATGGGGAGGG + Intergenic
1089285234 11:117402992-117403014 AATGGAAAGCAAAAAGAGGCAGG - Intronic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1089712589 11:120326175-120326197 AAAGAAAAGAAGGAAGAGGAAGG - Intronic
1089911056 11:122101106-122101128 AATGAAAAACAGAAAGAAAAAGG - Intergenic
1089932986 11:122333186-122333208 AGTGAAAAACAGAATGAGGTGGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1090339086 11:125999658-125999680 AATGAGAAGGAGAAAGATGATGG - Intronic
1090422694 11:126586479-126586501 AATGACAAGCAGAAAGAGGGCGG - Intronic
1090508445 11:127345207-127345229 AATGAAAAACAGAGTATGGATGG - Intergenic
1090574262 11:128084177-128084199 AATGAAAAGCAGAAAAAAGCAGG - Intergenic
1090578103 11:128130837-128130859 AATGAAAAGCAGAAGGAGTTGGG - Intergenic
1090591382 11:128273841-128273863 AAAGATAAGCAGAGTGAGGGTGG - Intergenic
1091182079 11:133614426-133614448 AAAGAAAAGAAGAATAGGGAAGG + Intergenic
1092092267 12:5812699-5812721 AAAGAAAAGAAGAAGAAGGAAGG + Intronic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1092782490 12:11999926-11999948 AAGGAAAAGGAGTATCAGGATGG - Intergenic
1093206191 12:16253572-16253594 AATCAAAACCATAATGAGGCTGG + Intronic
1093474939 12:19544320-19544342 AATGGAAAGGGGAATGGGGAGGG - Intronic
1093781309 12:23140468-23140490 AATGAAAATCAAATTGAAGAGGG - Intergenic
1093859826 12:24150959-24150981 ATTTAAAAACAGAATCAGGAAGG + Intergenic
1093897666 12:24593105-24593127 AATGAAAAACAAAAAGAGGCAGG - Intergenic
1094430512 12:30364157-30364179 AATAAAAAGCACACTGAGGCAGG - Intergenic
1095298840 12:40558766-40558788 AAGGCAAAGAAGAATGAGGTAGG - Intronic
1095347347 12:41167050-41167072 AAAGAAAAGAAGAAAGAGCATGG - Intergenic
1095360632 12:41334234-41334256 AATGAAAGGCAGAAGCAAGAAGG - Intronic
1095399727 12:41800644-41800666 AATGAAAACCGGAATGATAATGG - Intergenic
1095563064 12:43588373-43588395 AAAGGAAAGGAGAATGATGAGGG + Intergenic
1095631179 12:44379129-44379151 AAAGAAAGGAAGAAAGAGGAGGG + Intronic
1095789484 12:46148605-46148627 AATGAAAAACTTCATGAGGAAGG - Intergenic
1095815413 12:46416799-46416821 AATAAGAAGATGAATGAGGAAGG - Intergenic
1096081693 12:48837579-48837601 AATGGAAATGAGGATGAGGAAGG - Exonic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1096968215 12:55645652-55645674 AAGGAAGAGAAGAATGGGGAAGG - Intergenic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1097604135 12:61731556-61731578 AAGTAAAAGAAGAATGAGCAGGG - Intronic
1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG + Intronic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098200692 12:68052247-68052269 GATGATAAACAGAATGAGTATGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098558205 12:71842852-71842874 AAAGAAAAAGAAAATGAGGAGGG + Intronic
1098600116 12:72321064-72321086 AATGACAATAAGAATGAGCAGGG + Intronic
1098694874 12:73539555-73539577 AATGGAAAGCAGAAAAAGCAAGG + Intergenic
1099465982 12:82988563-82988585 AGTTGAAGGCAGAATGAGGAGGG + Intronic
1099611896 12:84883820-84883842 GGTGATTAGCAGAATGAGGAAGG + Intronic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1099734229 12:86547311-86547333 AAGGAAGAGCAGGAAGAGGAAGG - Intronic
1100115946 12:91304356-91304378 AATGCAAAAGAGTATGAGGAAGG - Intergenic
1100121954 12:91378912-91378934 ATTGAAAATAAGAATGTGGAGGG - Intergenic
1100262983 12:92950281-92950303 AAAGAAAAGAAGAATGGGTACGG + Intergenic
1101025141 12:100595937-100595959 AAAGAAGAGAAGAAGGAGGAGGG - Intronic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1102624402 12:114223169-114223191 AATGAAAAGCAAAATGAGAAGGG - Intergenic
1103003983 12:117407268-117407290 ACAGAAAAGCAGAATGATCAGGG - Intronic
1103383254 12:120511625-120511647 AATAAAAAGCAAAAAGAGAAAGG + Intronic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1103749192 12:123147923-123147945 AATGAAAAGGAAAGTGGGGAAGG - Intronic
1103832603 12:123791916-123791938 AATGACAGCAAGAATGAGGAAGG - Intronic
1104026604 12:125032110-125032132 GAAGGAAACCAGAATGAGGAGGG + Intergenic
1104574200 12:129951757-129951779 AATGAAAACCAGAATCAGCTAGG + Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1104772843 12:131374981-131375003 AATGTTAAGAAGAATGAGGTTGG + Intergenic
1104863515 12:131938642-131938664 AACCAAGAGCAGAGTGAGGAAGG - Intronic
1105554156 13:21429871-21429893 ACTGAACAGCAGAATGGAGAGGG - Intronic
1105936550 13:25105827-25105849 AATTAAAACCACAATGAGGCCGG + Intergenic
1105947226 13:25200536-25200558 TATGAAAAGCAGAATAGGGCCGG - Intergenic
1106068152 13:26379132-26379154 AATGGAAAGTAACATGAGGAGGG + Intronic
1106068482 13:26382087-26382109 AAGGAAGAGCAGAAGGAGTAAGG - Intronic
1106497867 13:30297163-30297185 AAAGAAAAGAAGGAGGAGGAAGG + Intronic
1106591576 13:31103058-31103080 AATGAAAAACTGAATGAATATGG - Intergenic
1106883001 13:34152258-34152280 ACTGCAAAGCAGAATGAGAAGGG + Intergenic
1106885564 13:34181203-34181225 AAGGAAAAGAAGAAAGAGAAAGG - Intergenic
1107758626 13:43652254-43652276 AATGAAGAGCAGAACCAAGATGG + Intronic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108459445 13:50650552-50650574 AATGAAAAACAGATTGGGGTTGG + Intronic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1108562869 13:51664047-51664069 AATGAAAGGAAGAAAGTGGAAGG + Intronic
1108671199 13:52690807-52690829 AATGGAATGGAGAAAGAGGATGG + Intronic
1108798488 13:54063987-54064009 AATGGAAACCAGATTGAGGTGGG - Intergenic
1108809287 13:54201503-54201525 AAGGAACAGCAGCAAGAGGATGG - Intergenic
1109254027 13:60056349-60056371 GATGAAAAGAAGAATAAAGATGG + Intronic
1109299384 13:60575185-60575207 AATTAAAAACAGAAGAAGGAAGG + Intergenic
1109505121 13:63290183-63290205 AAGGAAAAGCAGAAAAAGTAAGG + Intergenic
1109937423 13:69308631-69308653 AATAAAAAGCAGAATATGGTGGG + Intergenic
1110120705 13:71877193-71877215 TATGGAAAGCAGACTGAGGTTGG - Intergenic
1110212914 13:72993888-72993910 AATAACAAACAGAATGAGGGAGG + Intronic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110842258 13:80156436-80156458 AAAGAAAAGAAAAATGAAGATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111210768 13:85076206-85076228 AATGAAAAGAAGAAACAGCATGG + Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1112170277 13:96965869-96965891 AATGAAATCAAGAAAGAGGAGGG - Intergenic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG + Intronic
1112616230 13:101008540-101008562 AATAAAAAGGAGTATGAGGAAGG - Intergenic
1112667327 13:101590576-101590598 ATTGAAAACCAGATTGAAGAGGG - Intronic
1113321454 13:109236304-109236326 AATGAGAAGCACAATGACTATGG + Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113432468 13:110262529-110262551 AATAAAAAGTAGAATTAAGAGGG - Intronic
1113490241 13:110686015-110686037 AAAGAAAAAAAGAAAGAGGAGGG + Intronic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113664259 13:112130338-112130360 AAAGAAATGATGAATGAGGATGG + Intergenic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114564962 14:23623909-23623931 AACTGAAAGCAGAATAAGGAGGG + Intergenic
1114720205 14:24873565-24873587 AATGAAATGAACAATGAGAACGG + Intronic
1114921760 14:27341428-27341450 AATGTAAAGCAGAAAAAAGAGGG - Intergenic
