ID: 1017480291

View in Genome Browser
Species Human (GRCh38)
Location 6:154846825-154846847
Sequence CAATCATTAGGGTGGCACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017480291 Original CRISPR CAATCATTAGGGTGGCACGA GGG (reversed) Intronic
901387126 1:8917920-8917942 CAAACATTAGCCAGGCACGATGG + Intergenic
902264832 1:15255864-15255886 AAATCCTTACGGTGGCATGAAGG - Intronic
908272166 1:62432663-62432685 CAATCAAAATTGTGGCACGAAGG + Intergenic
912558260 1:110531684-110531706 CAGGCAATAGGGTGGCACAAAGG + Intergenic
1065435462 10:25700360-25700382 CAATAATTAGCTTGGCATGATGG - Intergenic
1065849479 10:29775298-29775320 CACTCATTAGAGTGTCATGATGG - Intergenic
1072638215 10:97191155-97191177 CAAACATTAGCTAGGCACGATGG - Intronic
1077173793 11:1179847-1179869 CAATTATCAGGGTGCCACGGAGG - Intronic
1077237432 11:1488463-1488485 CAATGGTGAGGGTGGCACGGGGG + Intronic
1084236920 11:67793762-67793784 CAAAAATTAGGCAGGCACGATGG + Intergenic
1087717927 11:101630901-101630923 CAATAATTAAGATGGCATGATGG - Intronic
1091089424 11:132756274-132756296 GAATCATTAGTGGGGCACCAAGG + Intronic
1100405449 12:94268745-94268767 CAAGCATTAGCCTGGCATGATGG - Intronic
1104024702 12:125017307-125017329 AAAACATTAGGGGGGCACGGTGG - Intronic
1110228879 13:73147703-73147725 CAAACATTAGCCAGGCACGATGG + Intergenic
1118369527 14:65125603-65125625 CTATCATGAGGGTAGCACCAAGG + Intergenic
1122672701 14:103384760-103384782 CAATAACGAGGGTGGCACAAAGG - Intergenic
1127344477 15:58080496-58080518 ACATCATTAGGGAGGAACGAGGG - Intronic
1129360806 15:75022791-75022813 CAAACATTAGTCTGGCATGATGG + Intergenic
1134233913 16:12450778-12450800 CAATCATTGTGGTGGCACTGGGG + Intronic
1135703125 16:24650510-24650532 CAAACATTAGCCTGGCACGGTGG + Intergenic
1136031523 16:27506729-27506751 CTCTCATTAGGATGGCACCAAGG + Intronic
1138193383 16:55034577-55034599 CAATCAGCAGGGTGCCAGGAAGG + Intergenic
1139014306 16:62671319-62671341 AAATCATTAGCCTGGCATGATGG + Intergenic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1141782524 16:86173174-86173196 CAATCATTAGCCAGGCATGATGG - Intergenic
1146028888 17:29347269-29347291 CAAAAATTAGGGGGGCACGGTGG - Intergenic
1160251724 18:77209421-77209443 CAAAAATTAGCCTGGCACGATGG - Intergenic
1162203048 19:9035087-9035109 CAATCATTAGCTGGGCATGATGG + Intergenic
1165202268 19:34154791-34154813 CAAAAATTAGCCTGGCACGATGG - Intergenic
1166426228 19:42680792-42680814 CAATCATTATGGCAGCACCAAGG - Intronic
928678073 2:33669962-33669984 CAAAAATTAGCGGGGCACGATGG - Intergenic
930143875 2:47981395-47981417 CAAACATTAGGTGGGCATGATGG - Intergenic
930164875 2:48195004-48195026 CACTCATTAGGGTGGCTCCCAGG + Intergenic
931068771 2:58620321-58620343 TAATTATTAGGGTGGGACGTGGG + Intergenic
939624329 2:144458353-144458375 CAGTCTTTAGGTTGGCACTAGGG + Intronic
941989585 2:171542015-171542037 CAAAAATTAGCCTGGCACGATGG - Intronic
945123804 2:206486582-206486604 CCATGATTAGAGTGGCACAATGG + Intronic
945264884 2:207881359-207881381 TAATCATTATGATGGCACCAAGG - Intronic
948506994 2:238435179-238435201 GAATCACTAAGGTGGCACGGGGG - Intronic
1177353216 21:19972095-19972117 CAATAATTAGTGGGGCATGATGG - Intergenic
1182001466 22:26923376-26923398 CAACCACTAGTGTGGCAAGAAGG - Intergenic
1183679770 22:39320992-39321014 CAAAAATTAGCGGGGCACGATGG + Intergenic
1184275783 22:43408912-43408934 CGATCATCAGGATGTCACGAAGG - Intergenic
958127896 3:89381380-89381402 CAATCATCAGCGTGGTATGATGG + Intronic
963615466 3:147531419-147531441 CAAAAATTAGCCTGGCACGATGG + Intergenic
968322009 3:197778010-197778032 CAATCATTAAGATGGCTGGAGGG - Intronic
978563037 4:110053650-110053672 CAAAAATTAGGCTGGCACGGTGG + Intronic
984678735 4:182581582-182581604 CAATAATTAGGCAGGCATGATGG + Intronic
992080557 5:73232113-73232135 AAATCATGGGGGTGGCAGGAAGG + Intergenic
992355444 5:75977727-75977749 CATCCATTAGGCAGGCACGAAGG - Intergenic
994967928 5:106698154-106698176 CAATCATGGGGTTGGCACAATGG + Intergenic
1000100043 5:158007547-158007569 CAATCATTTGGGTGGAAAAATGG - Intergenic
1012243617 6:96901456-96901478 TAATCATAAGGGTGTTACGATGG - Intergenic
1014173329 6:118303810-118303832 AAATCATAAGGGTGGGACCATGG - Intronic
1017480291 6:154846825-154846847 CAATCATTAGGGTGGCACGAGGG - Intronic
1017514030 6:155139785-155139807 CAATAATTAGCCTGGCATGATGG + Intronic
1017753444 6:157510090-157510112 CAAACATTAGTGGGGCATGATGG + Intronic
1020319950 7:6932249-6932271 CAAAAATTAGGCAGGCACGATGG + Intergenic
1022747054 7:33183161-33183183 CAATTCTTAGGGTTCCACGAGGG + Intronic
1024147258 7:46530341-46530363 CATTCACTAGGGTGGCACTTGGG - Intergenic
1026814415 7:73499178-73499200 CAAAAATTAGCCTGGCACGATGG - Intronic
1031250987 7:119380126-119380148 CAAAAATTAGCCTGGCACGATGG - Intergenic
1041208722 8:55524542-55524564 CAATCATTAGGGTGTCTTGATGG + Exonic
1050319638 9:4438248-4438270 GATTCATTGGGGTGGCATGAGGG - Intergenic
1053141288 9:35684436-35684458 CAAGGATTAGGGTGGCTTGAGGG + Intronic
1057523447 9:95778983-95779005 CAATCTTTGGGGTGGCACTGTGG + Intergenic
1187140735 X:16591204-16591226 CAATAGTTAAGGTGGCAGGAAGG - Intronic
1190058852 X:47198183-47198205 CATCCATCAGGGTGGCATGATGG - Intronic
1195160741 X:102168282-102168304 CAAAAATTAGCCTGGCACGATGG + Intergenic
1199023874 X:142914743-142914765 CACTGATTTAGGTGGCACGAGGG + Intergenic