ID: 1017474449

View in Genome Browser
Species Human (GRCh38)
Location 6:154774321-154774343
Sequence GCCACAGTGAGCTATGATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 757
Summary {0: 1, 1: 4, 2: 42, 3: 173, 4: 537}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017474449_1017474451 -9 Left 1017474449 6:154774321-154774343 CCACGATCATAGCTCACTGTGGC 0: 1
1: 4
2: 42
3: 173
4: 537
Right 1017474451 6:154774335-154774357 CACTGTGGCCTCGACCTCCTGGG 0: 20
1: 385
2: 4345
3: 22824
4: 76216
1017474449_1017474450 -10 Left 1017474449 6:154774321-154774343 CCACGATCATAGCTCACTGTGGC 0: 1
1: 4
2: 42
3: 173
4: 537
Right 1017474450 6:154774334-154774356 TCACTGTGGCCTCGACCTCCTGG 0: 26
1: 395
2: 4800
3: 24308
4: 86618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017474449 Original CRISPR GCCACAGTGAGCTATGATCG TGG (reversed) Intronic
900838551 1:5027396-5027418 TTCACAGTGAGCTATGACCATGG + Intergenic
900961350 1:5922934-5922956 GCTACAGTGAGCTGTGATTATGG + Intronic
900988770 1:6088119-6088141 GCTACAGTGAGCTGTGATTGTGG - Intronic
901129908 1:6955735-6955757 GCCCCACTGAGCTCTGATGGGGG + Intronic
901293491 1:8142687-8142709 GCTGCAGTGAGCTGTGATTGTGG + Intergenic
901545983 1:9957380-9957402 GTTACAGTGAGCCAAGATCGCGG - Intronic
902445512 1:16461027-16461049 GCTGCAGTGAGCTATGATCACGG + Intergenic
903119189 1:21203494-21203516 GTGTCAGTGAGCTATGATCGTGG + Intergenic
903204525 1:21771062-21771084 GATGCAGTGAGCTAAGATCGTGG + Intronic
903206462 1:21785965-21785987 GTTACAGTGAGCCAAGATCGTGG + Intergenic
903347532 1:22696813-22696835 GCTGCAGTGAGCTATGATGGAGG - Intergenic
903576807 1:24344427-24344449 GCTGCAGTGAGCTGTGATGGTGG + Intronic
903988427 1:27246926-27246948 GCTGCAGTGAGCTATGTTTGTGG - Intronic
904110591 1:28123052-28123074 GCTGCAGTGAGCTTTGATCATGG - Intergenic
904174285 1:28615045-28615067 ACTACAGTGAGCTGTGATCATGG + Intronic
904560783 1:31395847-31395869 GCTGCAGTGAGCCACGATCGCGG - Intergenic
904661644 1:32089965-32089987 GTTGCAGTGAGCTAAGATCGCGG + Intronic
905368628 1:37470475-37470497 GTTACAGTGAGCTATGATCACGG + Intergenic
905421603 1:37849823-37849845 GTTACAGTGAGCTATGATGATGG + Intronic
905765480 1:40596657-40596679 GCTGCACTGAGCTATGATCATGG - Intergenic
905958854 1:42026006-42026028 GCTGCAGTGAGCCGTGATCGTGG + Intronic
906469519 1:46116454-46116476 GCTGCAGTGAGCTATGATCAGGG + Intronic
906621557 1:47285083-47285105 GCTTCAGTGAGCCATGTTCGTGG - Intronic
906723905 1:48029576-48029598 GCTGCAGTGAGCTATTGTCGTGG + Intergenic
906988071 1:50708189-50708211 GCCACAGTGAGCAAAGACTGGGG + Intronic
907416180 1:54315721-54315743 GCTGCAGTGAGCTGTGATTGTGG - Intronic
907529166 1:55075905-55075927 GCTACAGTGAGCTACGACTGTGG + Intronic
908154870 1:61342333-61342355 GCCACAGTGATCTATAAACCAGG - Intronic
908532758 1:65049358-65049380 GCTGCAGTGAGCCATGATCGTGG + Intergenic
909571722 1:77120274-77120296 GCTACAGTGAGCTGAGATTGTGG - Intronic
910056917 1:83044542-83044564 ACTGCAGTGAGCTATGATGGTGG - Intergenic
910263298 1:85312474-85312496 GCCTCACTGAGCTGTGAGCGGGG + Intergenic
910595709 1:88978398-88978420 GCTGCAGTGAGCCATGATGGTGG - Intronic
910795600 1:91094635-91094657 GCTGCAGTGAGCTGTGATCATGG - Intergenic
910925924 1:92398086-92398108 GCTTCAGTGAGCCATGATTGTGG + Exonic
911017709 1:93352129-93352151 GCCACAGTAAACTATGACTGTGG - Intronic
912375677 1:109207923-109207945 GTTGCAGTGAGCTATGATGGTGG + Intergenic
912488120 1:110045413-110045435 GCTACAGTGAGCTATGATCATGG + Intronic
913457556 1:119048999-119049021 GCTGCAGTGAGCTGAGATCGCGG + Intronic
915124917 1:153657208-153657230 GCTACAGTGAGCCAAGATCGTGG - Intergenic
915278025 1:154803005-154803027 GCCTCAGTGAGCTATGAGAGAGG - Intronic
915435380 1:155901574-155901596 GTTACAGTGAGCCAAGATCGCGG + Intronic
915617624 1:157051703-157051725 GCAGCAGTGGGCTATGATCATGG + Intergenic
916100893 1:161392397-161392419 GCTGCTGTGAGCTATGATTGCGG - Intergenic
916123867 1:161551877-161551899 GCTACAGTGAGTTATGTTCATGG + Intergenic
916133751 1:161633240-161633262 GCTACAGTGAGTTATGTTCATGG + Intronic
916309874 1:163386184-163386206 GTTACAGTGAGCTGTGATTGCGG - Intergenic
916309893 1:163386349-163386371 GCTGCAGTGAGCTGTGATTGCGG - Intergenic
917357512 1:174142140-174142162 GCTACAGTGAGCTATGATCCTGG + Intergenic
917429141 1:174947477-174947499 GCTGCAGTGAGCCAAGATCGCGG - Intronic
918003501 1:180520443-180520465 GCTCCAGTGAGCTATGATAGTGG - Intergenic
918014481 1:180619754-180619776 CTTACAGTGAGCTATGATCATGG + Intergenic
918361841 1:183767156-183767178 GTTGCAGTGAGCTATGATCATGG + Intronic
919102558 1:193112422-193112444 GCTACAGTGAGCTGAGATCATGG - Intergenic
919340834 1:196304413-196304435 GCTGCAGTGAGCTATGATCATGG - Intronic
919836033 1:201573992-201574014 GCTACAGTGAGCTATGATAGTGG + Intergenic
919977349 1:202621355-202621377 GCTGCAGTGAGCTATGATCACGG - Intronic
920371459 1:205481797-205481819 GCCACAGTGAGCAGTGCTGGAGG + Intergenic
921050256 1:211506012-211506034 GCTCCAGTGAGCTATGATCAAGG - Intergenic
922205144 1:223439866-223439888 GCTGCAGTGAGCTATGATCGTGG - Intergenic
922281464 1:224128922-224128944 GCTGCAGTGAGCTGTGATCGTGG + Intronic
923017997 1:230141851-230141873 GCTGCAGTGAGATATGATTGTGG - Intronic
923679455 1:236107782-236107804 GCTGCAGTGAGCTATGATCATGG + Intergenic
924224049 1:241906291-241906313 GCTACAGTGAGCCAAGATTGAGG + Intergenic
924352780 1:243134557-243134579 GTTACAGTGAGCCATGATCATGG - Intronic
924814311 1:247428756-247428778 GCTGCAGTGAGCTATGATCATGG + Intronic
1062813690 10:483876-483898 GCTGCAGTGAGCTATGATTGTGG - Intronic
1063086343 10:2821410-2821432 GCTGCAGTGAGCTAGGATCACGG + Intergenic
1063212631 10:3894867-3894889 GTCACAGTGAGCCGAGATCGCGG + Intergenic
1063603548 10:7503595-7503617 TCCATAGTGAGCTATGAGGGAGG + Intergenic
1064097113 10:12431996-12432018 GCCACAGTGACCTCTGCTCAAGG - Intronic
1064112105 10:12548524-12548546 GCTGCAGTGAGCCATGATCACGG - Intronic
1064679017 10:17790492-17790514 GCTGCAGTGAGCTATGATTGTGG + Intronic
1065366880 10:24945514-24945536 GCTGCAGTGAGCTATGATTGTGG - Intronic
1065499487 10:26365280-26365302 GTTACAGTGAGCTATAATTGTGG - Intergenic
1065958438 10:30713689-30713711 GCTGCAGTGAGCTGTGATTGTGG - Intergenic
1066012354 10:31206614-31206636 GCTGCAGTGAGCTATGATTGTGG - Intergenic
1066532720 10:36358046-36358068 GCCACAGAGAGGTAGGATAGGGG - Intergenic
1066958857 10:42201015-42201037 GTTACAGTGAGCTATGATTATGG + Intergenic
1067735629 10:48848130-48848152 TCCACAGCAAGCTATGGTCGGGG - Intronic
1068450012 10:57174149-57174171 GCTGCAGTGAGATATGATCAAGG - Intergenic
1068471959 10:57476565-57476587 GCTGCAGTGAGCCATGATCGTGG + Intergenic
1069839341 10:71329394-71329416 GCTGCAGTGAGCCATGATCGTGG + Intronic
1069988896 10:72302058-72302080 GCCAAAGTGATCTATGGTCAGGG + Intergenic
