ID: 1017481804

View in Genome Browser
Species Human (GRCh38)
Location 6:154864876-154864898
Sequence CTGCAGAAGAAGAATTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017481804 Original CRISPR CTGCAGAAGAAGAATTAGGC TGG (reversed) Intronic
900530195 1:3149281-3149303 CTGAAGAAGATGAAGCAGGCAGG + Intronic
900586415 1:3434557-3434579 CGGCCGAAGAAGTCTTAGGCAGG + Exonic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901246396 1:7735199-7735221 CTTCAGAAGAAGCAAGAGGCTGG + Intronic
902626290 1:17678264-17678286 CTGGAGAAGAAACACTAGGCTGG + Intronic
904465680 1:30705938-30705960 CAGGAGAATAAGAATTAGGGAGG - Intergenic
905680721 1:39869199-39869221 CTGAAGCAGGAGAATCAGGCAGG - Intronic
906550377 1:46661231-46661253 ATGCAAAAGAAAAATTAGCCAGG - Intronic
906700297 1:47852725-47852747 CTGCAGATGAAGAAATGGGGTGG + Intronic
907000032 1:50843239-50843261 ATGAAGAAAAAGAATTAGGTCGG - Intronic
907930912 1:58999182-58999204 TTGAAGATGAGGAATTAGGCTGG + Intergenic
910713803 1:90208689-90208711 CTTCAGTAGAAGAAAGAGGCTGG + Intergenic
910891808 1:92026784-92026806 CTGAGGCAGAAGAATCAGGCAGG + Intergenic
910898331 1:92092102-92092124 CTGTATAAGAAGACTTAGGGCGG + Intronic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
913192543 1:116425987-116426009 CTTCACAAGAAGGATCAGGCAGG - Intergenic
917304458 1:173612687-173612709 CTGAGGCAGAAGAATCAGGCAGG - Intronic
918073003 1:181147523-181147545 CTGCAGAGGAAGATTTTGGAAGG - Intergenic
919108776 1:193190564-193190586 CTGAAGGAGAAAAATAAGGCAGG - Intronic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG + Intergenic
920330557 1:205204307-205204329 CCGCAGAAGCAGAATTGGACTGG + Intronic
922319074 1:224469376-224469398 CTAAAGAAGAAAAATCAGGCTGG - Intronic
923490880 1:234483019-234483041 GTGAAGATGGAGAATTAGGCAGG - Intergenic
1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG + Intergenic
1064070884 10:12227155-12227177 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1066546655 10:36507466-36507488 TTGCAGAGGAAGAATGAGGTTGG - Intergenic
1067120221 10:43466087-43466109 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1069069023 10:63975197-63975219 CTGCAGAAGCAGTGATAGGCTGG - Intergenic
1069412482 10:68167917-68167939 CTGCAGGAGAAGAACTAGAGAGG + Intronic
1069732826 10:70630522-70630544 CTGCGGCAGGAGAATCAGGCAGG - Intergenic
1070135308 10:73689083-73689105 CTGAAGCAGGAGAATCAGGCAGG - Intronic
1070605585 10:77895997-77896019 CTTCAGAACAAAAATTAGCCAGG + Intronic
1070874249 10:79787461-79787483 CAGCTGAAGGAGAATTAGACTGG + Intergenic
1071641180 10:87309615-87309637 CGGCTGAAGGAGAATTAGACTGG + Intergenic
1072065635 10:91868439-91868461 CTGAAGAAGAAAAATAAAGCAGG + Intergenic
1072998781 10:100269968-100269990 ATGGATTAGAAGAATTAGGCGGG + Intergenic
1073066486 10:100762580-100762602 CTGCATAAGAAAAATTAGTAGGG + Intronic
1073308730 10:102524149-102524171 TTTAAAAAGAAGAATTAGGCAGG - Intronic
1074679988 10:115895790-115895812 GTGCAGAAGAGGAATCAGGGAGG + Intronic
1075449865 10:122543781-122543803 CTGCAGAAACAGGATTGGGCTGG - Intergenic
1077679865 11:4228860-4228882 CTACAGAAGAAGAATGATGCTGG + Intergenic
1077684174 11:4275403-4275425 CTACAGGAGAAGAATGATGCTGG + Intergenic