1115116064 14:29881539-29881561 AATAAAAAGCAAAATGGAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115331493 14:32202921-32202943 AATGAAAAGTTCAATGAAGAAGG + Intergenic
1115731167 14:36271453-36271475 AATGAAGAGCAGCATGTGGCAGG - Intergenic
1116111306 14:40588084-40588106 AAGGAAAAGTAGATTTAGGATGG + Intergenic
1116162879 14:41291777-41291799 AATGAAAAACAAAAAGAGCAGGG + Intergenic
1116543938 14:46138699-46138721 AAGCAAAAGCAGATTGAGGTTGG + Intergenic
1117124222 14:52603833-52603855 TATGAAAAACAGTATGAGGCTGG - Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117609918 14:57472323-57472345 AATGAAAAAGACAATGAAGATGG - Intronic
1117931471 14:60846147-60846169 AAGGAATAGGAGAATGGGGAAGG - Intronic
1118012481 14:61624057-61624079 AATGTAAAGCAGTAGGAGAAAGG - Intronic
1118491604 14:66266275-66266297 AATGAAAAGTATCAGGAGGAGGG + Intergenic
1118510959 14:66472739-66472761 ATTGAAAAGCAAAAGGAGAATGG + Intergenic
1118839970 14:69502621-69502643 AAGAAAAAGCAGGATGATGATGG + Intronic
1119211261 14:72833883-72833905 AATCAAAACCACAATGAGGCCGG + Intronic
1119211759 14:72837194-72837216 AGTGCAAAGAAGAATGAGGGTGG + Intronic
1119637041 14:76281975-76281997 AATGAAAAGCATTATGAAGATGG + Intergenic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1120222139 14:81746724-81746746 AAGGAAAAGCAGAAAGGGGGTGG - Intergenic
1120389037 14:83882074-83882096 AATGTAAATCAGAATTAAGAAGG - Intergenic
1120484779 14:85099338-85099360 AGTGAAAAGGAGAATGAAAAAGG + Intergenic
1120489156 14:85154628-85154650 AATGCATAGAAGAATGTGGAAGG + Intergenic
1120668029 14:87330335-87330357 AATGAGAATAATAATGAGGATGG - Intergenic
1120683343 14:87507752-87507774 AATGAAACACAGAAAGAGGGGGG + Intergenic
1121108912 14:91298883-91298905 AGTGAATAGCAGAGTCAGGATGG - Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121878400 14:97476533-97476555 ACTAAAAAGCAGAAAGAAGAAGG - Intergenic
1123177938 14:106439647-106439669 GAAGAATAGCAGAATGAGGCAGG + Intergenic
1124196232 15:27632399-27632421 AATGAAAACAAGAATGAGTGAGG + Intergenic
1124353357 15:28976780-28976802 AATGAAAGGCAGAATAAGAAAGG - Intronic
1124366676 15:29076857-29076879 AAAGAAAAGCAGCATGGGAAGGG - Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125254817 15:37751398-37751420 AAAGAAAAGGAAAAAGAGGAAGG + Intergenic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1126276805 15:46893669-46893691 AATAAAAAGCAGCATAAGGTTGG + Intergenic
1126288888 15:47048554-47048576 AAAAAAAAGCAGAATAATGAGGG + Intergenic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126770730 15:52053370-52053392 AATCAAAACCACAATGAGGCCGG - Intronic
1126841244 15:52719359-52719381 TATGAAACGTAGAATGAGTAAGG + Intergenic
1127687455 15:61362937-61362959 AATGGAAAGCAGAAAAAGCAGGG - Intergenic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1127870294 15:63067413-63067435 AATTTAAAAAAGAATGAGGAAGG - Intronic
1128158990 15:65410788-65410810 AAAGAAAAGCAGAAGGAACAGGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128658955 15:69483888-69483910 AATCAAAAGCAGATGGAGGGCGG - Intergenic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1129600446 15:76995340-76995362 AATCAGCAGCAAAATGAGGAAGG - Exonic
1129920220 15:79313254-79313276 AATCAAGAGCAAGATGAGGAGGG - Intronic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130200238 15:81819276-81819298 AATGAAGAGGAGCATGAGGGAGG - Intergenic
1130285634 15:82552203-82552225 AAAGAAGAGCAGAATAAAGACGG + Intronic
1130404623 15:83587184-83587206 AATTCAAAACAGAATGAGGCAGG - Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131655992 15:94459678-94459700 CATGAATAGTAAAATGAGGAGGG + Intronic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1132060489 15:98688323-98688345 AGTGAAAGGCAGAGAGAGGAGGG - Intronic
1133065886 16:3206861-3206883 AAAGAACAGCAGAGTGAGGCTGG + Intergenic
1133342933 16:5049039-5049061 AATGGAAACCAGAAGGAAGAAGG + Intronic
1133743636 16:8670751-8670773 AATGAACAGATGAATGAAGATGG + Intergenic
1133878792 16:9761356-9761378 AATGTAAAGCAGAATGCAGGAGG + Exonic
1134615891 16:15650687-15650709 AAGGAAGAGGAGAAAGAGGATGG - Intronic
1134772957 16:16826510-16826532 AATTAAAAGGAGAAAGAGGGTGG - Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135703736 16:24656164-24656186 AAAGAAAAGAAAAATGAGGCCGG + Intergenic
1135939591 16:26809742-26809764 AATGCAAGGGAGAAGGAGGAAGG + Intergenic
1135973761 16:27091581-27091603 GAAGAAAAGAAGAAAGAGGATGG + Intergenic
1136715010 16:32272107-32272129 AATGAAAAGAAGAATAACAAGGG + Intergenic
1136752905 16:32657618-32657640 AATGAAAAGAAGAATAACAAGGG - Intergenic
1136815208 16:33212747-33212769 AATGAAAAGAAGAATAACAAGGG + Intronic
1136821684 16:33322827-33322849 AATGAAAAGAAGAATAACAAGGG + Intergenic
1136828247 16:33379366-33379388 AATGAAAAGAAGAATAACAAGGG + Intergenic
1136833313 16:33478138-33478160 AATGAAAAGAAGAATAACAAGGG + Intergenic
1137402748 16:48166576-48166598 CGTAAAAAGCAGAATGAAGATGG + Intergenic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1138380489 16:56598314-56598336 AATTAAAACCACAATGAGGCCGG - Intergenic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139061787 16:63262395-63262417 TATAAAAATCAGAATAAGGATGG - Intergenic
1139153615 16:64414569-64414591 AATGTAAAGAAGAATGATAATGG - Intergenic
1139196299 16:64922024-64922046 AAGGAAAAGGAGAAAGAGAAAGG - Intergenic
1139458857 16:67106499-67106521 AATGAAAAGCATATTCAGGGAGG - Intergenic
1139486482 16:67259683-67259705 AATGGAGAGGAGTATGAGGAAGG - Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139842384 16:69891953-69891975 AATGCAAAGCAGGATCAGTATGG - Intronic
1140119389 16:72070489-72070511 TCCGAACAGCAGAATGAGGATGG + Intronic
1140513107 16:75522408-75522430 AATAAAAAGGAGAAAAAGGAAGG - Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1141119591 16:81341951-81341973 AATGGAAAGCAGAAGAAGCAGGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142137757 16:88459541-88459563 AATGAAGAGAAGGAGGAGGAAGG - Intronic
1202993785 16_KI270728v1_random:35722-35744 AATGAAAAGAAGAATAACAAGGG + Intergenic
1203011603 16_KI270728v1_random:246383-246405 AATGAAAAGAAGAATAACAAGGG - Intergenic
1203055042 16_KI270728v1_random:917662-917684 AATGAAAAGAAGAATAACAAGGG - Intergenic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144290178 17:13818699-13818721 AAAAAAAAGCAGAAAGAGAATGG + Intergenic
1144371099 17:14592484-14592506 AATGAAAAGAAGAATGCTGTAGG - Intergenic
1144993789 17:19252611-19252633 TATGAAAATCAGAATTAGGAAGG - Intronic
1145070770 17:19805123-19805145 AATGAATAGCAGAATGTGAGTGG - Intronic
1146328582 17:31908480-31908502 ATTGGAAGGCAGAATGAGAAGGG - Intergenic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1147350769 17:39841302-39841324 AATGAAGAGGGGAATGAAGAGGG + Intronic
1147422551 17:40329748-40329770 AATCAAAAGCACAATGAGGCTGG - Intronic
1147943550 17:44066857-44066879 AATGAAAAGGGGAAAGAGGAGGG + Intronic
1148015968 17:44522947-44522969 AAAAAAAAAGAGAATGAGGATGG - Intergenic
1148137376 17:45302883-45302905 AATGAAAACCAAAACCAGGAAGG - Intronic
1149005618 17:51802274-51802296 GATGAAAAACAGAACCAGGATGG - Intronic
1149114175 17:53071794-53071816 AAAGAAAAAGAGAAAGAGGAGGG + Intergenic