1070111234 10:73488482-73488504 CCTGCAGTGAGCTATGATCATGG + Intronic
1070302837 10:75217193-75217215 GCTGCAGTGAGCTATGACTGTGG + Intronic
1070317681 10:75331508-75331530 GCTGCAGTGAGCTATGATCATGG - Intergenic
1071216475 10:83408435-83408457 GTTACAGTGAGCTATGATTATGG + Intergenic
1071707677 10:88017138-88017160 GCTGCAGTGAGCTGTGATCCTGG - Intergenic
1074750470 10:116580876-116580898 GCTTCAGTGAGCTTTGATTGTGG - Intergenic
1075017297 10:118919414-118919436 GCTGCAGGGAGCTATGATCACGG - Intergenic
1075342290 10:121656841-121656863 ACCGCAGTGAGCTGTGATAGTGG - Intergenic
1075369506 10:121923401-121923423 GTTACAGTGAGCTATGATGATGG + Intronic
1075448848 10:122533392-122533414 GCTGCAGTGAGCTGTGATTGTGG - Intergenic
1075816586 10:125269402-125269424 GCTGCAGTGAACTATGATCATGG + Intergenic
1076053073 10:127350662-127350684 ACCACAGTGGGCTATGAGCATGG - Intronic
1077395537 11:2318975-2318997 GCTGCAGTGAGCCATGATCACGG + Intergenic
1077724705 11:4662419-4662441 GCTGCAGTGAGCTATGATCTTGG - Intergenic
1078155629 11:8797644-8797666 GCTTCAGTGAGCTATGATCATGG - Intronic
1078446415 11:11408301-11408323 GCTGCAGTGAGCCAAGATCGTGG + Intronic
1078646644 11:13147071-13147093 GTCACAGTGAGCCACGATCATGG - Intergenic
1078797600 11:14608287-14608309 GCTGCAGTGAGCTATGAGCCTGG + Intronic
1078803563 11:14671953-14671975 GCTGCAGTGAGCTGTGATTGTGG + Intronic
1079535743 11:21513066-21513088 GCCACAGTCAGCTATGGTTTGGG + Intronic
1079546425 11:21638255-21638277 GCTGCAGTTAGCTATGATCATGG - Intergenic
1079845314 11:25459014-25459036 GCTGCAGTGAGCTGTGATTGTGG + Intergenic
1081977762 11:47246512-47246534 GCTGCAGTGAGCTATGACTGAGG + Intronic
1082085030 11:48043276-48043298 GCTGCAGTGAGCTATGATCATGG - Intronic
1082832115 11:57626304-57626326 GCTGCAGTGATCTATGATTGAGG - Intergenic
1082836774 11:57656842-57656864 GCTGCAGTGAGCCATGTTCGCGG + Intronic
1083047746 11:59752034-59752056 GCTGCAGTGAACTATGATCACGG - Intronic
1083705698 11:64512830-64512852 GCTGCAGTGAGCTACGATCACGG + Intergenic
1083822308 11:65180312-65180334 GTTACAGTGAGCTGTGATCAGGG + Exonic
1083874923 11:65517398-65517420 GCTGCAGTGAGCTATGATTACGG - Intergenic
1083950334 11:65951597-65951619 GCTGCAGTGAGCTATGATCGTGG - Intronic
1083992387 11:66254601-66254623 GCTGCAGTGAACTATGATTGTGG + Intergenic
1084037314 11:66520096-66520118 GCTGCAGTGAGCTATGATTGTGG + Intronic
1084537370 11:69764937-69764959 GCTGCAGTGAGCTGTGATTGAGG - Intergenic
1086083567 11:82931411-82931433 GCTGCAGTGAGCCATGATCTTGG - Intronic
1086214205 11:84358217-84358239 GCCACAGTCAGCTTTTATCAAGG - Intronic
1088327665 11:108617331-108617353 GCTGCAGTGAGCTATGGTTGGGG + Intergenic
1088825896 11:113494235-113494257 GCTGCAGTGAGCTATGATCAGGG - Intergenic
1089365848 11:117920552-117920574 GTCGCAGTGAGCCAAGATCGCGG - Intronic
1089444867 11:118543866-118543888 GTTACAGTGAGCTAAGATCGTGG - Intronic
1089472714 11:118733699-118733721 ACCACATGGATCTATGATCGAGG - Intergenic
1089817985 11:121193547-121193569 GCTGCAGTGAGCCATGATCATGG + Intergenic
1089925382 11:122251671-122251693 ATCACAGTGAGCTGTGATTGTGG - Intergenic
1090826179 11:130388119-130388141 GCTGCAGTGAGCCATGATGGTGG - Intergenic
1090858189 11:130629909-130629931 GCTGCAGTGAGCCATGATCATGG - Intergenic
1091021591 11:132104841-132104863 GCTGCAGTGAGCTGTGATTGTGG + Intronic
1091260334 11:134229089-134229111 GCTGCAGTGAGCTGTGATCGTGG - Intronic
1091372343 11:135071441-135071463 GCTACAATGAGCTATAATCATGG - Intergenic
1091510571 12:1120047-1120069 GTTACAGTGAGCTATGATCAAGG - Intronic
1091622605 12:2100694-2100716 GCTGCAGTGAGCTGTGATCACGG + Intronic
1091756156 12:3053456-3053478 GCTGCAGTGAGCCATGATCACGG - Intergenic
1092520576 12:9268625-9268647 GCTGCAGTGAGCCATGATCATGG - Intergenic
1092723106 12:11461154-11461176 GCTGCAGTGAGCTGAGATCGTGG - Intronic
1092742261 12:11641147-11641169 GCTGCAGTGAGCTATGATTTTGG - Intergenic
1092809494 12:12259199-12259221 GTCACAGTGAGCCAAGATCATGG + Intronic
1093228720 12:16516463-16516485 GCCACAGAGAGCTAATATCCAGG - Intronic
1093650320 12:21635815-21635837 GCTTCAGTGAGCTATGACAGCGG + Intronic
1093754993 12:22842345-22842367 ACTATAGTGAGCTATGATGGTGG - Intergenic
1093820973 12:23617061-23617083 GCTGCAGTGAGCTGTGATTGTGG + Intronic
1093879031 12:24382673-24382695 GCCACAATGAGAAATGATGGTGG + Intergenic
1094129350 12:27058706-27058728 GCTGCAGTGAGCCATGATCGCGG + Intronic
1094369996 12:29727850-29727872 GCTGCAGTGAGCTATGATTGTGG - Intronic
1095154251 12:38833288-38833310 GTAACAGTGAGCTGAGATCGTGG + Intronic
1095934738 12:47665700-47665722 GCTGCAGTGAGCCATGATTGTGG - Intronic
1096264758 12:50113997-50114019 GCTGCAGTGAGCTGTGATCACGG - Intronic
1096710331 12:53451086-53451108 GCTACAGTGAGCCATGATGACGG - Intergenic
1096733516 12:53633961-53633983 GCTGCAGTGAGCTATGATCGGGG - Intronic
1096988248 12:55776368-55776390 GCTGCAGTGAGCCATGATCTGGG + Intronic
1097159081 12:57033413-57033435 GCTGCAGTGAGCTGTGATGGTGG - Intronic
1097437034 12:59562751-59562773 GCTGCAGTGAGCCATAATCGTGG - Intergenic
1097865461 12:64556220-64556242 GCTGCAGTGAGCCATGATCACGG - Intergenic
1099077900 12:78134688-78134710 GCTACAGTGAGCTATGATCGTGG + Intronic
1099169100 12:79342291-79342313 TCTTCAGTGAGCTATGATTGTGG - Intronic
1099901671 12:88718389-88718411 GCTCCAGTGAGCCATGATCGTGG - Intergenic
1100382147 12:94072088-94072110 GCTACAGTGAGCCATGATCGAGG - Intergenic
1100484601 12:95012872-95012894 GCTGCAGTGAGCTATGATCGTGG + Intergenic
1100488422 12:95054367-95054389 GCTGCAGTGAGCTATGATCCTGG - Intronic
1100634038 12:96417786-96417808 GCTGCAGTGAGCAATGATAGAGG + Intergenic
1100634227 12:96419713-96419735 ACTGCAGTGAGCTATGATAGAGG + Intergenic
1101011918 12:100459775-100459797 GCTATAGTTAGCCATGATCGTGG + Intergenic
1101037802 12:100722245-100722267 GCCAAAGTGGGCAATGATGGTGG - Intronic
1101418718 12:104531420-104531442 GCTGCAGTGAGCTATGATTGTGG + Intronic
1101611221 12:106294080-106294102 GCTACAGTGAGCTATCATCATGG - Intronic
1102082238 12:110107823-110107845 GCTGCAGTGAGCTGTGATCATGG + Intergenic
1102208327 12:111105924-111105946 GCTGCAGTGAGCCATGATCATGG - Intronic
1102233497 12:111279624-111279646 ACCACAGTGAGCTGTGATCATGG + Intronic
1102332624 12:112047577-112047599 GCTGCAGTGAGCTATGATCTTGG + Intronic
1102387646 12:112523537-112523559 GCTGCAGTGAGCCATGATCATGG + Intergenic
1103078754 12:118006458-118006480 GCTACAGGGAGCCATGATCAGGG + Intergenic
1103805401 12:123568634-123568656 GCTGCAGTGAGCTGTGATCATGG + Intergenic
1103813819 12:123637021-123637043 GCTGCAGTGAGCTATATTCGTGG + Intronic
1104201722 12:126596258-126596280 GCTGCACTGAGCTATGATCATGG - Intergenic
1105351890 13:19623328-19623350 GCTACAGTAAGCCGTGATCGTGG + Intergenic
1105376149 13:19846863-19846885 GCTGCAGTGAGCTATGATCATGG + Intronic
1105431597 13:20342252-20342274 GCTGCAGTGAGCTCTGATCATGG - Intergenic
