ID: 1017479260

View in Genome Browser
Species Human (GRCh38)
Location 6:154833302-154833324
Sequence ATCTTCAAATGAAATAAACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 1, 2: 1, 3: 70, 4: 785}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017479257_1017479260 21 Left 1017479257 6:154833258-154833280 CCTATACCAGTACAGAATGATCC 0: 1
1: 0
2: 0
3: 8
4: 57
Right 1017479260 6:154833302-154833324 ATCTTCAAATGAAATAAACAAGG 0: 1
1: 1
2: 1
3: 70
4: 785
1017479259_1017479260 0 Left 1017479259 6:154833279-154833301 CCTGAACTTTATGAAAAACTGAC 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1017479260 6:154833302-154833324 ATCTTCAAATGAAATAAACAAGG 0: 1
1: 1
2: 1
3: 70
4: 785
1017479258_1017479260 15 Left 1017479258 6:154833264-154833286 CCAGTACAGAATGATCCTGAACT 0: 1
1: 0
2: 2
3: 40
4: 662
Right 1017479260 6:154833302-154833324 ATCTTCAAATGAAATAAACAAGG 0: 1
1: 1
2: 1
3: 70
4: 785
1017479255_1017479260 27 Left 1017479255 6:154833252-154833274 CCACCACCTATACCAGTACAGAA 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1017479260 6:154833302-154833324 ATCTTCAAATGAAATAAACAAGG 0: 1
1: 1
2: 1
3: 70
4: 785
1017479256_1017479260 24 Left 1017479256 6:154833255-154833277 CCACCTATACCAGTACAGAATGA 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1017479260 6:154833302-154833324 ATCTTCAAATGAAATAAACAAGG 0: 1
1: 1
2: 1
3: 70
4: 785

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017479260 Original CRISPR ATCTTCAAATGAAATAAACA AGG Exonic