1149368698 17:55971166-55971188 AATGAGAATGAGAATGAGAATGG + Intergenic
1149940706 17:60862295-60862317 AACAAAAAACAGAATGAGGCTGG + Intronic
1150683722 17:67303612-67303634 AGTGAAAAGAAGGATGATGAGGG + Intergenic
1150747827 17:67830606-67830628 AAGGAAAGGCAGATTGAGGGAGG + Intronic
1151814635 17:76465684-76465706 AATGAGAAGGAAAATAAGGAGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152310428 17:79546656-79546678 AAAAAAAAATAGAATGAGGAAGG - Intergenic
1152439960 17:80300846-80300868 AATCAAAATCACAATGAGGCCGG - Intronic
1152937826 17:83150829-83150851 AAAGAAAGCCAGACTGAGGATGG - Intergenic
1152993259 18:382301-382323 CATGAAAAGCAGAAAGAAAAAGG - Intronic
1153062515 18:1008507-1008529 AAATACAAGCAAAATGAGGAGGG - Intergenic
1153577676 18:6539143-6539165 AAAGAAAAGTAGAGTAAGGAGGG + Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1155294356 18:24371674-24371696 AGTGAAGAGTAGAATGGGGAGGG - Intronic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1155417476 18:25614488-25614510 AAGGAAAAGTAGAAAAAGGAGGG + Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1155868327 18:30994242-30994264 AGTGAAAAGCAGGAAGAAGATGG - Exonic
1156156029 18:34302657-34302679 AAGGAAAAGCAGCAAGAGAAAGG + Intergenic
1156254799 18:35384797-35384819 AATAAAAAGCATAATGGGGCCGG + Intergenic
1156259581 18:35432469-35432491 AAGGAAAAATAGAATGAGGGAGG + Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1156749014 18:40427742-40427764 AATGAAAATCATAATGACAATGG + Intergenic
1156768086 18:40683929-40683951 AATAAAAAGAAGAACTAGGAAGG - Intergenic
1156787600 18:40934320-40934342 AATGAAAAGCAGACATTGGATGG - Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157511201 18:48276188-48276210 AATGAGAAGAGGAATGAAGAGGG - Intronic
1157791831 18:50538972-50538994 AGTTAAAACCAAAATGAGGATGG - Intergenic
1158121885 18:54057579-54057601 AATGAAAAGCACGATGTGTAAGG + Intergenic
1158144319 18:54294194-54294216 AATGAAAAGCAGACACAGCAGGG - Exonic
1158153873 18:54403558-54403580 AATGGAAAACAGAAAAAGGAAGG - Intergenic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159258663 18:65981194-65981216 AAGGAAAGGCAGAAAGAGAAAGG - Intergenic
1159754323 18:72345177-72345199 AATAAATGGCAGAATGAGGAAGG + Intergenic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160475316 18:79179532-79179554 GATGAAAAGAAGAATCATGAAGG - Intronic
1161673089 19:5625065-5625087 AATGAAAAGGAGAAGGAAGAAGG - Intronic
1161779994 19:6285589-6285611 AAAAAAAAGAATAATGAGGAAGG + Intergenic
1161886305 19:6998833-6998855 AATGGAAAACAGAAAGATGAAGG - Intergenic
1162024139 19:7884318-7884340 AAAAAAAAGAAGAATGAAGAAGG + Intergenic
1162108873 19:8389499-8389521 AAAGAATAGCAGAAAGTGGACGG + Intronic
1163674296 19:18647668-18647690 AAAGAACAGGAGAATGGGGAGGG + Intronic
1163779166 19:19237197-19237219 AAGGAAAAGTAGGCTGAGGATGG - Intronic
1163855159 19:19695926-19695948 AATTAAAAGCATAATGAGGTCGG - Intergenic
1164404544 19:27932349-27932371 GATGAAGAGAAGAAGGAGGAAGG - Intergenic
1164522186 19:28988186-28988208 AAAGAAAAGGAGAGAGAGGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1166649371 19:44560134-44560156 AAAGAAAAGGAGAAAGAGGGAGG + Intergenic
1167514484 19:49915118-49915140 AAGGAAAGGAAGAATTAGGAAGG + Intronic
1167913873 19:52724993-52725015 AGAGAAAAGAAGAATGAGAAAGG - Intronic
1167921379 19:52785997-52786019 AGAGAAAAGAAGAATGAGAAAGG - Intronic
1167934204 19:52893073-52893095 AGAGAAAAGAAGAATGAGAAAGG - Intronic
1167940384 19:52941910-52941932 AGAGAAAAGAAGAATGAGAAAGG - Intronic
1167991791 19:53366458-53366480 AGAGAAAAGAAGAATGAGAAAGG + Intronic
1202674214 1_KI270710v1_random:26071-26093 AATAAAAAAAAGAATGAGGTTGG + Intergenic
924978748 2:201057-201079 TATAGACAGCAGAATGAGGACGG - Intergenic
925036470 2:690613-690635 AATGTTAAGCAAGATGAGGAAGG + Intergenic
925234902 2:2269537-2269559 AATGCAAGGCAGAAGTAGGATGG - Intronic
925384081 2:3449887-3449909 AAGGAAAGGCCGAGTGAGGATGG + Intronic
925535880 2:4916103-4916125 AATAAAATGCTGAATGAGGAGGG + Intergenic
925554672 2:5116923-5116945 AAAAAAAAAAAGAATGAGGAAGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925859809 2:8163412-8163434 AAAGAAAAGCACTGTGAGGAAGG - Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
925957477 2:8981630-8981652 AAAGAAAAGCAGGATGAGAGAGG + Intronic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927624078 2:24694685-24694707 ACTCAAAAACAGAATGAAGAAGG - Intronic
928607539 2:32957319-32957341 AATAAAAAGCTAAGTGAGGAAGG - Intronic
929178348 2:39004647-39004669 AATAGAAACCAGAATGAGAAAGG + Intronic
929426392 2:41848890-41848912 AATGAAAAGTGGAAGGAGGCTGG + Intergenic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
929878991 2:45820447-45820469 AAGGAAGGGCAGAATGAGAAAGG + Intronic
929992644 2:46802722-46802744 AGTGAAATGAAGATTGAGGATGG - Intergenic
930395514 2:50818943-50818965 AATCAAAACCACAAGGAGGAGGG + Intronic
930639481 2:53840509-53840531 AAAGAAAAGGAGAAGGAGAAAGG + Intergenic
930845555 2:55899826-55899848 AATGCAATGCAGAATGGGGTAGG + Intronic
931630715 2:64296140-64296162 CATGAAGAGCAGAATAGGGAAGG - Intergenic
931737571 2:65210921-65210943 AATTAAAACCACAATGAGGCCGG - Intergenic
932472964 2:71975103-71975125 AATCAAGAGCAGTATTAGGATGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933789781 2:85874509-85874531 AATGAAAACCAGAACGGAGATGG - Intronic
933995004 2:87661722-87661744 AAAGAAAAGGAGGAGGAGGAGGG + Intergenic
934114606 2:88775111-88775133 AATGAAGAACAAAATGTGGAAGG + Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934632027 2:95936745-95936767 AATGAAGAACAAAATGTGGAAGG - Intronic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934748613 2:96776907-96776929 AATTAAAACCACAATGAGGTGGG - Intronic
934801476 2:97166476-97166498 AATGAAGAACAAAATGTGGAAGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935271584 2:101439107-101439129 AATTAAAACCACAATGAGGCCGG - Intronic
935418188 2:102840600-102840622 AATTAAAACAAAAATGAGGAAGG + Intronic
935449526 2:103192635-103192657 AATATAAAACAGAATGAAGAAGG + Intergenic
935583628 2:104781805-104781827 ATTGAAAAGAAGAAAGAGGTTGG + Intergenic
936298854 2:111289191-111289213 AAAGAAAAGGAGGAGGAGGAGGG - Intergenic
936388482 2:112052521-112052543 AAAAAAAAGGAAAATGAGGAAGG - Intergenic
936682716 2:114792885-114792907 GATGAAAAGCAAAATCAGCAAGG - Intronic
936908869 2:117569974-117569996 AATGAAAAACAGAAAAAGGCAGG - Intergenic
937073231 2:119081669-119081691 AATCAAAACCACAGTGAGGATGG - Intergenic
937253518 2:120539252-120539274 AATGAAAAGCTGATAGAGGAAGG + Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938509273 2:131923558-131923580 AATCAACCGCAAAATGAGGAAGG + Intergenic
939434878 2:142162605-142162627 AATTAAAACCACAATGAGGTTGG + Intergenic
939654202 2:144802453-144802475 AATAAAAAGCACATTGAGTATGG + Intergenic
939795946 2:146644134-146644156 AATGAAAAGCATAAAAAAGAAGG + Intergenic
940092845 2:149940818-149940840 AAGGAAGAGAAGAAAGAGGAAGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940590767 2:155722582-155722604 AATGAAAAGCATAAGAAGAAAGG - Intergenic
940935695 2:159491909-159491931 AATAAAAAGAAGAATTAGGATGG - Intronic