1105563722 13:21521836-21521858 GCTGCAGTGAGCTGTGATCACGG - Intronic
1105901211 13:24754832-24754854 GCAACAGTAAGCCATGATGGTGG + Intergenic
1106009705 13:25808189-25808211 GCTTCAGTGAGCTATGACTGTGG - Intronic
1106162120 13:27211075-27211097 GCTGCAGTGAGCTGTGATCATGG - Intergenic
1106637911 13:31550864-31550886 GCTACAGTGAGCCATGATCCAGG - Intergenic
1107008887 13:35647935-35647957 GCTGCAGTGAGCCATGATCATGG - Intronic
1107312893 13:39098820-39098842 GCTGCAGTCAGCTATGATCATGG - Intergenic
1107324307 13:39224564-39224586 GCTACACTGATCTATGATCATGG - Intergenic
1107367798 13:39703793-39703815 GCTGCAGTGAGCTACGATCCTGG - Intronic
1108381262 13:49856950-49856972 GTTACAGTGAGCCAAGATCGCGG - Intergenic
1108401595 13:50050703-50050725 GCTGCAGTGAGCTACGATCATGG - Intergenic
1108985303 13:56578739-56578761 GCTGCAGTGAGCTGAGATCGTGG + Intergenic
1110315254 13:74099282-74099304 GCTGCAGTGAGCTAAGATCAAGG + Intronic
1110452380 13:75651369-75651391 GTCACAGTGAGCTGAGATCATGG - Intronic
1111353430 13:87063979-87064001 GCTCCAATGAGCTATGATGGTGG - Intergenic
1111701018 13:91689105-91689127 GCTACAGGGAGCTATGATCCTGG + Intronic
1111759675 13:92445837-92445859 GCCACAGTGAGCTATGATCTTGG - Intronic
1112395154 13:99022885-99022907 GCCGCATTGAGCTATGACTGTGG + Intronic
1113532059 13:111034459-111034481 GCTGTAGTGAGCTATGATCGTGG + Intergenic
1114295950 14:21329341-21329363 GCCACAATTAGCTATGATTATGG - Intronic
1115264648 14:31488402-31488424 GCTGCAGTGTGCTATGATCATGG + Intergenic
1115987479 14:39116810-39116832 GCTGCAGTGAGCTATGATCGTGG - Intronic
1116897076 14:50326977-50326999 GCTGCAGTAAGCTATGATCACGG + Exonic
1118245761 14:64108935-64108957 GCTCCAGTGAGCCATGATTGTGG - Intronic
1118291856 14:64533944-64533966 GTTACAGTGAGCTATAATCTTGG - Intergenic
1118305328 14:64650546-64650568 GCTGCAGTGAGCTATGATCATGG - Intergenic
1118593313 14:67417803-67417825 GCTGCAGTGAGCTGTGATTGCGG - Intergenic
1118618316 14:67591591-67591613 GCTGCAGTGAGCTTTGATCATGG - Intronic
1118939796 14:70322576-70322598 ACTACAGTAAGCTATGATTGTGG + Intergenic
1119121871 14:72087190-72087212 GTTGCAGTGAGCTAAGATCGTGG - Intronic
1119249764 14:73141721-73141743 GTTGCAGTGAGCCATGATCGTGG + Intronic
1120486716 14:85123480-85123502 GCTGCAGTGAGCTATGATCATGG - Intergenic
1121136364 14:91502362-91502384 GCTGCAGTGAGCTATGATCGTGG + Intronic
1122527556 14:102398791-102398813 GCTGCAGTGAGCTATGATTGAGG + Intronic
1122533294 14:102444253-102444275 GCTGCAGTGAGCCGTGATCGTGG - Intronic
1122561812 14:102620657-102620679 GGCTCAGTGAGCTCTGATTGTGG + Intronic
1122607454 14:102956765-102956787 GTTGCAGTGAGCTATGATGGTGG + Intronic
1122655766 14:103258396-103258418 GCCACAGGGAGATATGACCGTGG - Intergenic
1124020739 15:25920475-25920497 GCTATAGTGAGCTGTGATCGTGG + Intergenic
1124457591 15:29858603-29858625 GCTGCAGTGAGCTGTGATTGTGG - Intronic
1125547660 15:40518749-40518771 GCTACAGTGAGCTATGATCGTGG - Intergenic
1125852339 15:42915883-42915905 GCTGCAGTGAGCTACGATCATGG + Intronic
1125919053 15:43514195-43514217 GCCAAAGTAAGCTCTGATCTAGG - Intronic
1126116179 15:45209751-45209773 GCTACAGTGCACTATGATTGTGG + Intergenic
1127159584 15:56167249-56167271 GCTGCAGTGAGCTATGATCATGG + Intronic
1127224961 15:56918857-56918879 GCCAAAGTGAACTTTAATCGGGG + Exonic
1127235201 15:57042473-57042495 GTCACAGTGAGCAATGACTGTGG - Intronic
1127412409 15:58722472-58722494 GCCACAGTGAGCTATGATAACGG + Intronic
1128297277 15:66534042-66534064 GCTGCAGTGAGCTGTGATCGTGG + Intronic
1128628895 15:69242993-69243015 GCTACAGTGAGCTATGAGCATGG + Intronic
1129106660 15:73313837-73313859 GCTGCAGTGAGCCAAGATCGAGG + Intergenic
1129316322 15:74747245-74747267 GCTGCAGTGAGCCATGATTGTGG + Intergenic
1129414898 15:75370174-75370196 CCTGCAGTGAGCTATGATCGTGG + Exonic
1129736576 15:77969360-77969382 GCTGCAGTGAGCCATGATTGTGG - Intergenic
1129830132 15:78663525-78663547 GTTTCAGTGAGCCATGATCGCGG - Intronic
1129849499 15:78784301-78784323 GCTGCAGTGAGCCATGATTGTGG + Intronic
1129978228 15:79841296-79841318 GTTACAGTGAGCTATGATTGCGG - Intronic
1130252794 15:82311446-82311468 GCTGCAGTGAGCCATGATTGTGG - Intergenic
1130340000 15:82992155-82992177 ACTACAGTGAGCTAGGATCATGG + Intronic
1130682806 15:86011108-86011130 GCCAAAGTGAGCCAAGATTGAGG + Intergenic
1131124175 15:89844397-89844419 GCTGCAGTGAGCTATTATCATGG - Intronic
1131128087 15:89873344-89873366 GCTGCAGTGAGCCAAGATCGTGG - Intronic
1131924358 15:97365662-97365684 GCTGCTGTGAGCTATGATCAGGG - Intergenic
1132053745 15:98633662-98633684 GCTGCAGTGAGCTATGATCGCGG + Intergenic
1132097970 15:99002071-99002093 GCTGCAGTAAGCTATGATCGTGG - Intronic
1132387371 15:101409992-101410014 GCTGCAGTGAGCAATGATTGTGG - Intronic
1133295829 16:4751844-4751866 GCTGCAGTGAGCTATGATCATGG + Exonic
1133309983 16:4838946-4838968 GCTACAGTGAACTGTGATTGAGG - Intronic
1133986283 16:10670964-10670986 GCTGCAGTGAGCTATGATCGTGG - Intronic
1134503131 16:14784652-14784674 GCTGCAGTGAGCTATGATTGTGG + Intronic
1134577434 16:15344246-15344268 GCTGCAGTGAGCTATGATTGTGG - Intergenic
1134617376 16:15661993-15662015 GCTGCAGTAAGCTATGATCACGG - Intronic
1134725012 16:16412263-16412285 GCTGCAGTGAGCTATGATTGTGG + Intergenic
1134942420 16:18299595-18299617 GCTGCAGTGAGCTATGATTGTGG - Intergenic
1135275575 16:21109659-21109681 GCTGCAGTGAGTTATGATTGAGG - Intronic
1135385155 16:22032606-22032628 GCTGCAGTGAGCTATGATTGGGG - Intronic
1135568491 16:23530185-23530207 GCTGTAGTGAGCCATGATCGTGG - Intronic
1135584397 16:23657392-23657414 GTTGCAGTGAGCTATGATTGTGG + Intronic
1136051836 16:27656354-27656376 GCTGCAGTGAGCTGTGATCATGG + Intronic
1136140466 16:28285006-28285028 GCTGCAGTGAGCTGTGATCATGG - Intergenic
1136173648 16:28503309-28503331 GCTGCAGTGAGTTATGATCCTGG - Intronic
1136291527 16:29275358-29275380 ACTACAGTGAGGTATGATTGTGG - Intergenic
1136359605 16:29770155-29770177 GCTACAGTGAGCTGTAATAGTGG + Intergenic
1136458143 16:30394097-30394119 GATGCAGTGAGCCATGATCGTGG - Intronic
1136462378 16:30419508-30419530 GCTACAGTGAGCTAATATTGTGG + Intronic
1137790759 16:51172802-51172824 GCTACAGTGAGCTATGATCATGG - Intergenic
1137824144 16:51475155-51475177 GCTGCAGTGAGCGATGATCATGG - Intergenic
1137845140 16:51680259-51680281 GTCACAGTGAGTTATTATCTTGG - Intergenic
1138111026 16:54324062-54324084 GCCATAGTGAGCTATGATTGGGG - Intergenic
1138112336 16:54334049-54334071 GTTACAGTGAGCTATGATCATGG - Intergenic
1138291167 16:55848166-55848188 GCTGCAGTGAGCTGTGATCATGG - Intronic
1138517727 16:57546183-57546205 GCTGCAGTGAGCTATGATGGTGG - Intronic
1138608782 16:58106546-58106568 GCTGCAGTGAGCTGAGATCGTGG - Intergenic
1138656139 16:58492601-58492623 GCTGCAGTGAGCTAAGATTGTGG - Intronic
1138817677 16:60221712-60221734 GCTGCAGTGAGCTGTGATTGTGG - Intergenic
