ID: 1017479257

View in Genome Browser
Species Human (GRCh38)
Location 6:154833258-154833280
Sequence GGATCATTCTGTACTGGTAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017479257_1017479260 21 Left 1017479257 6:154833258-154833280 CCTATACCAGTACAGAATGATCC 0: 1
1: 0
2: 0
3: 8
4: 57
Right 1017479260 6:154833302-154833324 ATCTTCAAATGAAATAAACAAGG 0: 1
1: 1
2: 1
3: 70
4: 785

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017479257 Original CRISPR GGATCATTCTGTACTGGTAT AGG (reversed) Exonic
902106563 1:14041460-14041482 GGAGCATTCTATACAGCTATTGG - Intergenic
907011089 1:50964042-50964064 GGAACATTCTGTACTGTCTTTGG - Intronic
912926264 1:113915810-113915832 GCATCATTCTGTTCAGGTATAGG - Intergenic
915204593 1:154260830-154260852 AGGTAATTCTGTATTGGTATTGG + Intronic
915408686 1:155683161-155683183 GGATCTTTTAGTACTGGTATAGG - Intronic
917694284 1:177505020-177505042 GGAGCATTCTATACTGATAAAGG + Intergenic
921053095 1:211524958-211524980 GGCTCATTCTGTTCTGGGAGGGG - Intergenic
923048892 1:230376404-230376426 GGATCATTCTGAGGTGGTGTTGG - Intronic
924093190 1:240523332-240523354 GGATCATTCTGTGCTGTAAGGGG + Intronic
1072734302 10:97868672-97868694 GGTTCATTCTGTTTTGGGATAGG + Exonic
1079743549 11:24096039-24096061 GGATAATGCTGTAATGGCATGGG + Intergenic
1082187398 11:49200947-49200969 GATTCATTCTGAACTTGTATCGG - Intronic
1083592804 11:63905132-63905154 GGGACACTCTGTACCGGTATTGG + Intronic
1085161166 11:74347206-74347228 GGATCTTTTTGTTCTGGTACTGG + Exonic
1086529417 11:87766468-87766490 GGAGCAGTCTGTACTGGTGCAGG - Intergenic
1086678937 11:89644475-89644497 GATTCATTCTGAACTTGTATCGG + Intergenic
1099766739 12:86997315-86997337 AGATCATTCTGTTTTGGGATGGG - Intergenic
1103991830 12:124804582-124804604 GCTTCATTCTTTGCTGGTATCGG - Intronic
1107658266 13:42613809-42613831 GAATCATAGTGTATTGGTATAGG + Intergenic
1111316556 13:86568981-86569003 TGATAATTCTGACCTGGTATAGG + Intergenic
1114940954 14:27609416-27609438 AGATCATTCTGTTTTGGTATGGG - Intergenic
1117265216 14:54079485-54079507 GGATGATGCTGTACAGGGATGGG - Intergenic
1118418521 14:65572714-65572736 GGGTCATTCTGTAGTGATAAAGG + Intronic
1119722893 14:76903198-76903220 GGCTGATTCTGTACTGGTTTTGG + Intergenic
1121323982 14:93009158-93009180 GGATAATTCTGCACTGCTAGGGG - Intronic
1125666833 15:41437540-41437562 GTATAATTGTGGACTGGTATTGG + Intronic
1133804359 16:9113065-9113087 AGATTTTTCTGTACTTGTATAGG + Intronic
1150186636 17:63188726-63188748 GGTTCTATCTGTACTGTTATGGG + Intronic
1152422449 17:80201363-80201385 GGATCATTCTGTGCTGCTGCGGG - Intronic
1155322743 18:24634307-24634329 TGATCATTTTGTCCTGGTTTGGG + Intergenic
1156297142 18:35803041-35803063 GGGTGATTCTATAATGGTATAGG + Intergenic
1163741619 19:19017447-19017469 GGATCATTCTGTATTAGGGTTGG - Intronic
933335794 2:80957073-80957095 TGATAATTCTGTAGTGGAATTGG + Intergenic
934984528 2:98874694-98874716 GGTTCCTTCTGTTCTGGTCTTGG + Intronic
944408621 2:199414377-199414399 GGATCTTGTTGTACTGGTACGGG + Intronic
948142581 2:235684876-235684898 GGATCATGCTGTACTGCTTACGG + Intronic
1176136114 20:63522688-63522710 GCATCATTCTGGCCTGGTATAGG + Intergenic
950946413 3:16952958-16952980 AAATCATTCTGTACTTTTATAGG - Intronic
952184249 3:30951617-30951639 CCATCATCCTGTACTGGTTTGGG + Intergenic
954601476 3:51874042-51874064 GGATCATTCAGTGCTGGTGGAGG - Exonic
957601513 3:82340977-82340999 GTAACATTCTGTACAGGGATGGG + Intergenic
961143545 3:124575358-124575380 GGAACATTCTGAACTGAGATGGG - Intronic
968663469 4:1808677-1808699 GGTTCGTTCTGTACTGTTACTGG + Exonic
970853426 4:20628505-20628527 GGATCATTCTGTTTTGGACTGGG + Intergenic
971955492 4:33412423-33412445 AGATCATTCTGTATTGGGCTGGG - Intergenic
974166467 4:58211316-58211338 TCATCATTCTGTACTGTAATTGG + Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
988389668 5:30611488-30611510 GGGTCATTCTGTAATGATAAGGG + Intergenic
995310143 5:110701296-110701318 GGATCCACCTGTACTTGTATTGG - Intronic
1005212998 6:23490756-23490778 GTTTCATTTTGTACTGGTTTTGG - Intergenic
1008145587 6:47888032-47888054 GACTCATTCTGTACTGGGATGGG - Intronic
1017275039 6:152556492-152556514 GGGTCATCCTGTACTGGAGTTGG - Intronic
1017479257 6:154833258-154833280 GGATCATTCTGTACTGGTATAGG - Exonic
1023597707 7:41849672-41849694 GGCTCATTTTGTACTGTTCTAGG + Intergenic
1024575817 7:50763419-50763441 GGATCACACTGTACAGGCATGGG + Intronic
1027688881 7:81316470-81316492 GGATCATGCTGTAAAGGTTTTGG + Intergenic
1031282632 7:119823204-119823226 TCACCATTCTGTAATGGTATTGG - Intergenic
1037531138 8:19775180-19775202 TGATCATTCTGTATATGTATAGG - Intergenic
1045985474 8:108245136-108245158 AGCCCATTCTGTATTGGTATGGG - Intronic
1046734123 8:117757815-117757837 AGATGATGCTGTAATGGTATGGG - Intergenic
1047610208 8:126513339-126513361 GGATGATTCTGCACAGGTAGGGG - Intergenic
1048155712 8:131948158-131948180 GGATAATTGTTTTCTGGTATAGG + Intronic
1056893132 9:90514751-90514773 AGATCATTTTGTGCTGGTTTGGG - Intergenic
1195546785 X:106121673-106121695 AGATCATTCTGTCTTGGGATGGG + Intergenic
1197472580 X:126881718-126881740 GGGGCATTCTGTACAGGTATTGG + Intergenic
1198436916 X:136626053-136626075 GGATCATTCTTTGCTGGAAGTGG - Intergenic