941418901 2:165257832-165257854 AATCAAAACCACAATGAGGCTGG - Intronic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
942218922 2:173750326-173750348 GATTAAAGGCAGAAAGAGGAAGG - Intergenic
942579136 2:177397581-177397603 AATGCAAACCACAATGAGGTTGG - Intronic
942588383 2:177511842-177511864 AATGAAAAGGAGATGGAGAAAGG - Intronic
943015578 2:182506178-182506200 AAAGAAAAGATGAATGACGAAGG - Intronic
943164139 2:184296005-184296027 TATGAAAATGAGAATCAGGATGG - Intergenic
943562431 2:189479815-189479837 AATGAAATGAACAATGAGGAAGG - Intergenic
943975132 2:194466297-194466319 GATGAAAAAGAGGATGAGGATGG + Intergenic
944099098 2:196003177-196003199 GATGGAAAAGAGAATGAGGAAGG + Intronic
944296402 2:198067840-198067862 AATGAAAATCAAAATAAGGAGGG - Intronic
944328770 2:198440517-198440539 AATAAATAGGAGAATGAGGAGGG + Intronic
944844280 2:203653475-203653497 AAAGAAGAGCAGAATGAGGCCGG + Intergenic
945164544 2:206928700-206928722 AATGGAAAGCAGAAAAAAGAAGG + Intergenic
945167624 2:206962664-206962686 AATGGAAATCAGAAAAAGGAAGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946872603 2:224097814-224097836 GATGGAAAGCAGAATGAGAGAGG - Intergenic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947364917 2:229383578-229383600 AATGGAAAGCAAAAAAAGGAGGG + Intronic
947365518 2:229390659-229390681 GATGAAAACCAGAATGAGATAGG - Intronic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
948433709 2:237937620-237937642 AAATAAAACCAGAAAGAGGAGGG + Intergenic
948692816 2:239717618-239717640 AATAAAAACAAGAATGATGATGG + Intergenic
948962045 2:241346955-241346977 AAAGAAAAGGTGAGTGAGGATGG - Intronic
1168864973 20:1078528-1078550 GCTGAAAATCAGGATGAGGAGGG + Intergenic
1169103637 20:2974680-2974702 AATCAAAACCAAAATGAGGCCGG - Intronic
1169318592 20:4612715-4612737 AATGAACAGAAGAAGGAAGAGGG + Intergenic
1169793021 20:9431442-9431464 AATTAAAAGCAGAATTAAGAGGG - Intronic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1169993514 20:11529816-11529838 AAAGAACAACAGAATTAGGAAGG + Intergenic
1170193944 20:13671335-13671357 AAAGAAAAGAAGAAAGAAGAAGG - Intergenic
1170702284 20:18714119-18714141 AAGGAAAGGCAGGATGAGAAAGG + Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171491258 20:25519366-25519388 AATGAAAAACAGAATAACTATGG - Intronic
1171540785 20:25953590-25953612 AAAAAAAAGCAGAATAATGAGGG - Intergenic
1172584404 20:36072397-36072419 AATGAAATGGAGAATAAGGAAGG + Intergenic
1173071773 20:39775113-39775135 AATGAAAACCAGAAAAAGCAGGG - Intergenic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173117785 20:40262715-40262737 AATAAATAGCAAAATGAGTAGGG + Intergenic
1173135617 20:40436393-40436415 AATAAAAAGAAAAATGAGGCCGG + Intergenic
1173175869 20:40764339-40764361 AAAGAAAAGCCTAATTAGGAAGG - Intergenic
1173301798 20:41810094-41810116 ACTGAAAAGTAGAAAGAAGAAGG + Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1174254445 20:49243778-49243800 AGTTAAGACCAGAATGAGGATGG - Intronic
1174523446 20:51152548-51152570 AATGACAATCAGAATGAGTGAGG + Intergenic
1174710885 20:52703818-52703840 AATGAAAAACTGAATGAGGCCGG + Intergenic
1175094815 20:56533019-56533041 AATGAAAAACAGAAACATGACGG + Intergenic
1175142168 20:56869018-56869040 AATGCCAAGCAGAACCAGGAAGG + Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176784212 21:13234986-13235008 AATCAACCGCAAAATGAGGAAGG - Intergenic
1177149348 21:17438962-17438984 AATGAAATGCAGCTGGAGGATGG - Exonic
1177220588 21:18187289-18187311 AATGAAGAGAAGAATGAACAAGG - Intronic
1177306228 21:19320474-19320496 AATTAAATGCAGAATGTGGCTGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177467341 21:21503608-21503630 AATGCAAAACTGGATGAGGAGGG + Intronic
1177969762 21:27775656-27775678 AAGGAAGAGCAGGAAGAGGAAGG - Intergenic
1178002337 21:28176392-28176414 AATGAAAAGAAGAAGAAGGAAGG + Intergenic
1178071471 21:28972721-28972743 AAACAAGAGAAGAATGAGGAAGG + Intronic
1178323317 21:31622783-31622805 AAAGAAAAAAAGAAAGAGGAAGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1181006113 22:20014489-20014511 AATTAAGACCAGAATGAGGCCGG - Intronic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1182166862 22:28183480-28183502 TCAGCAAAGCAGAATGAGGAGGG - Intronic
1182282281 22:29224538-29224560 AATGAAAACCAGAGGGAGGCTGG - Intronic
1182773259 22:32811212-32811234 AAAGATAAGCAGACTGAGGGGGG + Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1183138481 22:35913842-35913864 TAAGAAAAGGGGAATGAGGAAGG + Intronic
1183145405 22:35986287-35986309 TATGAACAGCAGGATGAGGAAGG + Intronic
1183388914 22:37532425-37532447 AATGAAAAGAAAAATAAGGCTGG - Intergenic
1183974936 22:41506547-41506569 TATAAAAAACAGAATGAGGCCGG - Intronic
1184437229 22:44486596-44486618 GATGAAGAACAGGATGAGGAAGG + Intergenic
1184712351 22:46259744-46259766 AATGAAAAGCACAGTGAAGAGGG + Exonic
1184877950 22:47287231-47287253 AAAGAAAAACAGAATGGGGGAGG - Intergenic
1185035534 22:48474779-48474801 AAGGAAAAGCAGAAAAAGCAGGG + Intergenic
949103082 3:169403-169425 GAAGAAAAGGAGAAAGAGGAGGG + Intergenic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
949359149 3:3213507-3213529 AATGATAAGCAAAATTTGGACGG + Intergenic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950722057 3:14890452-14890474 AATGAATAAAGGAATGAGGACGG + Intronic
950916770 3:16654014-16654036 AATGCAAAATAAAATGAGGAAGG + Intronic
951873483 3:27393844-27393866 GATGGAAGACAGAATGAGGATGG + Intronic
952177743 3:30884674-30884696 AATGCAATGTATAATGAGGAAGG - Intronic
952307198 3:32156780-32156802 GATGAAAAACAGAATGAGCTGGG - Intronic
952327164 3:32331850-32331872 AATGAAAAGTAGAATGCCAAGGG + Intronic
952567577 3:34677942-34677964 AATGGCAAACAGAATGAGGCTGG - Intergenic
953290186 3:41652636-41652658 AGTGAAAAGCAGAAAGAGGTGGG + Intronic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
955117327 3:56018524-56018546 AATGAAAGAAAGAATGAGGGAGG + Intronic
955434178 3:58883653-58883675 AATGAAAGGTAAAATGATGATGG - Intronic
955451630 3:59074560-59074582 AATGGAAAACAGAATGGGGTAGG + Intergenic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
956126573 3:66016640-66016662 AAAGAAAAGCAGAATGGAGGAGG + Intronic
956675893 3:71731441-71731463 ACTGAAAAAAATAATGAGGAAGG - Intronic
956696373 3:71922404-71922426 AATGAACTGTAGAAGGAGGAAGG + Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
956834173 3:73082096-73082118 AAAGAAAAGTAAAATGAAGAAGG + Intergenic
957423076 3:79997676-79997698 ACTGAAAAGCAGAAAAAGCAAGG - Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
958860451 3:99438893-99438915 AATTTAAAGCAGAAGAAGGAAGG + Intergenic
959191670 3:103120244-103120266 AATGGACAGCAACATGAGGATGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959655444 3:108799408-108799430 AAAGAAAAGGAGAAAAAGGAAGG - Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960286470 3:115835608-115835630 AATCAAAACCACAATGAGAAAGG + Intronic
960331842 3:116369565-116369587 AAAGAAAAGGAGGAAGAGGAGGG + Intronic
960480282 3:118179633-118179655 AATGAAAAGGAGAAGTAGCATGG - Intergenic
960502811 3:118457384-118457406 AATGGAAATGAGAATGAGAAAGG + Intergenic
960758014 3:121039740-121039762 AATAAAAAAGAGAAAGAGGAGGG - Intronic