1139380349 16:66526688-66526710 GCCGCAGTGAGCCATGATCATGG + Intronic
1139397124 16:66649143-66649165 CCTACCGTGAGCTATGATCATGG + Intronic
1139624455 16:68174784-68174806 GTTACAGTGAGCTCTGATTGTGG + Intronic
1139722536 16:68868080-68868102 GCTATAGTGAGCCATGATCATGG + Intronic
1139743034 16:69052007-69052029 GCTGCAGTGAGCCATGATGGTGG - Intronic
1139929021 16:70510382-70510404 GCCACAGTGAACTATGACTGTGG - Intronic
1140497292 16:75400218-75400240 GTTACAGTGAGCTATTATCGTGG + Intronic
1141617155 16:85216340-85216362 GCTGCAGGGAGCTATGATCCCGG + Intergenic
1142097405 16:88249287-88249309 ACTACAGTGAGGTATGATTGTGG - Intergenic
1142343236 16:89537591-89537613 GCTGCAGTGAGCTATGATGGTGG - Intronic
1142467428 17:144318-144340 GCTGCAGTGAGCCAAGATCGCGG - Intergenic
1142569795 17:865919-865941 GTTGCAGTGAGCTAAGATCGCGG + Intronic
1142734824 17:1890300-1890322 GCTGCAGTGAGCCATGATCGTGG + Intronic
1143110664 17:4551041-4551063 GCTGCAGTGAGCCATGATCATGG - Intronic
1143465823 17:7135562-7135584 GCTGCAGTGAGCCATGATTGAGG + Intergenic
1143565035 17:7716059-7716081 ACCACAGCTAGCTATGATGGGGG - Intergenic
1143685189 17:8508166-8508188 ACCAGAGTGAGCTGTGATCGTGG - Intronic
1143755380 17:9063504-9063526 TCCACATTGAGCTATGAAAGAGG + Intronic
1144820843 17:18072964-18072986 GCCACAGTGAGTCATGATTATGG - Intergenic
1145049175 17:19646433-19646455 GCTGCAGTGAGCCATGATCATGG + Intergenic
1145918412 17:28591329-28591351 GCTGCAGTGAGCTATGATCATGG - Intronic
1146111955 17:30097994-30098016 GCTGCAGTGAGCTGTGATTGTGG - Intronic
1146135594 17:30318004-30318026 GCTACAGTGAGCTGTGATCAAGG + Intronic
1146140133 17:30359909-30359931 GCTTCAGTGAGCCATGATCGTGG + Intergenic
1146459723 17:33036490-33036512 GTTGCAGTGAGCTATGATCATGG - Intronic
1147776690 17:42906816-42906838 GCTGCAGTGAGCTATGATCATGG + Intronic
1147802740 17:43105299-43105321 GCTGCAGTGAGCTATGATTGTGG - Intronic
1148116682 17:45179513-45179535 GCTGCAGTGAGCTGTGATCGCGG + Intergenic
1148479575 17:47951238-47951260 ACGACAGTGAGCCATGATTGTGG - Intergenic
1149479288 17:56989126-56989148 GCTGCAGTGAGCTGTGATCATGG + Intronic
1149594508 17:57856401-57856423 GCTGCAGTGGGCTATGATTGTGG + Intergenic
1149815420 17:59718563-59718585 GTTGCAGTGAGCTATGATTGTGG - Intronic
1150638370 17:66932539-66932561 GCTGCAGTGAGCCATGATCGTGG - Intergenic
1150674193 17:67230533-67230555 GTTGCAGTGAGCTAAGATCGCGG + Intronic
1150771106 17:68041662-68041684 GCTGCAGTGAGCTGTGATCGTGG + Intronic
1150815182 17:68387188-68387210 GCTGCAGTGAGCTATGATCTTGG - Intronic
1150901640 17:69284298-69284320 GCTGCAGTGAGCTGTGATTGTGG + Intronic
1151257356 17:72888838-72888860 ACTGCAGTGAGCTATGATTGTGG + Intronic
1151269481 17:72983209-72983231 GCTGCAGTGAGCTGAGATCGCGG - Intronic
1151606118 17:75137416-75137438 GCTACAGTGGGCTGTGATTGAGG - Intronic
1151686776 17:75652163-75652185 GCTGCAGTGAGCTGAGATCGTGG + Intronic
1152560609 17:81076907-81076929 GCAGCAGTGAGCCATGATTGTGG + Intronic
1152589789 17:81205835-81205857 GCTGCAGTGAGCTATGATCGTGG + Intronic
1152692989 17:81729330-81729352 GCTACAGTGAGCCGTGATGGTGG + Intergenic
1153102500 18:1489419-1489441 GTTACAGTGAGCTATGATCATGG - Intergenic
1153332874 18:3891811-3891833 GTTACAGTGAGCTATAATCCTGG - Intronic
1154316746 18:13310285-13310307 GCTGAAGTGAGCTATGATCATGG + Intronic
1154440043 18:14381547-14381569 CCCATAGTGACCTATGACCGAGG - Intergenic
1156178426 18:34574494-34574516 GTCACAGTGAGCAATGGTCTGGG + Intronic
1157264481 18:46206145-46206167 GCTGCAGTGAGCCATGATCATGG - Intronic
1157445534 18:47743923-47743945 GCTGCAGTGAGCTATGATGGTGG - Intergenic
1157640818 18:49212557-49212579 GCTGCAGTGAGCTATGATTGTGG - Intronic
1157664568 18:49475014-49475036 GCTACAGTGACCTGTGATCATGG - Intergenic
1158439301 18:57459982-57460004 GTTGCAGTGAGCTATGATTGGGG - Intronic
1158607838 18:58911623-58911645 GCTGCAGTGAGCTATGATCATGG + Intronic
1158617769 18:59003943-59003965 GCTACAGTGAGCTGTGATTATGG + Intergenic
1158815226 18:61087453-61087475 GCCACAGAGAGCTAGGAGAGAGG - Intergenic
1159977870 18:74738356-74738378 GCTGCAGTGAGCCAAGATCGTGG + Intronic
1160212260 18:76891432-76891454 GCTGCAGTGAGCTATGATCGTGG - Intronic
1161107015 19:2448949-2448971 GCTGCAGTGAGCTGTGATTGCGG - Intronic
1161130168 19:2583733-2583755 GCTACAGTGAGCCCTGATGGTGG + Intronic
1161158878 19:2750495-2750517 GCTACAGTGAGCTATGCTCACGG + Intergenic
1161205371 19:3038267-3038289 GCTGCAGTGAGCTATGACGGTGG - Intronic
1161212697 19:3075825-3075847 GCTGCTGTGAGCTATGATCGCGG + Intergenic
1162045309 19:7995972-7995994 GCTGCAGTGAGCTATGATTATGG - Intronic
1162137715 19:8566045-8566067 GTTACAGTGAGCTGTGATTGTGG + Intronic
1162214125 19:9118343-9118365 GCTGCAGTGAGCCATGATCGTGG + Intergenic
1162224887 19:9212812-9212834 GCTGTAGTGAGCTGTGATCGTGG - Intergenic
1162488847 19:10979452-10979474 GCTGCAGTGAGCCATGATCGTGG - Intronic
1162510055 19:11112598-11112620 GCTGCAGCGAGCTATGATGGAGG - Intronic
1163350949 19:16776878-16776900 GCTGCAGTGAGCTGTGATTGTGG + Intronic
1163399043 19:17080805-17080827 GCTACAGTGAGCTATGATCATGG + Intronic
1163788150 19:19288225-19288247 GCTGCAGTGAGCTATGATCGTGG - Intronic
1164467406 19:28499560-28499582 GCTGCAGTGAGCTATGAGCATGG - Intergenic
1165086302 19:33350310-33350332 GCTGCAGTGAGCCGTGATCGTGG + Intergenic
1165203262 19:34162524-34162546 GCTGCAGTGAGCTGTGATCGTGG - Intergenic
1165414680 19:35685390-35685412 GCTGCAGTGAGCTGAGATCGTGG - Intergenic
1165587291 19:36929787-36929809 TCTTCAGTGAGCTATGATTGTGG + Intronic
1165870607 19:38970267-38970289 GCTGCAGTGAGCTATGATCGTGG - Intronic
1165901575 19:39171801-39171823 GCCACAGTGAGCTGAGAACGTGG - Intronic
1165990676 19:39811008-39811030 GATGCAGTGAGCTATGATCCTGG - Intergenic
1166038704 19:40189491-40189513 GCTACTGTGAGCTGTGATTGTGG - Intergenic
1166045873 19:40230775-40230797 GCTGCAGTGAGCTATGATTGCGG - Exonic
1166087336 19:40485742-40485764 GCTGCAGTGAGCCATGATTGTGG + Intronic
1166539209 19:43594479-43594501 CCGTCAGTGAGCTAGGATCGCGG + Intronic
1166612224 19:44209011-44209033 GCTGCAGTGAGCTATGACCACGG + Intronic
1166706312 19:44909854-44909876 GCTGCAGTGAGCTGTGATGGCGG - Intergenic
1167087916 19:47323269-47323291 GTTGCAGTGAGCTATGATTGTGG + Intergenic
1167297249 19:48658661-48658683 GCTGCAGTGAGCTATGATCGTGG - Intergenic
1167433716 19:49467077-49467099 GCTGCAGTGAGCCATGATTGTGG - Intronic
1167557401 19:50204831-50204853 GCTGCAGTGAGCCATGATCGTGG + Intronic
1167805154 19:51777728-51777750 GCGGCAGTGAGCTATGATTGTGG + Intronic
1167813307 19:51854388-51854410 GCTGCAGTGAGCCATGATCGTGG - Intergenic
1168076807 19:53984889-53984911 GCTGCAGTGAGCTAGGATCGCGG + Exonic
1168261160 19:55195633-55195655 ACTGCAGTGAACTATGATCGGGG - Intronic
1168278843 19:55292944-55292966 GCTGCAGTGAGCTATGACTGTGG + Intronic
1168367950 19:55805599-55805621 GCCACGGTGAGCTGAGATTGTGG - Intronic
