ID: 1017479257

View in Genome Browser
Species Human (GRCh38)
Location 6:154833258-154833280
Sequence GGATCATTCTGTACTGGTAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017479257_1017479260 21 Left 1017479257 6:154833258-154833280 CCTATACCAGTACAGAATGATCC 0: 1
1: 0
2: 0
3: 8
4: 57
Right 1017479260 6:154833302-154833324 ATCTTCAAATGAAATAAACAAGG 0: 1
1: 1
2: 1
3: 70
4: 785

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017479257 Original CRISPR GGATCATTCTGTACTGGTAT AGG (reversed) Exonic