960782799 3:121338661-121338683 AAAGAAAAAAAGAAAGAGGAAGG + Intronic
961188563 3:124937789-124937811 AATGAAAAGTATAACCAGGAAGG + Intronic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
962105958 3:132389646-132389668 TATGAAAAGCAGAATTAAGCTGG + Intergenic
962512585 3:136116559-136116581 AATGGAAAGCAGAAAGAAGCAGG + Intronic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
963052315 3:141152527-141152549 AGTGAAGAGCAGACTGAGAATGG + Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963442398 3:145356481-145356503 TATGAACAGCAGAAAGAGGGTGG - Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964074434 3:152676180-152676202 AATAAAAATCAGAGTTAGGATGG + Intergenic
964168674 3:153739813-153739835 AACGACAGGAAGAATGAGGAGGG + Intergenic
964367332 3:155964197-155964219 AAGGAATGGCAGAGTGAGGAAGG - Intergenic
964458495 3:156895316-156895338 AATCAAAACCACAATGAGGCTGG + Intronic
964472791 3:157072159-157072181 AAAGAAAAGGAGGAGGAGGAAGG + Intergenic
964734086 3:159898566-159898588 AAAGAAAAGAAGAAAGTGGAAGG - Intergenic
965329155 3:167348379-167348401 AAAGAAAAGAAGAAGGAGGGAGG + Intronic
965740446 3:171868828-171868850 AATGAAAAACTGAATCAGGCCGG + Intronic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966539402 3:181073172-181073194 AATGAAAAGCAAAAAAAGCAGGG - Intergenic
966565206 3:181372106-181372128 AAGAAAAAGCAAAATGAGAAGGG + Intergenic
966592458 3:181697523-181697545 AACTAAAAGTGGAATGAGGAAGG - Intergenic
966592766 3:181699951-181699973 AAAGAAAAACAGAATGAGTGGGG - Intergenic
967578794 3:191127159-191127181 AAGGAAAAGAAGAATGTGTATGG - Intergenic
967840072 3:193998009-193998031 TATGAACAGCAGAGGGAGGAGGG + Intergenic
967846594 3:194047969-194047991 AATGAAAAGAAGAGAGAGAAAGG + Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967880995 3:194301433-194301455 AATGCTAATCAGAATAAGGAGGG - Intergenic
968039931 3:195580300-195580322 TATCAAAAGCAGAAAGATGATGG + Intronic
968929944 4:3573530-3573552 CATGAAAACCAGAGTGAGAAGGG + Intergenic
969013386 4:4085830-4085852 AGTAAAAAGCACAATGAGGCTGG + Intergenic
969165883 4:5312018-5312040 AATGGAGAGAAGAATGAAGAAGG - Intronic
969726069 4:8918951-8918973 AAGAAAAAGAAGAATGAGAAAGG - Intergenic
969943226 4:10756100-10756122 AATGAAATGAATTATGAGGATGG - Intergenic
970260132 4:14215864-14215886 GATGATAAGGAAAATGAGGAAGG + Intergenic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970432848 4:16004926-16004948 AAAGAAAAAAAGAAAGAGGAAGG - Intronic
970831132 4:20340949-20340971 AAAGAAAGACGGAATGAGGAGGG + Intronic
971017775 4:22506254-22506276 GATGAAAAGCAAAATAAGGCCGG + Intronic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971145896 4:23976127-23976149 AATGAAGGGCAGAATGTGCAAGG + Intergenic
971147601 4:23995779-23995801 AATGACAATCAGGATGAGGAAGG - Intergenic
971445731 4:26746107-26746129 GAAGAAAAGAAGAATGAGTATGG - Intronic
971514355 4:27467954-27467976 AAAGAAAAAGAGGATGAGGAAGG - Intergenic
972281447 4:37605892-37605914 AAAGAAAGGAAGAAAGAGGAAGG + Intronic
972578722 4:40375954-40375976 AAAGAAAACCAGAGAGAGGAAGG - Intergenic
972763478 4:42130182-42130204 AATCAAAACCACAATGAGGCTGG + Intronic
972808967 4:42561995-42562017 TATAAAAAGCAGAAAGATGAGGG - Intronic
972945319 4:44247195-44247217 AATAAAAAGCAGATTTAGGGAGG - Intronic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973978731 4:56288210-56288232 AAAGAAGAGCAGGAGGAGGAAGG - Intronic
974044826 4:56890014-56890036 AATCAAAACCACAATGAGGCCGG + Intergenic
974087381 4:57275987-57276009 AGTGAAAAGTTGAGTGAGGATGG - Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974379187 4:61116691-61116713 AACAAAAAGTAAAATGAGGAGGG + Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
975321634 4:73015174-73015196 AATGTAAAGAAGAAGGAGAAAGG + Intergenic
975543702 4:75539810-75539832 AAAGAAAAACAGTATGTGGATGG - Intronic
975631437 4:76407815-76407837 AGAGAAAAGAAGAAAGAGGAAGG + Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976361430 4:84183064-84183086 AATGACAATCATAATAAGGATGG + Intergenic
976506254 4:85851272-85851294 AATGAAAAGCAAAAAAAGCAGGG - Intronic
976527629 4:86113039-86113061 AATGGAAAGCAGAAAAAGGCAGG - Intronic
976848986 4:89523515-89523537 ACTGAAATGCAGAAAGATGAAGG + Intergenic
976954025 4:90871985-90872007 AATGAAAAGCAGAAAATGGCAGG - Intronic
977040028 4:92003969-92003991 AATGGAAAGCAGAAAAAGGGAGG + Intergenic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
977858137 4:101920935-101920957 GATAAAGAGAAGAATGAGGAAGG + Intronic
978149576 4:105416809-105416831 TATGAAAAGGAGAATGGAGAAGG - Intronic
978165190 4:105598482-105598504 AATACAAAGTAGAATGAGAAAGG - Intronic
978205100 4:106071921-106071943 AATGGAAAGCAAAAAAAGGAAGG - Intronic
978668532 4:111216467-111216489 ACTAAAACGAAGAATGAGGATGG - Intergenic
978710968 4:111780636-111780658 AATCAAAACCACAATGAGGCTGG + Intergenic
978854452 4:113378144-113378166 AATGAAATCCTGAAAGAGGATGG + Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979581869 4:122370361-122370383 AATTAAAACCACAATGAGGCTGG + Intergenic
979900850 4:126216014-126216036 AATGAAAGGAAGGATGACGAAGG + Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
980145189 4:128974157-128974179 AATAAAAGGCAAAATGATGATGG - Intronic
980583830 4:134787958-134787980 AAAGAAAAAAAGAATGAGGCTGG - Intergenic
980828881 4:138105567-138105589 AATGAAACAAAGACTGAGGAAGG + Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982230163 4:153201258-153201280 AATCAAAAACACAATGAGGCTGG - Intronic
982232133 4:153218995-153219017 AATCCAAAGCAGAATGGGGGGGG - Intronic
983098634 4:163596877-163596899 AATGTAAATTAGAAAGAGGAAGG - Intronic
983557767 4:169073757-169073779 TATAAAAAGCAGAATGTGGCCGG + Intergenic
983853349 4:172611005-172611027 AATGAAAAACAGAAAGAAGCAGG - Intronic
984237733 4:177181124-177181146 AACCAAGAGCAGAATGTGGATGG + Intergenic
984459197 4:180011517-180011539 AATTAAAAGCAAAAGGAGAATGG - Intergenic
984568960 4:181366713-181366735 GATAAAAAACAGAGTGAGGAAGG - Intergenic
984624781 4:181994990-181995012 TAAGAAAAGTAGAATGAGGCTGG + Intergenic
984854210 4:184179193-184179215 AATGAAAAGCAGAAAAAAGCAGG + Intronic
984951644 4:185012267-185012289 AAAGAAAAGCAGCAAGTGGAGGG - Intergenic
985837146 5:2279963-2279985 AATTATAATCAGAATCAGGAAGG - Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
986143449 5:5053117-5053139 AAAGAAAAACAGACAGAGGAAGG + Intergenic
986279239 5:6309969-6309991 AATGAACAGGAGAAGGAGGTGGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
986439315 5:7764876-7764898 AATGCAAAGAAGACGGAGGAAGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987635016 5:20528079-20528101 AATGAAAAGCAGAAAAAAGTGGG + Intronic
987748116 5:22004245-22004267 ACAGAAAAACAGCATGAGGAAGG - Intronic
989346340 5:40434102-40434124 AATGGAGGGCAGAATGAAGAGGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990007441 5:50960510-50960532 AATGAAAGAAAGAAAGAGGAAGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
991128637 5:63095727-63095749 AATGATTAGAAAAATGAGGATGG - Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
991261878 5:64676692-64676714 AAGGAAAAGAGGGATGAGGAAGG - Intergenic