1077685869 11:4291362-4291384 CTACAGGAGAAGAATGATGCTGG - Intergenic
1077691018 11:4342522-4342544 CTACAGGAGAAGAATGATGCTGG - Intergenic
1078010479 11:7569639-7569661 CTGCAGAGGAAGCATCAGGGAGG + Intronic
1078802279 11:14659073-14659095 CTGCTGAAGAAGATTTTTGCTGG - Intronic
1081133259 11:39406321-39406343 TTGAAGCAGAAGAGTTAGGCAGG - Intergenic
1081225450 11:40516708-40516730 ATGCAGAAGAAAAATTGGGTTGG - Intronic
1083648724 11:64187842-64187864 ATACAGAAGAAAAATTAGCCGGG + Intronic
1084475377 11:69385771-69385793 ATGCAGAGGAAGATTAAGGCTGG - Intergenic
1088756759 11:112891364-112891386 TTACAGAAGAAGAAGCAGGCAGG + Intergenic
1089652009 11:119920613-119920635 CAGGAGAAGAGGAATTAGGGTGG + Intergenic
1090283050 11:125474332-125474354 CTCAAAAAGAAAAATTAGGCCGG - Intronic
1091339447 11:134799076-134799098 CTGCAGGAGAGGAAAGAGGCAGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091504325 12:1051555-1051577 GGGCAGAAGAAAAATTAGACAGG + Intronic
1092296190 12:7200789-7200811 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1092322314 12:7489227-7489249 ATGCAGAAGAAGAAATATGCTGG - Intronic
1092509519 12:9140212-9140234 CTGGAAAAGATTAATTAGGCAGG + Intergenic
1093194559 12:16114660-16114682 TTGCATCAGAAGAATGAGGCAGG - Intergenic
1094427850 12:30334463-30334485 ATAAAGAAGTAGAATTAGGCCGG + Intergenic
1095344398 12:41132630-41132652 TTGCAAAAGAAGAGTAAGGCAGG + Intergenic
1095884241 12:47172278-47172300 CTGAAGAAGATGATTTATGCTGG - Intronic
1096387077 12:51201378-51201400 CTCCAGAAAAAAAATCAGGCTGG + Intronic
1099055312 12:77833114-77833136 CTACAGAAAAAGAATTGGGAAGG - Intronic
1099801228 12:87459675-87459697 CTGATATAGAAGAATTAGGCAGG + Intergenic
1100854446 12:98746302-98746324 CTGCAGCAGAAAAATCAGGTGGG - Intronic
1101902461 12:108800685-108800707 CTGCAGATGCAGAAGTCGGCTGG - Intronic
1104144972 12:126024419-126024441 CTACAAAAGAAAAAGTAGGCCGG + Intergenic
1105340963 13:19525247-19525269 CTGCACAAAAAGAATGAAGCTGG + Intronic
1106233491 13:27841061-27841083 CTTTAGAGGAAGAATTGGGCAGG + Intergenic
1106691484 13:32122141-32122163 ATGCAGAAAAAGCATTAGACAGG + Intronic
1107483790 13:40807385-40807407 CCGAAGAAGAAGAAATAGCCTGG - Exonic
1107636572 13:42398288-42398310 TTGCAAAAGAAGTATTAGACTGG - Intergenic
1107745731 13:43506193-43506215 CTGCATAAGAAGAACAAAGCTGG - Intronic
1109239671 13:59870415-59870437 CTGAAGAAGAAGAACTAAGTTGG - Intronic
1109784496 13:67156284-67156306 CAGCAGAAGAAGATAGAGGCAGG + Intronic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1112504220 13:99965932-99965954 ATTAGGAAGAAGAATTAGGCTGG - Intronic
1113479146 13:110607185-110607207 CTGAGGCAGAAGAATCAGGCAGG + Intergenic
1113634626 13:111911097-111911119 CTACAGAGTAAGAATCAGGCCGG - Intergenic
1116399351 14:44486363-44486385 CTGCAGAGAAAGAAGCAGGCTGG - Intergenic
1116408978 14:44600912-44600934 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1120130033 14:80795742-80795764 CTTCAGAAGTAAAATTGGGCAGG + Intronic
1120505933 14:85353369-85353391 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1120707538 14:87760396-87760418 CTGCACAAGAAGCATGATGCTGG + Intergenic