1168595312 19:57670920-57670942 GCTGCAGTGAGCTGTGATTGGGG - Intronic
1168726460 19:58585229-58585251 GCTGCAGTGAGCCATGATTGTGG + Intergenic
925391488 2:3497559-3497581 GCTGCAGTGAGCTGTGATTGTGG - Exonic
925925360 2:8666276-8666298 GCCTCAGGGAGCTATGAGCCTGG - Intergenic
926832527 2:16979140-16979162 GCTGCAGTGAGCCATGATCATGG + Intergenic
927039104 2:19210172-19210194 GCCACAGGGAGCTACAATCATGG - Intergenic
927883507 2:26705024-26705046 GCTGCAGTGAGCCATGATCATGG - Intronic
927977618 2:27351052-27351074 ACTGCAGTGAGCTATGATTGTGG + Intronic
928475391 2:31621691-31621713 GTTACAGTGAGCTATGATCATGG - Intergenic
928519913 2:32078586-32078608 GCTACAGTGAGCTATGATAATGG + Intronic
928967590 2:36992784-36992806 GCTGCAGTGAGTTATGATCATGG - Intronic
929134918 2:38614618-38614640 GTTGCAGTGAGCCATGATCGTGG - Intergenic
929438224 2:41945144-41945166 GCTATAGTGAGCTATGATCATGG - Intronic
929566068 2:42985845-42985867 GCTGCAGTGAGCTATGATTGGGG - Intergenic
930064444 2:47317099-47317121 GCTGCAGTGAGCTGAGATCGTGG - Intergenic
930076692 2:47411475-47411497 GCTGCAGTGAGCCAAGATCGTGG - Intronic
930331037 2:49984103-49984125 GCTGCAGTGAGCTGTGATCATGG + Intronic
930776647 2:55178988-55179010 GCTGCAGTGAGCTGTGATTGTGG - Intronic
931202661 2:60114433-60114455 GCTGCAGTGACCTATGATCATGG + Intergenic
931291124 2:60874734-60874756 GCTATAGTGAGCCATGATCCTGG - Intergenic
931391490 2:61847708-61847730 GCTGCAGTGAGCTATGATGGAGG + Intronic
931779239 2:65565381-65565403 GCTGCAGTGAGCCATGATCGTGG - Intergenic
932690307 2:73907541-73907563 GCTGCAGTGAGCTGTGATCATGG - Intronic
933855376 2:86408712-86408734 GCTACAGTGAGCTATCACCATGG + Intergenic
934035396 2:88084810-88084832 GCTGCAGTGAGCTGTGATCAGGG - Intronic
934696958 2:96406892-96406914 GCTGCAGTGAGCTATGATTATGG - Intergenic
934964797 2:98711696-98711718 GCTGCAGTGAGCCATGATTGAGG - Intronic
935295711 2:101647517-101647539 GCTACAGTGAGCTATGATCAGGG + Intergenic
935695333 2:105766383-105766405 GCCACAGTGAGCCATGATGGCGG - Intronic
935790970 2:106589815-106589837 GCTGCAGTGTGCTATCATCGTGG - Intergenic
935807050 2:106759668-106759690 GCTGCAGTGAGCTATGATCATGG - Intergenic
936585792 2:113756606-113756628 GGCACAGTCAGCTATGGCCGCGG + Exonic
936646759 2:114381061-114381083 GCTGCAGTGAGCTATGATCATGG + Intergenic
937147680 2:119661275-119661297 GCTGCAGTGAGCCATGATCCTGG + Intronic
937696018 2:124809466-124809488 GCTGCAGTGAGCTATGATCATGG - Intronic
938823529 2:134982178-134982200 GCTGCAGTGAGATATGATCAGGG - Intronic
938856010 2:135311686-135311708 ACTGCAGTGAGCTATGATTGTGG + Intronic
938875475 2:135527727-135527749 GCAACAGTGGGCTATGGTTGTGG - Intronic
938907858 2:135855602-135855624 GCTGCAGTGAGCTATGACTGTGG + Intronic
939977337 2:148733557-148733579 GATGCAGTGAGCTATGATGGCGG - Intronic
940222901 2:151372074-151372096 GCTACAGTGCGCTATGCTGGTGG + Intronic
940647842 2:156409982-156410004 GCTACAGTGTGCTATGATTGTGG + Intergenic
942160607 2:173181992-173182014 GCCACAGTGAGCCGAGATCAAGG + Intronic
942498229 2:176561606-176561628 GCCACGCTAAGCTATGATGGAGG - Intergenic
943043725 2:182833054-182833076 GCTGCAGTAAGCTATGATTGCGG - Intergenic
944712294 2:202345348-202345370 GCTGCAGTGAGCTATGATCATGG - Intergenic
944714539 2:202365805-202365827 ACTGCAGTGAGCTATGATCATGG + Intergenic
944990920 2:205234256-205234278 GCTACAGTGAGCTGTGATCATGG + Intronic
944991916 2:205247988-205248010 GCTGCAGTGAGCTGTGATCATGG - Intronic
945993908 2:216419965-216419987 GCTGCAGTGAGCCATGATCACGG + Intronic
946507649 2:220318569-220318591 GCTACAGTTAACTATGATTGTGG + Intergenic
947092510 2:226528260-226528282 ACAACAGTGAGCCATGATCCAGG + Intergenic
947770116 2:232663852-232663874 GCTGCAGTGAGCCATGATTGAGG - Intronic
947853658 2:233308403-233308425 GCTGCGGTGAGCTATGATTGTGG + Intronic
948237854 2:236403843-236403865 GGCACAGCGAGCGAGGATCGGGG - Intronic
948972121 2:241436922-241436944 GCTACAGTGAGCCAAGATAGTGG + Intronic
948973827 2:241450299-241450321 GCTGCAGTGAGCCATGATTGTGG + Intronic
1168781150 20:491607-491629 GCTGCAGTCAGCTATGATCATGG + Intronic
1169049452 20:2563786-2563808 GCCACAGTGAGTTAAAATGGTGG - Intronic
1169610543 20:7375050-7375072 GCCTCAATGAGCTATGATGGTGG + Intergenic
1169634989 20:7680112-7680134 GCTACAGTGAGCTATGATCGTGG - Intergenic
1170761623 20:19256035-19256057 GCTGCAGTGACCTATGATGGTGG + Intronic
1170891261 20:20377714-20377736 GCCACAGTAAGCCATGATCATGG - Intergenic
1172143156 20:32738185-32738207 GCTGCAGTGAGCTATGACCATGG - Intronic
1172341269 20:34159623-34159645 GCCGCACTAAGCTATGATCATGG + Intergenic
1172459703 20:35108083-35108105 GCTTCAGTGAGCTTTGATTGCGG + Intergenic
1172546645 20:35767020-35767042 GCTGCAGTAAGCTGTGATCGTGG + Intergenic
1172727898 20:37060719-37060741 GCTGCAGTGAGCTGTGATTGCGG + Intronic
1173486017 20:43441728-43441750 CCTGCAGTGAGCTAGGATCGTGG - Intergenic
1174000622 20:47371838-47371860 GCTGCAGTAAGCTATGATCATGG + Intergenic
1174010746 20:47447620-47447642 GCTACAGTGAGCTGTGATCATGG + Intergenic
1174016665 20:47494257-47494279 GCTGCAGTGAGCCAAGATCGTGG - Intergenic
1174635198 20:51993499-51993521 GCTGCAGTGAGCTGTGATTGTGG + Intergenic
1175132730 20:56801691-56801713 GCTGCAGTGAGCCATGATTGTGG - Intergenic
1175362714 20:58426257-58426279 GCTACAGTGAGCTATGAGAGCGG - Intronic
1175653964 20:60752791-60752813 GCCACGGTGAGCTGTGGTCATGG - Intergenic
1176138018 20:63533519-63533541 GCCACACAGAGCCCTGATCGGGG + Intronic
1176364499 21:6024586-6024608 GCTTCAGTGAGCTATGACTGTGG - Intergenic
1176893837 21:14351844-14351866 ACTGCAGTGAGCTATGATCGTGG - Intergenic
1177595616 21:23238058-23238080 GTTACAATGAGCTATGATAGTGG + Intergenic
1178439880 21:32590176-32590198 GCCGCAGTGAGCTGAGATTGTGG + Intronic
1178740886 21:35200068-35200090 GCTGCAGTGAGCTATGATCGTGG - Intronic
1179223394 21:39429951-39429973 GTTGCAGTGAGCTGTGATCGCGG + Intronic
1179247045 21:39642988-39643010 GCTGCAGTGAGCCAAGATCGTGG + Intronic
1179759019 21:43513959-43513981 GCTTCAGTGAGCTATGACTGTGG + Intergenic
1180657281 22:17433505-17433527 GCTGCAGTGAGCAGTGATCGAGG - Intronic
1180881409 22:19206302-19206324 GCTGCAGTGAGCTGTGATCGGGG - Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181300933 22:21880632-21880654 GTTACAGTGAGCTATGATTGAGG + Intergenic
1181876516 22:25944783-25944805 GTCGCAGTGAGCTGAGATCGTGG + Intronic
1182540527 22:31038362-31038384 GCTACAGTAAGCTATGACTGAGG - Intergenic
1182657381 22:31901347-31901369 GCTTCAGTGAGCTATGACCATGG + Intronic
1183917150 22:41130465-41130487 GCTGTAGTGAGCTATGATTGTGG + Intronic
1184184491 22:42855977-42855999 GCTGCAGTGAGCTAGGATCAAGG + Intronic
1184191323 22:42896996-42897018 GCCACAGTGAGCCATGATTGTGG - Intronic
1185342159 22:50296348-50296370 GCTGCAGTGAACTATGATTGTGG + Intronic
1185358684 22:50391536-50391558 CCTGCAGTGAGCTATGATTGTGG + Intronic