991576073 5:68104545-68104567 AATGGAAAGCAAAAAAAGGAGGG + Intergenic
992355580 5:75979053-75979075 AATGAAAAGCAGAAAAATGCAGG + Intergenic
992571902 5:78067087-78067109 AATGAAAAGCAGAAAAAAGCAGG + Intronic
993322467 5:86489068-86489090 AATGGAGAGGAGAATGAGGGAGG + Intergenic
993362223 5:86991677-86991699 ACTGGAAAGGAGAATGATGAGGG - Intergenic
993384658 5:87250775-87250797 AGGGAAAAGCAAATTGAGGAAGG - Intergenic
993778333 5:92031318-92031340 AATGCAAAGCAAATTGTGGAAGG - Intergenic
993829025 5:92730130-92730152 AATTCAAAGCAGTATGAGTAAGG - Intergenic
994040649 5:95256203-95256225 AATGAAAAAAAGAATAAGGAAGG + Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994578583 5:101611274-101611296 GATGAAAAGCAGAAGCAGCAGGG - Intergenic
994691120 5:103020770-103020792 AATGAAAAGCAGCAACAGCAAGG + Intronic
994804842 5:104431779-104431801 AATGAAAAGTAGAATTGTGAGGG - Intergenic
995122017 5:108546301-108546323 GAGGAAAAGCAGGATGAGAACGG - Intergenic
995483251 5:112613977-112613999 AGTGAAAAGCAGAAGGGGAATGG + Intergenic
995611004 5:113910269-113910291 AATTAAAAGGAGATTGAGGCTGG - Intergenic
995667477 5:114559386-114559408 AATGAGAAGGGGCATGAGGAGGG + Intergenic
995695981 5:114878547-114878569 AATGGAAAGCAAAAAAAGGAGGG + Intergenic
995740657 5:115352744-115352766 AATGAAAAGCAGGCTGAGCATGG - Intergenic
995849316 5:116528387-116528409 ATTGTAAAGGCGAATGAGGATGG - Intronic
996012846 5:118500595-118500617 AATGGAAAGCAAAAAAAGGAAGG - Intergenic
996137483 5:119861856-119861878 TATGAAAAGGAAAATGTGGAAGG + Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996163327 5:120194612-120194634 AATGGAAAGCAAAATAAGGCAGG + Intergenic
996306757 5:122055770-122055792 AATTAAAAACACAATGAGGATGG + Intronic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996598795 5:125236904-125236926 AAAGCAAAGCAGAAAGAGAAGGG + Intergenic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
996778391 5:127157926-127157948 AATGGAAAACAGAAAAAGGAAGG - Intergenic
996805951 5:127454049-127454071 TATGAAAAGCTGAATAAAGAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997559672 5:134835351-134835373 ATTGAAAAGCAGGAAGAGGCCGG + Intronic
998274370 5:140738306-140738328 AATAAAAAGAAGAATAAGGAAGG - Intergenic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
998620413 5:143788454-143788476 AAAGAAAAGAAGAATGGGGAAGG + Intergenic
998755387 5:145372670-145372692 AATGAAAAGCAAAAGGAAGCAGG - Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
998980839 5:147700464-147700486 AATGGAAATCAGAGTGAGAAAGG + Intronic
999517701 5:152317559-152317581 AATCAAAAGCTGCATGTGGAAGG + Intergenic
999556578 5:152749491-152749513 AATGAAAACCAAAAGGAGCAAGG + Intergenic
999561512 5:152808299-152808321 ACTGAACACCAAAATGAGGATGG + Intergenic
999588273 5:153115492-153115514 AATGTAAAGCATAAAGTGGAAGG + Intergenic
999889373 5:155960145-155960167 AATGAAGAGGAGAAGGAAGATGG - Intronic
1000277788 5:159754358-159754380 AATAAACAGGAGGATGAGGAGGG + Intergenic
1000715166 5:164633969-164633991 AATGAAAAACAGTATGATGTTGG + Intergenic
1000729608 5:164816621-164816643 AATAAAAAGAAGAGTGATGATGG - Intergenic
1000765530 5:165284753-165284775 AATGAAAAGAAAAATGAGGCTGG + Intergenic
1000870839 5:166575130-166575152 ATTAAAAAGCTGAATGGGGAGGG + Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001839473 5:174862808-174862830 AATGGAAAGCAAAAAAAGGAGGG - Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002686046 5:181010349-181010371 AATGGAAAGCAAAAAGAGCAGGG + Intergenic
1003416654 6:5915679-5915701 AATGAAAAGCAAAAAAAGCAGGG - Intergenic
1004025388 6:11813294-11813316 AAAGAACAGCAGAATGAAGTCGG + Intergenic
1004440764 6:15650576-15650598 AATCAAAACCACAATGAGGCCGG - Intronic
1004813067 6:19281074-19281096 AATCAAAGGGAGAGTGAGGAAGG + Intergenic
1005033021 6:21529082-21529104 ATTGAAAAGGAGAAAGAAGAAGG - Intergenic
1005209030 6:23439559-23439581 TATGTAAAGTAGAATCAGGAAGG + Intergenic
1005429090 6:25735299-25735321 AATGAAATGGAGAATGAGCAAGG + Intergenic
1005495266 6:26382828-26382850 AAAGAAAAAGAGAATGAGAAAGG + Intergenic
1005596435 6:27382827-27382849 ATTGAAAAGCAGGCTGAGCACGG + Intronic
1005853519 6:29841513-29841535 AATGAAAAAGAGGCTGAGGAAGG - Intergenic
1006097327 6:31664247-31664269 AAAGAAAAGAAGAATAATGAAGG - Exonic
1006564421 6:34942834-34942856 AAAGAAAAGAAGGATGGGGAGGG - Intronic
1007021705 6:38527835-38527857 CATGAAAATCAGAAATAGGAAGG + Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007647411 6:43393624-43393646 AAAGAAAATCAGAAAGAGAAAGG + Intergenic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1008550344 6:52623681-52623703 ACTGAAAAGGGGAATGAGAAAGG - Intergenic
1008993002 6:57625648-57625670 AATAAAAAAGAGAATGATGAAGG + Intronic
1009181616 6:60524753-60524775 AATAAAAAAGAGAATGATGAAGG + Intergenic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1009706928 6:67264421-67264443 AATGGAAAGCAGAAAGAAGCAGG - Intergenic
1009986818 6:70790700-70790722 AATAACAAGCAGATTGAGGGAGG + Intronic
1010179299 6:73066305-73066327 AATGCAGAGCAGGATGAGGGTGG - Intronic
1010799748 6:80161724-80161746 AATGAAAAGCTGATGTAGGATGG - Intronic
1011137169 6:84113408-84113430 AATGGAAAGCAAAATAAGCAGGG - Intergenic
1011330284 6:86197307-86197329 AATGAGAATCACAATGAGGGGGG + Intergenic
1012576169 6:100802701-100802723 TATTAAAAGCAGAATCAGGCTGG + Intronic
1013061381 6:106637461-106637483 AATGAAAAGTAGTACCAGGAAGG + Intronic
1013199706 6:107881504-107881526 AATAAAAAGCACAAGGAGGGAGG - Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013394594 6:109722646-109722668 AATGAAAGCCAGAATGAAGAGGG - Intronic
1013429315 6:110041696-110041718 AATGAACAGAAGCATGAAGAAGG - Intergenic
1013589714 6:111609799-111609821 GCTGAAAAGCAGCCTGAGGATGG + Intergenic
1013609187 6:111778251-111778273 GAAGAAAAGATGAATGAGGAAGG + Intronic
1013844396 6:114432379-114432401 AATTAAAACCAGAATGACAATGG + Intergenic
1014374197 6:120651916-120651938 GAAGAAAAGGAGAAAGAGGAGGG + Intergenic
1014699104 6:124661405-124661427 AAAGAAAGGCTGAATGAGGGTGG - Intronic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1015380971 6:132568604-132568626 AATGAATATCAGAATGATGAAGG + Intergenic
1015387205 6:132637437-132637459 AATGAAAAGCAAAAAAAGGTAGG + Intergenic
1015664575 6:135613887-135613909 AATGGCAAGCAGAATCAAGAAGG - Intergenic
1015885078 6:137909633-137909655 AATGAAAAGGACAAAAAGGAGGG + Intergenic
1015966874 6:138703069-138703091 AATGAAATGCAGACTGGGCATGG + Intergenic
1017297204 6:152811910-152811932 AAAGAAAAGGAGGAGGAGGAAGG - Intergenic
1017436249 6:154418272-154418294 AGAGAAAGGCAGAATGATGACGG - Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017869766 6:158477271-158477293 TATGAAAAGCAGAACTAGGAGGG + Intronic
1018296545 6:162352056-162352078 AATGAAAGACAGACTGAGCAGGG + Intronic
1018354396 6:162997498-162997520 AATGAATAGCAGAATAATGCTGG + Intronic
1018361751 6:163077866-163077888 TATGAACAGGGGAATGAGGAAGG + Intronic
1018619417 6:165715549-165715571 AATGAAGGGGAGAAGGAGGAGGG + Intronic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1020423759 7:8040188-8040210 AATTAAAACCACAATGAGGGAGG + Intronic
1020734436 7:11929525-11929547 AAAGATAAGCAAAATGAAGAAGG + Intergenic