1121500428 14:94431522-94431544 CTGCAGAGGAAGCATAATGCTGG - Intergenic
1121805855 14:96821822-96821844 CAGCTGAGGAAGAATTAGCCAGG - Intronic
1121837635 14:97106428-97106450 CTGCAGAAGAATCAACAGGCAGG - Intergenic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1125186876 15:36941033-36941055 CTGCAGAAGAAGAATGGAGGGGG - Intronic
1125559295 15:40614527-40614549 CTGAAGAAGAGGGAATAGGCTGG - Intronic
1127390140 15:58498728-58498750 CTGTGGAAGAAGCATTAGACTGG + Intronic
1127644531 15:60946364-60946386 CTGAGGCAGAAGAATCAGGCAGG - Intronic
1128172692 15:65526823-65526845 CTGGAAAAAAAAAATTAGGCTGG + Intergenic
1129978292 15:79842285-79842307 TTCCTGAAGAAGAATTAGGAAGG + Intronic
1131891961 15:96982799-96982821 CTGTAGGAGAAGAACCAGGCAGG + Intergenic
1132045166 15:98557592-98557614 CTGCAGAAGAATGATTAGGGTGG + Intergenic
1136078411 16:27833435-27833457 TTGAAAAAGAAGAATAAGGCAGG - Intronic
1137520388 16:49190198-49190220 CTGTGGATGAAGAGTTAGGCAGG - Intergenic
1137927478 16:52554317-52554339 CTGCAGAAGAAGTTTTAGACTGG - Intergenic
1139477615 16:67210504-67210526 TTGCAGAAGGAGAACTGGGCGGG + Exonic
1139598588 16:67972319-67972341 CTGAAAAAGAAAAATTAGCCAGG + Intergenic
1141200406 16:81893376-81893398 CTGCAGAAGATGAATTAACAAGG - Intronic
1141221105 16:82070042-82070064 GTGGAGAAGAAGGATTAGGTTGG - Intronic
1141298222 16:82789891-82789913 CTGCGGAGGAAGAATCAGGGTGG + Intronic
1141818377 16:86428495-86428517 ATGCAGAAAAAAAATTAGCCGGG - Intergenic
1141962792 16:87420765-87420787 CTGCAGTAGCAGAATTCTGCTGG - Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143568887 17:7741987-7742009 CTGCAGAGGAGGAATAGGGCCGG + Intronic
1145026936 17:19475455-19475477 CTGAGGAAGGAGAATCAGGCAGG - Intergenic
1146543774 17:33720266-33720288 CTCCAGAAGCAGAATTAAGAAGG + Intronic
1146672034 17:34745489-34745511 TTGCAAAAGAAGAATAAGGCTGG - Intergenic
1147762138 17:42805617-42805639 CTGAAGATGAAGGAATAGGCTGG + Intronic
1148405612 17:47411793-47411815 GTACAGATGAAAAATTAGGCTGG + Intronic
1149045846 17:52244475-52244497 CTGGAGGAGAGGAATTAGGACGG - Intergenic
1149719625 17:58830012-58830034 CTCTAGAAGAAAAATTAGCCAGG + Intronic
1150505055 17:65690531-65690553 GTGCAGAAGAAAAATAAAGCAGG + Intronic
1151309941 17:73286758-73286780 CTGCGGATGAAGAAACAGGCAGG - Intronic
1203172753 17_GL000205v2_random:165339-165361 CTGTAGGAGAAAAATTAGGCTGG - Intergenic
1153045711 18:854099-854121 CTCCAGAAGAAGAACTGGGATGG + Intergenic
1153973698 18:10248258-10248280 CTGAAGAAAAAGAAGTTGGCTGG + Intergenic
1158174553 18:54639765-54639787 CTGCAAAAGAAAGATTAGGAAGG + Intergenic
1160736718 19:666103-666125 CTACAAAAATAGAATTAGGCCGG + Intergenic
1161042747 19:2118692-2118714 CTGCAGCAGAAGGAGCAGGCCGG - Exonic
1162366068 19:10250453-10250475 CTACAAAAAAAAAATTAGGCCGG + Intergenic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1165070330 19:33251715-33251737 TTGCAGAGGAAGAATCCGGCTGG - Intergenic
1166401481 19:42483996-42484018 CTGCAGAAAATGAATTAGAGTGG - Intergenic
1167092067 19:47351347-47351369 CTGGAGAAAAAAAATTAGCCAGG - Intronic
1167148647 19:47696583-47696605 CTCCAGAAGCAGAGTTGGGCAGG + Intronic
1167618904 19:50550743-50550765 CTGCAGGAGAAAAATGAGCCCGG - Intronic