949422093 3:3876779-3876801 GCTGCAGTGAGCTATGATCATGG + Intronic
949757903 3:7435223-7435245 GCCACAGTGAGCCGAGATCAAGG - Intronic
950207253 3:11090519-11090541 GCTGCAGTGAACTATGATCAGGG + Intergenic
951508190 3:23472708-23472730 GCTGCAGTGAGCTGTGATCACGG - Intronic
951596965 3:24329006-24329028 GCTGCAGTGAGCCATGATCATGG - Intronic
951876341 3:27430145-27430167 GCTGCAGTGAGCTATGATTGTGG + Intronic
951876342 3:27430169-27430191 ACTGCAGTGAGCTATGATTGTGG + Intronic
951895175 3:27603202-27603224 GCTGCAGTGAGCCATGATCATGG - Intergenic
952315924 3:32232185-32232207 GCTGCAGTGAGCCATGATTGTGG - Intergenic
953434371 3:42866933-42866955 GCTGCAGTGAGCCATGATTGTGG - Exonic
953618429 3:44512082-44512104 GCTGCAGTGAGCTATGATTGGGG + Intergenic
954022796 3:47757187-47757209 GCCGCAGTGAGCTATGATCAAGG + Intronic
954056178 3:48027774-48027796 GCTGCAGTGAGCCATGATTGCGG + Intronic
954222399 3:49162727-49162749 GGCACAGTGTGCTATGTCCGTGG - Exonic
954474287 3:50729258-50729280 GCTGCAGTGAGCTGTGATTGCGG + Intronic
954811449 3:53250841-53250863 GCTGCAGTGAGTTATGATCATGG - Intronic
956092685 3:65684761-65684783 GCTACAGTGAGCTGAGATCATGG - Intronic
956443493 3:69303254-69303276 GCTGCAGTGTGCTATGATCACGG + Intronic
958264587 3:91423092-91423114 GAGGCAGTGAGCTATGATCGTGG + Intergenic
959038474 3:101392920-101392942 GGTACAGTGAGCTATGATCATGG + Intronic
959043650 3:101447378-101447400 ACCACAGTGAGTTATGACCATGG + Intronic
959687904 3:109167642-109167664 GCTGCAGTGAGCTGTGATGGTGG + Intergenic
960169000 3:114436781-114436803 GCTGCAGTGAGCCATGATTGTGG + Intronic
960600807 3:119456666-119456688 ACTACAGTGAGCTAAGATTGTGG - Intronic
961253306 3:125524515-125524537 GCTGCAGTGAGCTATGTTCATGG - Intergenic
961748000 3:129078148-129078170 GCTGCAGTGAGCCATGATTGTGG - Intergenic
961811770 3:129526140-129526162 GCTACAGTGAGCTATGATTGTGG + Intergenic
961815165 3:129546260-129546282 GCTGCAGTGAGCCATGATTGTGG + Intronic
962127029 3:132631007-132631029 GTTTCAGTGAGCTATGATTGTGG + Intronic
962542321 3:136395048-136395070 GCCACAGTGAGCCGTGACAGTGG + Intronic
962598357 3:136970152-136970174 ACCGCAGTGAGCTGTGATTGAGG - Intronic
962798179 3:138866883-138866905 GCTACAGTGAGCTATGATGGTGG - Intergenic
962822510 3:139065221-139065243 GCCACAGTGAGCCATGATTATGG + Intronic
963150319 3:142039446-142039468 GCTGCAGTGAGCCATGATAGTGG - Intronic
963169528 3:142236824-142236846 GTTGCAGTGAGCTATGATCGTGG - Intergenic
964236410 3:154535641-154535663 GCTGCAGTGAGCTATGATCATGG + Intergenic
966416271 3:179693208-179693230 GCTGCAGGGAGCTATGATTGTGG - Intronic
966726123 3:183110453-183110475 CTCACAGTGAGCTGAGATCGCGG - Intronic
966797869 3:183732920-183732942 GCTGCAGTGAGCTATAATCATGG - Intronic
966955214 3:184869825-184869847 GCTACAGTGAGCTATGATTGCGG + Intronic
967481418 3:189977660-189977682 GCTGCAGTGAGCCATGATGGTGG - Intronic
968080539 3:195843452-195843474 GTTACAGTGAGCCAAGATCGCGG + Intergenic
968142638 3:196271486-196271508 GCTACAGTGTGCTATGATTATGG - Intronic
968142656 3:196271680-196271702 GCTACAGTGTGCTATGATTATGG - Intronic
968142674 3:196271875-196271897 GCTACAGTGTGCTATGATTATGG - Intronic
968142692 3:196272070-196272092 GCTACAGTGTGCTATGATTATGG - Intronic
968164078 3:196450457-196450479 GTCGCAGTGAGCTGAGATCGTGG - Intergenic
968204120 3:196783518-196783540 GTTACAGTGAGCCAAGATCGTGG + Intronic
968778205 4:2558441-2558463 GCTGCAGTGAGCTATGACGGCGG - Intronic
969356472 4:6629986-6630008 GCTGCAGTGAGCCATGATCATGG + Intergenic
969952026 4:10846888-10846910 GCTGCAGTGAGCTATGACGGTGG + Intergenic
970797363 4:19929256-19929278 GCTGCAGCGAGCTATGATCGTGG + Intergenic
971204047 4:24545047-24545069 GTTGCAGTGAGCTATGATCATGG + Intronic
971233031 4:24816147-24816169 GCTGCTGTGAGCTGTGATCGCGG - Intronic
972506149 4:39722027-39722049 GCTGCAGTGAGCCATGATCATGG - Intronic
972596086 4:40531035-40531057 GCTACAGTGAGCCATGATCGCGG + Intronic
972641703 4:40931338-40931360 GCCGCAGTGAGCCATAATCGAGG - Intronic
973559015 4:52115666-52115688 GCTGCAGTGAGCTAAGATCAAGG - Intergenic
973604789 4:52575695-52575717 GCTGCAGTGAGCTGTGATTGTGG + Intergenic
973764795 4:54153261-54153283 GCTACAGTGAGCTATGATCATGG - Intronic
974904462 4:68037823-68037845 GCTGCAGTGAGCCATGATCATGG + Intergenic
975346877 4:73301731-73301753 GCTGCAGTGCGCTATGATCGAGG + Intergenic
975502752 4:75104915-75104937 TCTGCAGTGAGCTATGATCATGG - Intergenic
975561621 4:75713725-75713747 GTCACAGTGAGCTATGAATGGGG + Intronic
975577965 4:75881506-75881528 GCTGCAGTGAGCCGTGATCGTGG + Intronic
975607255 4:76167741-76167763 GTCACAGTGAGCCAAGATGGTGG - Intronic
976182308 4:82410586-82410608 GCTGTAGTGAGCTGTGATCGTGG - Intergenic
976245748 4:83004549-83004571 GCTGCAGTGAGCCATGATCTTGG - Intronic
977253344 4:94712953-94712975 GCTACAGTGAGCTATGATTGGGG + Intergenic
977576774 4:98683282-98683304 GCTGCAGTGAGCTATGACCATGG + Intergenic
978381242 4:108131319-108131341 GCTGCAGTGAGCTATCATGGTGG + Intronic
978886396 4:113771637-113771659 GCTGCAGTGAGCCATGATTGTGG - Intergenic
978935194 4:114366013-114366035 GCCACAGTAAGATATGGTCAAGG + Intergenic
979249170 4:118545962-118545984 GTTACAGTGAGCCATGATCATGG + Intergenic
979275067 4:118806395-118806417 GCTGCAGTGAGCTATGATTGCGG - Intronic
979968000 4:127099205-127099227 GCTACAGTGAGCAGTGATTGCGG - Intergenic
980044678 4:127974431-127974453 GCTACAGTGAGCCAAGATCATGG - Intronic
980059288 4:128111639-128111661 GCTGTAGTGAGCTATGATCATGG + Intronic
980640897 4:135577614-135577636 GCTGCAATGAGCTATGATTGTGG + Intergenic
980968197 4:139544229-139544251 GCTGCAGTGAGCTGTGATCATGG + Intronic
981040807 4:140219670-140219692 GCTGCAGTGAGCTGTGATTGTGG + Intergenic
981712054 4:147719104-147719126 GTGACAGTGAGCTAAGATTGAGG + Intergenic
983458168 4:167991359-167991381 GCTACAGTGAGCCATGATCATGG - Intergenic
983506732 4:168561321-168561343 GCTACAGTGAGCTGTGATTGTGG - Intronic
983740708 4:171129230-171129252 GCCCAAGTGAGCTATTATGGTGG + Intergenic
984038733 4:174702627-174702649 GTTGCAGTGAGCTATGATCACGG - Intronic
984535495 4:180969793-180969815 GCTGCAGTGAGCTGTGATCTCGG - Intergenic
986873529 5:12079287-12079309 GTTGCAGTGAGCTAAGATCGTGG + Intergenic
987630008 5:20458177-20458199 GCTGCAGTGAGCTATGACTGTGG - Intronic
988503614 5:31803157-31803179 GCTGCAGTGAGCTATGACTGTGG - Intronic
988582259 5:32478409-32478431 GCTGCAATGAGCTATGATTGTGG + Intergenic
990571786 5:57086214-57086236 GCTACAGTGAGCCAAGATTGTGG - Intergenic
990583393 5:57186322-57186344 GCTGTAGTGAGCTATGATTGTGG + Intronic
991186928 5:63819348-63819370 GCTACAGTAAGCCATGATCGTGG + Intergenic
991370921 5:65918931-65918953 ACTACAGTGAGCTACGATCATGG + Intergenic
991719493 5:69482033-69482055 GTTGCAGTGAGCTATGATTGCGG + Intergenic
992515079 5:77483197-77483219 GCTGCAGTGAGCTGTGATCGGGG - Intronic
992792749 5:80228171-80228193 GCTACAGTGAGCTATGATTTCGG + Intronic
993720584 5:91317850-91317872 ACCACAGTGAGCCCAGATCGCGG - Intergenic
993956831 5:94244392-94244414 GCTACAGTGAGCTATGATCATGG - Intronic
995946839 5:117658118-117658140 GCTACAGTGAGTTATCATGGAGG + Intergenic
996740904 5:126798022-126798044 GTTACAGTCAGCCATGATCGTGG + Intronic
996794151 5:127325963-127325985 GCTACAGTGAGCTGTGATTGTGG - Intronic
997542783 5:134678081-134678103 GCTGCAGTGAGCTATGATCATGG - Intronic
998371866 5:141666968-141666990 GCTGCAGTGAGCCATGATCACGG - Intronic
999395535 5:151224566-151224588 GCTGCAGTGAACTATGATAGCGG - Intronic
999877197 5:155820633-155820655 GCGGCAGTGAGCTGTGATTGTGG + Intergenic
1000302728 5:159970864-159970886 GCTGCAGTGAACTATGATCGTGG - Intronic
1000389064 5:160704117-160704139 ACTGCAGTGAGCTATGATCATGG - Intronic
1001185538 5:169567935-169567957 GCTGCAGTGAGCTATGATTGTGG - Intergenic
1001187395 5:169587784-169587806 GCTTCAGTGAGTTATGATCATGG - Intronic
1001610573 5:172998046-172998068 GCTACAGTGAGCTGTCATTGCGG + Intronic
1002952375 6:1827003-1827025 GTTACAGTGAGCTATGATTGTGG + Intronic
1003077644 6:2997436-2997458 GCTGCAGTGAGCTGAGATCGTGG - Intronic
1003321913 6:5059277-5059299 GCCACAGTGAGCTATGACGGTGG + Intergenic
1003633375 6:7808850-7808872 GCTGCATTGAGCTATGATAGTGG + Intronic
1003665823 6:8110301-8110323 GCTGCAGTGAGCTATGGTTGTGG + Intergenic
1003822455 6:9914569-9914591 GCTGCAGTGAGCTATGATGGTGG - Intronic
1004016423 6:11736022-11736044 GCTGCAGTGAGCCAAGATCGTGG - Intronic
1004217956 6:13719825-13719847 GCTGCAGTGAGCCATGATTGTGG - Intergenic
1004454357 6:15777973-15777995 GCTGCAGTGAGCTGTGATCTTGG + Intergenic
1005319780 6:24641952-24641974 GCTGCAGTGAGCCAAGATCGTGG + Intronic
1005763121 6:28985949-28985971 GCCGCAATGAGCTCTGATCGTGG + Intergenic
1006465059 6:34188568-34188590 GCTGCAGTGAGCCGTGATCGTGG - Intergenic
1006647579 6:35525522-35525544 GCTGCAGTGAGCCATGATCATGG - Intergenic
1006830653 6:36966076-36966098 GCTGCAGTGAGCTATAATCCTGG - Intergenic
1006954619 6:37857003-37857025 GCTGCAGTGAGCTTTGATCACGG - Intronic
1007650661 6:43418644-43418666 GCTACGGTGAGCCATGATCATGG + Intergenic
1007819203 6:44548116-44548138 GCTGCACTGAGCTATGATCAAGG + Intergenic
1007884777 6:45214785-45214807 GCTGCAGTGAGCTATCATCATGG + Intronic
1008064933 6:47037567-47037589 GCTACAGTGAGCTATGATCATGG - Intronic
1008990859 6:57599882-57599904 GAGGCAGTGAGCTATGATCGTGG - Intronic
1009179379 6:60498116-60498138 GAGGCAGTGAGCTATGATCGTGG - Intergenic
1009430051 6:63556219-63556241 GCTGCAGTGAGCTGTGATTGTGG - Intronic
1010427048 6:75739327-75739349 GCCATAGTGAGCCATGATCATGG - Intergenic
1012023035 6:93950422-93950444 GCTGCAGTGAGCCATGATCGTGG - Intergenic
1012461832 6:99472277-99472299 GTTGCAGTGAGCTGTGATCGCGG - Intronic
1012506992 6:99958763-99958785 GGCACAGTGCCATATGATCGGGG + Intronic
1013290491 6:108715192-108715214 GCCACAGTGAACCATGATCACGG - Intergenic
1014006427 6:116424597-116424619 GCCACACTGTTCTATGATTGGGG + Intronic
1014371403 6:120613260-120613282 GCTGCAGTGAGCTAAGATTGTGG + Intergenic
1015115801 6:129648230-129648252 GCTGCAGTGAGCTATGATTGTGG - Intronic
1015545144 6:134354410-134354432 GTTACAGTGAGCTGAGATCGAGG - Intergenic
1016387947 6:143546973-143546995 GCTGCAGTGAGCTGTGATTGTGG + Intronic
1016637844 6:146315323-146315345 GCTACAGTGAGCTATGATTGTGG + Intronic
1017474449 6:154774321-154774343 GCCACAGTGAGCTATGATCGTGG - Intronic
1019097380 6:169593785-169593807 GTTACAGTGAGCTGAGATCGCGG + Intronic
1019437515 7:1029690-1029712 GACACACTGAGCTCTGGTCGCGG + Intronic
1019457716 7:1139133-1139155 GCTGCAGTGAGCTATGATCAAGG + Intergenic
1019719615 7:2560096-2560118 GCTACAGTGAACTGTGATCATGG + Intronic
1019814226 7:3187974-3187996 GCTGCAGTGAGCTATGATCGTGG - Intergenic
1020030766 7:4931205-4931227 GCTGCAGTGAGCTATGATAGTGG - Intronic
1020394711 7:7700986-7701008 GCTACAGTGAGCTATGATCACGG + Intronic
1021556702 7:21926809-21926831 GCTGCAGTGAGCTGTGATCAAGG + Intronic
1022070492 7:26908880-26908902 GTTACAGTGAGCTATGATCATGG + Intronic
1022175549 7:27868804-27868826 GCCACAGTGAGCTACTGTTGTGG - Intronic
1022734814 7:33065527-33065549 GCTGCAGTGAGCTATGATTATGG + Intergenic
1022735506 7:33072053-33072075 GCTGCAGTGAGCCATGATTGTGG - Intergenic
1022752135 7:33240317-33240339 ACTACAGTGAGCCATGATCATGG - Intronic
1023563119 7:41496365-41496387 GCTGCAGTGAGCTATAATCATGG - Intergenic
1025912744 7:65841021-65841043 GCCACAGTGAGGCATGAGCGTGG - Intergenic
1026328100 7:69328332-69328354 GTTACAGTGAGCTATGATCGTGG + Intergenic
1026365828 7:69647410-69647432 GCTACAGTGAGCAATGCTCATGG - Intronic
1026590604 7:71691971-71691993 GCTACAGTGAGCTCTGATTATGG - Intronic
1026905106 7:74058414-74058436 GCTGTAGTGAGCTATGATTGTGG - Intronic
1026953115 7:74360610-74360632 GCTGCAGTGAGCTGTGATTGTGG - Intronic
1027528933 7:79305857-79305879 GCTGCAGTGAGATATGATCATGG + Intronic
1029244569 7:99189681-99189703 GCTGTAGTGAGCTATGATCACGG - Intronic
1029450437 7:100638856-100638878 GCTGCAGTGAGCTATCATCTCGG + Intronic
1029603749 7:101585668-101585690 GCTGCAGTGAGCCATGATTGTGG + Intergenic
1029856090 7:103518392-103518414 GCTGCAGTAAGCTATGATTGTGG - Intronic
1030009330 7:105150452-105150474 GTCACAGTGAGCTGAGATCATGG + Intronic
1030118816 7:106086220-106086242 ACTGCAGTGAGCTATGATCTCGG - Intergenic
1030863432 7:114667365-114667387 GTTACAGTAAGCTATGATCATGG + Intronic
1031050973 7:116945018-116945040 GCTGCAATGAGCCATGATCGCGG + Intergenic
1032081639 7:128861721-128861743 GTTACAGTGAGCTATGATCACGG - Intergenic
1032819974 7:135515153-135515175 TCTGCAGTGAGCTGTGATCGTGG + Intergenic
1033334664 7:140442158-140442180 GCTGCAGTGAGCCATGATCGAGG + Intergenic
1034234959 7:149559484-149559506 GCTGCAGTGAGCTGTGATCATGG - Intergenic
1034482522 7:151333553-151333575 GCCGCAGTGAGCCATGCTCATGG + Intergenic
1034500223 7:151446062-151446084 GCTGCATTGAGCTATGATCGTGG - Intergenic
1034721605 7:153299237-153299259 GGCAAACTGAGCTATGATCCAGG + Intergenic
1035166906 7:156996131-156996153 GCTACAGTGAGCTATGATTGTGG - Intronic
1035584669 8:762738-762760 GCTGCAGTGAGCTGTGATTGTGG - Intergenic
1035625161 8:1066148-1066170 ACCACAGTCAGGTATGAGCGAGG + Intergenic
1036458944 8:8934833-8934855 GCTGCAGTGAGCTATGATCATGG + Intergenic
1036483531 8:9159327-9159349 GCCACAATGAGCTGTGGGCGTGG + Intronic
1038483863 8:27919969-27919991 GCCACAGTGGGCTTTGAGCAGGG + Intronic
1038754153 8:30325314-30325336 GCTGCCGTGAGCTATGATCATGG + Intergenic
1038755411 8:30336007-30336029 GCTGCAGTGAGCTACGATTGTGG + Intergenic
1038767276 8:30440853-30440875 GCTGCAGTGAGCTATGATCATGG - Intronic
1038928315 8:32165198-32165220 GCTGCAGTGAACTATGTTCGAGG - Intronic
1040035306 8:42864153-42864175 GCTGCAATGAGCTATGATCATGG - Intronic
1040552179 8:48446019-48446041 GCTGCAGTGAGCTATGATCCTGG - Intergenic
1040641980 8:49345740-49345762 GCTGCAGTGAGCCAAGATCGGGG + Intergenic
1040696667 8:50007679-50007701 GTCACAGTGAGCTAAGAGGGTGG + Intronic
1040857776 8:51967938-51967960 GCTGCAGTGAGCTGAGATCGTGG + Intergenic
1040947754 8:52901846-52901868 GCCACAGTGTGCTGTGATTGTGG - Intergenic
1042335830 8:67629417-67629439 GCTGCAGTGAGCTATGATCAAGG + Intronic
1042665920 8:71206281-71206303 GCTACAGTGAGCTGTGATGATGG - Intronic
1042986107 8:74584535-74584557 GCTGCAGTGAGCTATGATTGTGG + Intergenic
1043276043 8:78394240-78394262 GCTGCAGTGAGCTATGATTGGGG - Intergenic
1043482046 8:80663786-80663808 GCTGCAGTGAGCTGTGATCATGG - Intronic
1043779630 8:84314662-84314684 GCTACAGTGAGCTATGAGGCTGG + Intronic
1044075380 8:87815414-87815436 GCTGCAGTGAGCTGTGATCATGG + Intergenic
1044335104 8:90973542-90973564 GTTACAGTGACCTATGATCACGG - Intronic
1044545211 8:93451706-93451728 GCTGCAGTGAGCTAAGATGGTGG - Intergenic
1044604960 8:94040465-94040487 GCTGCAGTGAGCTATGATAATGG - Intergenic
1044823554 8:96175893-96175915 GCTGCAGTGAGCTATGATTGTGG - Intergenic
1045276568 8:100711410-100711432 GCTGCAGTGAGCTGTGATTGTGG + Intronic
1045399631 8:101800804-101800826 GCAGCAGTGAGCTATGGTTGTGG + Intronic
1045917021 8:107484461-107484483 GCTGCAGTGAGCTGGGATCGTGG - Intronic
1045972574 8:108095993-108096015 GTTGCAGTGAGCTATGATCAGGG + Intergenic
1047543750 8:125796249-125796271 GCCACAGTGAGTTCTCATAGGGG + Intergenic
1047981432 8:130187475-130187497 GCTACAGTGAGCTGTGATTGTGG - Intronic
1048546481 8:135392187-135392209 GCTGCAGTGAGCCATGATTGTGG - Intergenic
1049066839 8:140322772-140322794 GCTGCAGTGAGCTATGATTACGG + Intronic
1049168624 8:141143464-141143486 GATGCAGTGAGCTATGATAGCGG - Intronic
1049320388 8:141993122-141993144 GCCAGAGTGAGCCCTGATGGAGG - Intergenic
1049413366 8:142483818-142483840 GTCACAGTGAGCTCTGACCCTGG + Intronic
1049538457 8:143194131-143194153 GTGACAGTGAGCTATGATCATGG + Intergenic
1049817685 8:144615256-144615278 GCTACAGTGAGCTATGACTGTGG + Intergenic
1050561594 9:6840132-6840154 GCTGCAGTGAGCCATGATTGTGG - Intronic
1051361906 9:16288556-16288578 ACCACAGTGAACTGTGATGGTGG - Intergenic
1051771703 9:20586256-20586278 GCTGCAGTGAACCATGATCGTGG + Intronic
1052239849 9:26258629-26258651 GCTGCAGTGAGCTATGATGATGG - Intergenic
1052902555 9:33806118-33806140 GTTGCAGTGAGCTATGATGGTGG - Intergenic
1054795629 9:69298730-69298752 GCTGCTGTGAGCTATGATTGTGG + Intergenic
1055202166 9:73678297-73678319 GCTGCAGTGAGCTCTGATCATGG + Intergenic
1055302773 9:74899450-74899472 GCTGCAGTGAGCTATAATCATGG + Intergenic
1055323440 9:75104180-75104202 GCTGCAGTGAGCTGTGATTGTGG + Intronic
1056159764 9:83877013-83877035 GCTGCAGTGGGCTATGATCATGG + Intronic
1056984942 9:91354104-91354126 GCTGCAGTGAGCCAAGATCGTGG + Intronic
1057187321 9:93064108-93064130 GCCGCAGTGAGCCAAGATCACGG - Intronic
1057493401 9:95540684-95540706 GCTACAGTGAGCCATGATCATGG - Intergenic
1057633537 9:96740952-96740974 GATGCAGTGAGCTATGATGGCGG + Intergenic
1057711693 9:97451349-97451371 GCTGCAGTGAGTTATGATGGTGG - Intronic
1058138448 9:101333716-101333738 GCTACAGTAAGCCATGATCCTGG + Intergenic
1058940856 9:109811631-109811653 GCTGCAGTGAGCTATGATCATGG - Intronic
1059013524 9:110488810-110488832 GCTGCAGTGAGCTATGATTGTGG + Intronic
1059129315 9:111729175-111729197 GTTGCAGTGAGCTATGATTGTGG - Intronic
1059201092 9:112417413-112417435 GCTGCAGTGAGCTAGGATCATGG + Intronic
1059296527 9:113275780-113275802 GCCAGAGTGAGCTGGGATCCCGG - Intronic
1059382553 9:113938229-113938251 GCTGCAGTGAGCTATGATCATGG - Intronic
1060030767 9:120213079-120213101 GCCACAGAAAGATTTGATCGGGG + Intergenic
1060127667 9:121065550-121065572 GCTGCAGTGAGCTGTGATCAAGG - Intergenic
1060193396 9:121607363-121607385 GCTACAGTGAGCCATGATTGTGG - Intronic
1060522713 9:124302790-124302812 GCCCCAGTGAGATGTGATCACGG - Intronic
1060566610 9:124598273-124598295 GCTGCAGTGCGCTATGATTGTGG + Intronic
1060659134 9:125393096-125393118 GCTGCAGTGAGCTGTGATCATGG - Intergenic
1062345428 9:136112236-136112258 GCTGCAGTGAGCCGTGATCGTGG + Intergenic
1062644268 9:137538988-137539010 GCTGCAGTGAGCCAAGATCGTGG + Intronic
1185975529 X:4715370-4715392 GCTACAGTGAGCCATGATTGTGG - Intergenic
1186072303 X:5835501-5835523 GCTGCAGTGAGCTGTGATCATGG - Intergenic
1186090636 X:6044219-6044241 GCTGCAGTGAGCTATAATTGTGG + Intronic
1186268420 X:7858008-7858030 GCTGCAGTGAGCCATGATCTTGG - Intergenic
1186348674 X:8720862-8720884 GCTACAGTGAGATATGATCATGG + Intronic
1186427238 X:9472319-9472341 GCTGCAGTGAGCTATGATCAGGG - Intronic
1186764965 X:12761315-12761337 GCTGCAGGGAGCTATGATCATGG + Intergenic
1186827132 X:13351670-13351692 GCTGCAGTGAGCTATGATCGTGG - Intergenic
1186958501 X:14709170-14709192 GCTGCAGTGAGCTATGATCACGG + Intronic
1186959568 X:14721056-14721078 GCTGCAGTGAGCTGTGATCATGG + Intronic
1189102693 X:38207661-38207683 GCCTCAGAGAGCTATGAGCATGG + Intronic
1189311421 X:40020924-40020946 GCTGCAGTGAGCTGTGATTGTGG - Intergenic
1189516752 X:41720253-41720275 GCCACAAGCAGCTCTGATCGTGG - Intronic
1189671056 X:43409236-43409258 GATGCAGTGAGCTATGATCATGG - Intergenic
1190223741 X:48530014-48530036 GCTGCAGTGAGCCATGATCACGG + Intergenic
1190312493 X:49126633-49126655 GATACAGTGAGCTATGATCGTGG + Intergenic
1190709880 X:53059728-53059750 GCTGCAGTGAGCCATGATCATGG + Intronic
1193019067 X:76770200-76770222 GCTACAGTGAGCTGAGATTGAGG + Intergenic
1194267613 X:91775019-91775041 GCTGCGGTGAGCTATGATTGTGG - Intergenic
1194361297 X:92953682-92953704 GCTGCAGTGAGCTATAATCATGG + Intergenic
1195059242 X:101177816-101177838 GGCACAGTGAGCTGCGATGGTGG + Intergenic
1196081911 X:111641670-111641692 GCTGCAGTGAGCTATGACTGTGG - Intergenic
1196210723 X:112993089-112993111 GCTGCAGAGAGCTATGATCTTGG - Intergenic
1196681391 X:118473373-118473395 GCTGCAGTGAGCTATAATGGAGG - Intergenic
1197146100 X:123174332-123174354 GCTGCAGTGAACCATGATCGCGG - Intergenic
1197220878 X:123912571-123912593 GCTGCATTGAGCTATGATCATGG + Exonic
1198521730 X:137460085-137460107 GCTGCAGTGAGCTATGATTGTGG - Intergenic
1199456757 X:148037755-148037777 GCTACAGTGAGCCATGATCATGG + Intergenic
1199985035 X:152944384-152944406 TTCAGAGTGAGCTAGGATCGAGG + Intronic
1200584822 Y:4995954-4995976 GCTGCAGTGAGCTATAATTGTGG - Intergenic
1200669492 Y:6069528-6069550 GCTGCAGTGAGCTATAATCATGG + Intergenic
1201322034 Y:12709881-12709903 ACTGCAGTGAGCTATGATCGAGG + Intronic
1201767735 Y:17588301-17588323 GCTGCATTGAGCTATGATTGTGG + Intergenic
1201833818 Y:18317684-18317706 GCTGCATTGAGCTATGATTGTGG - Intergenic
1201902882 Y:19061446-19061468 GCTTCAGTGAGCTATGATCATGG + Intergenic
1202187722 Y:22205420-22205442 GTCACAGTGAGCCAAGATCCAGG - Intergenic
1202203638 Y:22380976-22380998 GTCACAGTGAGCCAAGATCCAGG + Intronic