1020872911 7:13656051-13656073 AAAGAAAAGCAGAGTTAGGGTGG - Intergenic
1020934336 7:14442017-14442039 AATCTAAGACAGAATGAGGAAGG - Intronic
1020999584 7:15312058-15312080 AATGAAAAAGAGAATGAGACAGG + Intronic
1021049154 7:15961056-15961078 AATCAAAACCACAATGAGAATGG + Intergenic
1021064796 7:16159896-16159918 AATCAAAACCACAATGAGAATGG - Intronic
1021305261 7:19023931-19023953 AAGTAAAAGCAGAACGTGGATGG + Intronic
1021467343 7:20960017-20960039 AAGGAAAAGCATAAGAAGGAAGG - Intergenic
1021915605 7:25429317-25429339 AATGGAAAACAAAATGAGAATGG - Intergenic
1022576308 7:31500531-31500553 ATTGAAAAGTGGAATGTGGAAGG - Intergenic
1023207692 7:37768736-37768758 AATGAAAAGAAGTAGGAAGAAGG + Intronic
1023669995 7:42565735-42565757 AATGAAAAGCTGTATGTGAATGG - Intergenic
1024355442 7:48409776-48409798 CATCCAAAGAAGAATGAGGAGGG + Intronic
1024847869 7:53670587-53670609 AATGAAAAGGAGTATAAGAAAGG - Intergenic
1025292209 7:57739839-57739861 AAAAAAAAGCAGAATAATGAGGG - Intergenic
1025860296 7:65320709-65320731 AAGGAAATGCGGAAAGAGGATGG - Intergenic
1025992874 7:66508829-66508851 AATGAAAAGGAGGAAAAGGAAGG - Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026489150 7:70847846-70847868 TATGAACAGCAGAAAGAGGGTGG + Intergenic
1026604028 7:71800642-71800664 AATGAAATGGAAAATGAGCACGG + Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026775236 7:73227097-73227119 AAAGAAAAGAAGAAAGAAGATGG + Intergenic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1027016093 7:74780468-74780490 AAAGAAAAGAAGAAAGAAGATGG + Intronic
1027071935 7:75165469-75165491 AAAGAAAAGAAGAAAGAAGATGG - Intergenic
1027199618 7:76055234-76055256 TTTGAAAAGTAGTATGAGGATGG + Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1028077178 7:86531450-86531472 AATGGAAAACAGAATAAGCAGGG - Intergenic
1028123242 7:87081643-87081665 TGTGAAAAGCAGAATGAGAGAGG + Intergenic
1028246745 7:88488397-88488419 AAAGAAGAGGAGAATGAGAAAGG - Intergenic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1029409638 7:100400630-100400652 GATGAAGAGCAGAACCAGGATGG + Intergenic
1029467952 7:100737711-100737733 AAAAAAAAGAAGAATGAGAAAGG + Intronic
1029637466 7:101794510-101794532 AATGAAAAGCAGAAGCAGGTTGG + Intergenic
1030064823 7:105651605-105651627 GAAGAAAAGCAGAACGAGGTGGG + Intronic
1030473567 7:109999206-109999228 AAGAAATGGCAGAATGAGGATGG - Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031892873 7:127315230-127315252 AATGGAAATCAGAATAAAGAAGG + Intergenic
1032261690 7:130343123-130343145 AAAGAAAAGAAGAAAGAAGAAGG - Intergenic
1032956873 7:136982267-136982289 AATGAAAAGCAAAATAAGTAGGG - Intronic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033669996 7:143482567-143482589 AATGGAGAGAAGAATGAAGAAGG - Intergenic
1033954875 7:146834471-146834493 AATAAAGAGAAGAGTGAGGAAGG + Intronic
1034014143 7:147563931-147563953 AATGAAAGGGAAAATGATGAGGG + Intronic
1034312875 7:150105066-150105088 AAAGAAAAAAAGAATGAAGAAGG - Intergenic
1034331527 7:150287319-150287341 AAGGAAAAGCAGAGTCAGGTGGG + Intronic
1034495435 7:151418383-151418405 AATGAAAAACAGAAAGAAAAAGG + Intergenic
1034666516 7:152822542-152822564 AAGGAAAAGCAGAGTCAGGTGGG - Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035979822 8:4357765-4357787 AATGAAAAGAATAAGGAGGATGG + Intronic
1035981032 8:4372358-4372380 AATGGAAAACAGCATGTGGAAGG - Intronic
1036582332 8:10086920-10086942 AATGAGAATGAGAATGAGAATGG + Intronic
1036655909 8:10677168-10677190 AATGAAGTGCAGGAGGAGGAGGG - Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1036951902 8:13148723-13148745 AATGCATAGAAGAATGAGAAGGG - Intronic
1036962461 8:13259992-13260014 AATGAAAAGCAGAAGGAATTTGG + Intronic
1037410906 8:18596085-18596107 AATTAAAAGCAGAAGGAAAATGG + Intronic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1038171727 8:25140963-25140985 AATAAAAAGCAGAATGATTTTGG - Intergenic
1038225051 8:25648054-25648076 AATCAAAACCACAATGAGGCTGG - Intergenic
1038231165 8:25701826-25701848 AATGACCAACAGAATGAGAAAGG + Intergenic
1038351410 8:26779534-26779556 CATGACAAGCAGGATGATGAAGG + Intronic
1038419427 8:27422881-27422903 AATACGAGGCAGAATGAGGATGG + Intronic
1038531348 8:28320299-28320321 AATGAAAGGATGAATGGGGAAGG - Intronic
1038699603 8:29837233-29837255 GAAGCCAAGCAGAATGAGGAAGG + Intergenic
1040058880 8:43087429-43087451 AATAAAAAGCATAGTGAGGCCGG + Intergenic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1040793260 8:51258560-51258582 AATGGGAAGAAGAATGAGAAGGG + Intergenic
1041370493 8:57154641-57154663 AAAGAAAAGCAGAATGAGAGAGG - Intergenic
1041884480 8:62792662-62792684 AAGGAAAAGTGGATTGAGGAAGG + Intronic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1042480338 8:69295554-69295576 GATGAAAACCAGTATTAGGATGG - Intergenic
1042773868 8:72407477-72407499 AATGAAAAGCAGAAAAAAGCAGG + Intergenic
1042853288 8:73238662-73238684 AATGGAAAGCAAAAAAAGGAGGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1042999940 8:74745689-74745711 AAGGAAAAGCACTATGTGGATGG + Intronic
1043109642 8:76164178-76164200 AATGAAAAGCATAAAGATGTGGG - Intergenic
1043182270 8:77100522-77100544 AATGAAAAGCAGAAAGTAGTGGG + Intergenic
1043283543 8:78500841-78500863 AAAGAAGAGTAGAATGAGAATGG + Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1044165187 8:88973721-88973743 ATTGAAAAGCGGCATGAGCAGGG + Intergenic
1044293040 8:90495172-90495194 AATTAAAAACACAATGAGGTAGG + Intergenic
1044357188 8:91236228-91236250 AATGAAAAGCAATTTGAGGCTGG + Intronic
1044390255 8:91641594-91641616 AATGAAGAGCATAAGGAGGCAGG - Intergenic
1044524666 8:93239089-93239111 AATGAAACTCAAAATGAGCATGG - Intergenic
1044567295 8:93678273-93678295 AATGCAAAGCACAAAGATGACGG + Intergenic
1044811148 8:96063539-96063561 AATGAAGAGGGGAATGAGGTAGG - Intergenic
1044953093 8:97452484-97452506 AATGGTCAGCAGGATGAGGATGG + Intergenic
1045297848 8:100887981-100888003 AATGAAGGGCAGAGAGAGGAAGG + Intergenic
1045527577 8:102954395-102954417 AATTAAAACCAAAATGAGGCCGG - Intronic
1045682732 8:104679944-104679966 AAAGAAAAAAAGAAGGAGGAAGG - Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1045856796 8:106773493-106773515 TATGAATAGTAGAAAGAGGAAGG + Intergenic
1046167620 8:110458189-110458211 AAGAAAAAGCAGCATGAAGAAGG + Intergenic
1046290951 8:112160019-112160041 AAAGAAAAGCTGAATCAGGAAGG - Intergenic
1046595988 8:116261729-116261751 ACTGCAAAGGAGACTGAGGAAGG + Intergenic
1046904296 8:119555646-119555668 AATGAAGATATGAATGAGGAAGG - Intergenic
1047039020 8:120971881-120971903 AATGAAAAGCAAATAGAGCAAGG - Intergenic
1047190063 8:122670387-122670409 AAGGAAAAGAAGCAAGAGGAAGG + Intergenic
1047684301 8:127288795-127288817 AATGGCAAGTAGAATGAAGAAGG - Intergenic
1048132924 8:131717512-131717534 AAAGAAGAGCAGAAAGAAGATGG + Intergenic
1048153593 8:131919145-131919167 AATGAAAAGCTGAATATGGGGGG - Intronic
1048259877 8:132936549-132936571 AATGAAAAGATGAATGAGAAAGG - Intronic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1048814154 8:138316208-138316230 AATTAAAACCACAATGAGGCCGG + Intronic
1049862286 8:144907680-144907702 AATAAAAACCACAATGAGGCTGG - Intergenic
1050052636 9:1619186-1619208 ACTGAACAGCAGCATGAGGCAGG + Intergenic