1168053277 19:53845904-53845926 CTTCAGAACAGGAACTAGGCGGG - Intergenic
927360936 2:22232430-22232452 CTACAAAAGAAAAATTAGCCAGG + Intergenic
931000756 2:57779496-57779518 CTGCAGAAGAACAGTAAGGATGG - Intergenic
931142447 2:59477814-59477836 ATGCAAAAAAAGAATTAGCCAGG - Intergenic
931522910 2:63119002-63119024 AAGCTGAAGAAGAATGAGGCTGG - Intergenic
932253944 2:70267688-70267710 CTGAAGCAGGAGAATCAGGCAGG + Intronic
932307207 2:70712622-70712644 ATGTGGAAGAAGAATTAGGCTGG + Intronic
933889154 2:86750158-86750180 GTGCTGAAGTGGAATTAGGCTGG + Intronic
935877871 2:107531612-107531634 CAGCAGAATAGGAATTAAGCTGG + Intergenic
938645759 2:133328467-133328489 AGGCAGAAGGAGAAGTAGGCTGG + Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
941024962 2:160448391-160448413 CTGAGGCAGGAGAATTAGGCAGG - Intronic
942448601 2:176094444-176094466 AAGCACAAGAAAAATTAGGCTGG - Intronic
942514914 2:176741899-176741921 CTGCTGAAAAAAAATTAGCCGGG - Intergenic
943005632 2:182385956-182385978 CTGAGGCAGAAGAATCAGGCAGG - Intronic
943737882 2:191377425-191377447 CTCCAGAAGAGGAAGTGGGCAGG - Intronic
944140059 2:196446359-196446381 CTGCAGGAGAAAAATAAAGCAGG - Intronic
944195593 2:197050029-197050051 CTGTACAAGAAGCATGAGGCTGG + Intronic
945109007 2:206344875-206344897 CTGTACAAGAAGAATGACGCTGG - Intergenic
945296863 2:208179371-208179393 CTGCAGTAAAAGAATAAGGGAGG + Intronic
1169077624 20:2771073-2771095 CTACAAAAGAAAAATTAGCCAGG + Intergenic
1170412205 20:16103978-16104000 CTGAAGAAGAATTCTTAGGCTGG - Intergenic
1170967631 20:21089565-21089587 CTGCACAGGAAGAATTGGGCTGG + Intergenic
1173324244 20:42018246-42018268 CTGCAGAACAAGAAGCATGCAGG - Intergenic
1173598668 20:44277362-44277384 GTGCAGGAGAAGATTGAGGCAGG + Intronic
1175527177 20:59643204-59643226 TTTTAAAAGAAGAATTAGGCCGG - Intronic
1176328747 21:5527122-5527144 CTGTAGAATAAAAATTAGGCTGG - Intergenic
1176375102 21:6083146-6083168 CTGCAGAAGAGGAGTTTGGTGGG + Intergenic
1176399010 21:6293829-6293851 CTGTAGAATAAAAATTAGGCTGG + Intergenic
1176438147 21:6695275-6695297 CTGTAGAATAAAAATTAGGCTGG - Intergenic
1176462409 21:7022345-7022367 CTGTAGAATAAAAATTAGGCTGG - Intergenic
1176485970 21:7404123-7404145 CTGTAGAATAAAAATTAGGCTGG - Intergenic
1177485613 21:21751508-21751530 ATGAAGGAGAAAAATTAGGCAGG + Intergenic
1178627573 21:34231079-34231101 ATGCAAAAGAAGAATTAAGTGGG - Intergenic
1179051962 21:37896020-37896042 CTGCACAGGAAGAATGATGCTGG + Intronic
1179748372 21:43455098-43455120 CTGCAGAAGAGGAGTTTGGTGGG - Intergenic
1179797299 21:43792664-43792686 CTACACAGGAAGAATTAGGAAGG + Exonic
1180847732 22:18993417-18993439 AAGCAGGAGAAGAATGAGGCTGG - Intergenic
1181967633 22:26668071-26668093 CCTCAGATGCAGAATTAGGCTGG + Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1183002899 22:34876440-34876462 CTACAGAAGAAGAAATAGAAGGG + Intergenic
1184100122 22:42337606-42337628 ATGCAGGAGAAGGATCAGGCAGG - Intronic
1184625005 22:45719793-45719815 CTCCAGAAGAAAAATAAAGCAGG - Intronic
1184732710 22:46379645-46379667 AAGCAGGAGAAGAATGAGGCTGG + Intronic
1203294194 22_KI270736v1_random:24918-24940 CTACAGAAAAAGAAATAGCCAGG - Intergenic
949196069 3:1309564-1309586 CTGAAGAAGAAGAATAAAGTTGG - Intronic
950051272 3:9991674-9991696 CTGCAAAAGGATAATCAGGCTGG - Intronic
950300082 3:11869252-11869274 CTGCAAAAGGATAATCAGGCTGG - Intergenic
951027890 3:17848832-17848854 CTTCAGAAGATGATTTGGGCTGG + Intronic
951800265 3:26588008-26588030 CAGCAGAAGAGAAATTAGGAAGG - Intergenic
952498882 3:33940732-33940754 AGGCAGAAGAAGAATTGTGCTGG + Intergenic
952799547 3:37275738-37275760 GTGCAGAAGAAGAACGCGGCTGG + Intronic
954481496 3:50804638-50804660 CTGAAGCAGGAGAATCAGGCAGG + Intronic
954632383 3:52054681-52054703 CTGCAGAAGAGGAATTAGCTGGG - Intronic
956011165 3:64833164-64833186 CTATAGAATGAGAATTAGGCAGG + Intergenic
956928913 3:74020492-74020514 CTACAGAAGAAGAAAAAGGGAGG + Intergenic
959198729 3:103219603-103219625 CTGCAGCAGAGAAATAAGGCAGG + Intergenic
961533949 3:127557848-127557870 CTACAGTAGAAAAATTAGCCAGG + Intergenic
961640967 3:128364647-128364669 CAGCAGTAGATGAATGAGGCTGG - Intronic
961672471 3:128543623-128543645 TTGCAGAAGAAAAATAAAGCAGG + Intergenic
962009046 3:131376036-131376058 CTGGAGAACAAGGATGAGGCAGG + Intergenic
962136531 3:132740393-132740415 TTGCAGAAGAAAAATTACCCAGG - Intergenic
962607352 3:137044031-137044053 CTGCAGAAGAAACATTTGGGAGG + Intergenic
962732139 3:138293243-138293265 CTAAAGAAGAATAACTAGGCTGG + Intronic
963056144 3:141188016-141188038 CTGCAGCAGAAGCATTACTCAGG - Intergenic
964092871 3:152896493-152896515 CTGAAGAAGAAGAGTAAGACAGG + Intergenic
964392619 3:156213376-156213398 CTACAAAAGAAAAATTAGCCAGG - Intronic
965218748 3:165899259-165899281 CTGCTGAAGAAGCTGTAGGCTGG + Intergenic
965471821 3:169102997-169103019 CTAGAGGGGAAGAATTAGGCAGG - Intronic
967898020 3:194416157-194416179 CTGCAGAAAAAGCATTAGATTGG + Intronic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968560107 4:1275485-1275507 TTGAAAAAGAAGAATAAGGCTGG + Intergenic
969386883 4:6857365-6857387 CTGCAGATGGAGCATGAGGCTGG - Intronic
972794868 4:42405347-42405369 ATCCAGAAGAAGAGTGAGGCTGG + Intergenic
975049616 4:69844043-69844065 CTGCTGAAGAAAACTTAAGCTGG + Intronic
975713950 4:77187907-77187929 CTGAAGAAGAAAAAATTGGCTGG + Intronic
976149277 4:82077214-82077236 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
976557967 4:86470972-86470994 TTGCTAACGAAGAATTAGGCTGG + Intronic
976921041 4:90443281-90443303 ATGCAGAAGAATAATGATGCTGG - Intronic
978234642 4:106443740-106443762 ATGTATAGGAAGAATTAGGCTGG - Intergenic
978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG + Intergenic
978955544 4:114608153-114608175 GTGCAGAAGAAAAAAAAGGCAGG - Intronic
979163862 4:117500260-117500282 CTGCAGAAGTATTATGAGGCAGG - Intergenic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
980876811 4:138670082-138670104 CTGAAGCAGAAGATTGAGGCAGG + Intergenic
982168245 4:152636048-152636070 CTCCAGAAGAAGGAAGAGGCTGG + Intronic
982628782 4:157804526-157804548 CAGCTGAAGAAGAATAAAGCTGG - Intergenic
982740017 4:159047699-159047721 CTGCAGAAAAGTAACTAGGCTGG + Intergenic
983099938 4:163612867-163612889 CTGCAGAAGAACAAATAAGAGGG - Intronic
986208364 5:5647319-5647341 GTTCAGTAGAAGGATTAGGCTGG - Intergenic
988535951 5:32068969-32068991 TTGCTTAAAAAGAATTAGGCCGG + Intronic
988614736 5:32764489-32764511 CTTCAAAAAAAGAATTTGGCCGG + Intronic
989204386 5:38796980-38797002 CTGCAGAACCAGAAGTAGGGTGG - Intergenic
991096943 5:62749734-62749756 GTGCTGAAAAAGAAGTAGGCAGG - Intergenic
991772070 5:70049819-70049841 CTGCGGAAGGAGAGTTGGGCCGG - Intronic
991851363 5:70925237-70925259 CTGCGGAAGGAGAGTTGGGCCGG - Intronic
992174126 5:74133124-74133146 TTGCAGAGGAAGAAAAAGGCAGG + Intergenic
993778756 5:92038704-92038726 ATGGAGGAGAAGATTTAGGCAGG + Intergenic
994005599 5:94833780-94833802 CTGCAGAAGAAAAATTGGGGTGG + Intronic
995276648 5:110285054-110285076 CTCCAGAAAAAGAATAAGGCAGG - Intergenic
996436972 5:123444934-123444956 CTGCAGAAGAAGAATTTACAAGG + Intergenic
998101481 5:139438915-139438937 CTGCAGAATCAGCATTAGGCGGG + Intronic
999409061 5:151334391-151334413 TTATAAAAGAAGAATTAGGCTGG + Intronic
1000361658 5:160453264-160453286 CTACAGAGGTAGAATTTGGCTGG - Intergenic
1001642139 5:173252112-173252134 CTGCAGAAGGAGAAACAAGCAGG - Intergenic
1001837673 5:174845531-174845553 CTACAGATGAGGAAATAGGCCGG + Intergenic
1003378167 6:5598220-5598242 CTGCAAAAAAAAAATTAGTCAGG + Intronic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004735181 6:18398688-18398710 CATCAGCAGAAGAATGAGGCTGG - Intronic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1008377756 6:50810668-50810690 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1011438531 6:87363985-87364007 GTGCAAAAAAAAAATTAGGCTGG + Intronic
1011908486 6:92404241-92404263 CTGCAGAAGAAGTTTGAAGCTGG - Intergenic
1013484508 6:110583884-110583906 CTGATGAAAAAGAATCAGGCTGG + Intergenic
1013651979 6:112204450-112204472 CAGTAGCAGATGAATTAGGCAGG - Intronic
1013789706 6:113822907-113822929 CTCCAAAAGAAGAATCAGGCTGG + Intergenic
1016154427 6:140786229-140786251 CTGAAGAGGAAGAATCAAGCTGG + Intergenic
1016875792 6:148863842-148863864 TTCCAGAAGAAGGATCAGGCAGG - Intronic
1017481804 6:154864876-154864898 CTGCAGAAGAAGAATTAGGCTGG - Intronic
1018528288 6:164736903-164736925 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1022013993 7:26333013-26333035 CTGAAAAAGAAGAATAAAGCAGG - Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1025186837 7:56867176-56867198 CTGCAAATAAAAAATTAGGCTGG + Intergenic
1025685085 7:63709740-63709762 CTGCAAATAAAAAATTAGGCTGG - Intergenic
1029532523 7:101134883-101134905 CTTTAGAAGAAGAACCAGGCCGG + Intronic
1029838108 7:103334462-103334484 CTGAGGCAGAAGAATGAGGCAGG + Intronic
1030072495 7:105710031-105710053 CTACAAAAGAAAAATTAGCCAGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030828280 7:114188282-114188304 ATGAAGAAGAAAAACTAGGCAGG - Intronic
1031879515 7:127180480-127180502 CTTCAGAAGATGAATTAAGGAGG - Intronic
1032653269 7:133901790-133901812 CTGCATTAAAAGAATCAGGCTGG - Intronic
1032919467 7:136528719-136528741 CTGCATAAGAAGCATGGGGCTGG + Intergenic
1033148106 7:138888668-138888690 GGGCAGATGAAAAATTAGGCAGG + Intronic
1033853612 7:145528507-145528529 ATACAGAAGAAGGAATAGGCAGG + Intergenic
1036096895 8:5734165-5734187 CTGCAGAAGCAGGCTTGGGCTGG - Intergenic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1038972894 8:32657357-32657379 CTGGAGAAGAAGGAATAGGTGGG - Intronic
1039968756 8:42303801-42303823 ATGCAGAAGAAAAATGGGGCTGG - Intronic
1040410517 8:47149692-47149714 ATACAGAAAAAGAATTAGCCGGG + Intergenic
1042522809 8:69732247-69732269 CTGCGGTAAAAGAATTAGGTTGG - Intronic
1042592948 8:70415524-70415546 TTGCAGAATATAAATTAGGCAGG + Intergenic
1042864486 8:73345358-73345380 CTGCAAAAAAAAACTTAGGCAGG - Intergenic
1043039627 8:75245285-75245307 TTGCAGGAGAAGAATAAGGTTGG - Intergenic
1043313558 8:78892717-78892739 GTGCAGAAGAAGGGTTAAGCAGG - Intergenic
1043381270 8:79704783-79704805 CTTCAGGAGAATAATTAGGCTGG - Intergenic
1045709386 8:104965189-104965211 CTGCAGAAGAAGGAGAAGGTGGG + Intronic
1046492863 8:114975792-114975814 CTGTACAAGAAGCATGAGGCTGG + Intergenic
1049812725 8:144582681-144582703 CTGCAGGAGGAGGATGAGGCGGG + Intronic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1051736414 9:20203726-20203748 CAGCAGAAGAAGAAATTAGCTGG + Intergenic
1052227063 9:26102672-26102694 CTACACAAGAGGTATTAGGCTGG + Intronic
1052757915 9:32559735-32559757 CTATAGAAGAAAAATTAAGCAGG - Intronic
1053752453 9:41269740-41269762 CAGCAGAGGAAGACTTGGGCAGG - Intergenic
1055618868 9:78102585-78102607 CTTTAGAAGAACAATTAGGGTGG - Intergenic
1056067673 9:82953800-82953822 CTCCAGAAGATGACTTAGGATGG - Intergenic
1056824951 9:89870584-89870606 CTGGAGAAAAGGAATCAGGCTGG - Intergenic
1057716329 9:97498792-97498814 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1058293139 9:103269727-103269749 CAGCAGAAGAAGCATGATGCTGG + Intergenic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059759067 9:117321216-117321238 ATGCAGTAGAAGAATCAGGCAGG + Intronic
1061774148 9:132949413-132949435 CTCAAGAAGGAGAATCAGGCTGG - Intronic
1203433362 Un_GL000195v1:113340-113362 CTGTAGGAGAAAAATTAGGCTGG + Intergenic
1187063622 X:15811720-15811742 CAACAAAAGGAGAATTAGGCCGG - Intronic
1188428242 X:30074538-30074560 CTGCTGAAGAAGAATATTGCTGG - Intergenic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1188925714 X:36040874-36040896 CTTTAGAAAAAGAATTAGGCCGG + Intronic
1189097891 X:38159445-38159467 CTGATGAAGAAAAATTGGGCTGG - Intronic
1190936821 X:55005223-55005245 ATGCATAAGAGGAATGAGGCAGG - Intronic
1191143504 X:57139797-57139819 CTGAAGAAAAAGAACTAAGCTGG - Intergenic
1192251994 X:69421491-69421513 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1192339051 X:70247178-70247200 CTACAGAAGAAAAATTAGCAAGG + Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193769310 X:85569953-85569975 TTGCATAAGAAGCATAAGGCTGG + Intergenic
1194113733 X:89871139-89871161 GAGAAGAAGAAAAATTAGGCAGG - Intergenic
1194458940 X:94141752-94141774 TTGCAAAAGAAGAATTAAGTTGG + Intergenic
1194747256 X:97641510-97641532 CTGCAGAAGATGAATCATGAGGG + Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196761137 X:119202079-119202101 CTGGAGAAGAAGCTTTAGGTTGG - Intergenic
1198201326 X:134422087-134422109 CTGCACAAAAAAAATTAGCCGGG - Intronic
1198607268 X:138355728-138355750 CTGCACAAGAAGCATGATGCTGG + Intergenic
1199028292 X:142965552-142965574 GTGCAGAAAATGAATTAGGAGGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200466411 Y:3526177-3526199 GAGAAGAAGAAAAATTAGGCAGG - Intergenic