1050538467 9:6649984-6650006 AGCCAAAAGCAGATTGAGGAGGG + Intergenic
1050885868 9:10764010-10764032 AATGAAAAGTAAAATGAGTTAGG - Intergenic
1051138537 9:13951885-13951907 AAAGAAAAGCAGAAAGAAAAGGG + Intergenic
1051238591 9:15027503-15027525 AATGGAAAGCAGAAAAAGCAGGG + Intergenic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051640567 9:19221071-19221093 AATAAAAAGCAGAACCAGGCTGG + Intergenic
1052014508 9:23449250-23449272 AATCAAAAGCAGAACCATGATGG + Intergenic
1052311202 9:27071408-27071430 AAAGAAAAGTAAAATGAGGCTGG + Intergenic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052515964 9:29480156-29480178 AAGGAAAAGGAAAATAAGGAGGG - Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1053465679 9:38306708-38306730 AATTACAAGCAAAAAGAGGAAGG - Intergenic
1053659645 9:40259717-40259739 AATTAAAAAAAGAATGAGGTAGG + Intronic
1053680903 9:40484526-40484548 AATGGAAGCCAGATTGAGGAGGG - Intergenic
1054282810 9:63140409-63140431 AATGGAAGCCAGATTGAGGAGGG + Intergenic
1054293985 9:63320041-63320063 AATGGAAGCCAGATTGAGGAGGG - Intergenic
1054392010 9:64624530-64624552 AATGGAAGCCAGATTGAGGAGGG - Intergenic
1054460336 9:65458941-65458963 CATGAAAACCAGAGTGAGAAGGG - Intergenic
1054503719 9:65891798-65891820 AATGGAAGCCAGATTGAGGAGGG + Intronic
1054524953 9:66116499-66116521 AATTAAAAAAAGAATGAGGTAGG - Intronic
1054679392 9:67895733-67895755 AATTAAAAAAAGAATGAGGTAGG + Intronic
1054804869 9:69388018-69388040 GATGAAAAGCAGGATGTGCATGG + Intronic
1054894542 9:70294068-70294090 AAAGCAAAGCAGAATGAGTAAGG + Intronic
1054959049 9:70946701-70946723 ACTGGAAAGGAGGATGAGGAGGG - Intronic
1054963651 9:70997569-70997591 AATGAAAACAAAAATGAAGATGG - Intronic
1055147134 9:72949333-72949355 AATGAAAGTCAGGATGAAGAAGG + Intronic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055661082 9:78504794-78504816 AATGAAAAACATAATAAGAAAGG + Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057471298 9:95359295-95359317 AATAAAAACCACAATGAGGCCGG + Intergenic
1057622741 9:96650992-96651014 AATAAAAAGCAGCCTGAGGCTGG + Intronic
1057745495 9:97747697-97747719 GGTGAAAAGCAGAATTAGAATGG - Intergenic
1057980154 9:99652440-99652462 AATGGAAAACAGAAAAAGGAGGG + Intergenic
1058110066 9:101022930-101022952 AATGAATAAAAGAATGAGAATGG - Intergenic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1058422951 9:104850494-104850516 AATGAAAAGATAAAAGAGGAAGG + Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058730142 9:107842012-107842034 AATTCAGAGCAGAATGATGAAGG - Intergenic
1059230106 9:112712700-112712722 AATGAACAGCAGATTGGAGATGG + Intronic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1059883103 9:118714404-118714426 AAAGAAAAGCAAAAGAAGGAAGG - Intergenic
1059932642 9:119276337-119276359 TATGAAAAGAAAAATCAGGAAGG - Intronic
1060232795 9:121838153-121838175 AAGGAAAAACAGAATTGGGAAGG - Intronic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062652447 9:137585039-137585061 ACTCACAAGCAGTATGAGGAAGG + Intronic
1203440854 Un_GL000219v1:7203-7225 AATGGAAAACAGAATAAGGCAGG - Intergenic
1203511732 Un_KI270741v1:125586-125608 AATGGAAAACAGAATAAGGCAGG - Intergenic
1203511861 Un_KI270741v1:127214-127236 AATGGAAAACAGAATAAGGCAGG - Intergenic
1186312734 X:8338369-8338391 GACGAAAAGCAGAATAAGGGAGG + Intergenic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1186956110 X:14683903-14683925 AAAAAAAAGCAGAATCAGTAGGG + Intronic
1187087615 X:16057980-16058002 AATCAAAACCATAATGAGGCTGG + Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187566094 X:20451126-20451148 AATGAAAAGCAGAGAGATGATGG - Intergenic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188119299 X:26285125-26285147 AATAGAAAGCAAAAAGAGGAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188744610 X:33827553-33827575 AATGAAAAGCAGAAAAAAGCAGG - Intergenic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1189493822 X:41491770-41491792 AATGAAAAGCAGAAATAGCTGGG + Intergenic
1189567868 X:42261984-42262006 ACTGAAAAGAAGAATGAGTATGG - Intergenic
1189585857 X:42461075-42461097 AATGAAAACTGGGATGAGGAAGG + Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1189783765 X:44541706-44541728 AATCAAAAGAAGGATGAGGAGGG + Intronic
1190200673 X:48357971-48357993 AATGAAAATAAAAATGAGCAGGG - Intergenic
1190706814 X:53035688-53035710 AATAAAAAGAAGGAAGAGGAGGG + Intergenic
1191096284 X:56675987-56676009 AATGGAAAGCAAAATGAAGCAGG + Intergenic
1191155567 X:57269051-57269073 AATGAAAAACAGAAAAAGAAGGG + Intergenic
1191776182 X:64816069-64816091 AATGGAAAGCAGAATGTAGCAGG + Intergenic
1192050067 X:67716644-67716666 AATGCCAGGCAGAAAGAGGATGG + Intronic
1192702958 X:73495859-73495881 AATGGAAAGCAGAAGAAGCAGGG - Intergenic
1192718404 X:73667173-73667195 AATGAAAAGCAGAAAAAAGCAGG - Intronic
1192922877 X:75725596-75725618 AAAGAAAAACAGAATGACAAAGG - Intergenic
1193520814 X:82527213-82527235 AATGACAAGCATAATGATGCTGG - Intergenic
1193739367 X:85199443-85199465 AAAGAAAAGCAGTATATGGAAGG + Intergenic
1193776375 X:85647762-85647784 AATGCAAATCAAAATGACGATGG + Intergenic
1194043434 X:88971420-88971442 ACTGAATAGCAGGATGAGGTTGG - Intergenic
1194084391 X:89508502-89508524 AATGAAAAGGAGAATCCAGAGGG - Intergenic
1194862456 X:99018057-99018079 AAAGAACAGTAGAATGAGGTGGG + Intergenic
1194930629 X:99882838-99882860 AATGAAAAGCAGAAAAATGCAGG + Intergenic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196039828 X:111190194-111190216 AAACACAAGCAGAGTGAGGAGGG + Intronic
1196175006 X:112630820-112630842 ATTCTAAAGCATAATGAGGAAGG + Exonic
1196362161 X:114874803-114874825 AATCAAAACCATAATGAGGCCGG - Intronic
1196512873 X:116532754-116532776 AATGAAGAACAGAATGGGCATGG - Intergenic
1196555658 X:117082082-117082104 AATTGAAAGCAGAAAGAAGAAGG - Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1197047671 X:122018684-122018706 AATGAATATCAGAATTTGGAAGG - Intergenic
1197190446 X:123641651-123641673 AATGAAAAACAGAGAAAGGAGGG - Intronic
1197489973 X:127104221-127104243 AATGGAAAGCAAAAAAAGGAGGG + Intergenic
1197600840 X:128526804-128526826 AATGAAAAACAAAAAGAGCAGGG + Intergenic
1197867867 X:131037652-131037674 AAGGAAAAGGGGAATGAGAAAGG - Intergenic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198237490 X:134749018-134749040 AATGAAAACAAGAATCAGGCTGG + Intronic
1198295568 X:135283338-135283360 AAAGAAAACAAGAATGAGAATGG + Intronic
1198381566 X:136088742-136088764 AAAGAAAAGAAAAATGGGGAGGG - Intergenic
1198460861 X:136861758-136861780 AAGTAAAAACAAAATGAGGAGGG + Intronic
1198596454 X:138241173-138241195 AATGGAAACCAGAATGAAGCAGG - Intergenic
1198708422 X:139475184-139475206 AATGAAAAGCAGCAAGCAGAAGG + Intergenic
1198949433 X:142053953-142053975 AATTAAAACCACAATGAGGCCGG - Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199194077 X:145006431-145006453 AGAGACAAGCAGAATGAAGACGG + Intergenic
1199340115 X:146667723-146667745 AATAAAAATCACAATAAGGATGG - Intergenic
1200086242 X:153608025-153608047 AATCAAAACTAGAATGAGGCTGG + Intergenic
1200437033 Y:3164391-3164413 AATGAAAAGGAGAATCCAGAGGG - Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic