ID: 1017489840

View in Genome Browser
Species Human (GRCh38)
Location 6:154935304-154935326
Sequence AAGCTGAGCGGACTATAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017489840 Original CRISPR AAGCTGAGCGGACTATAAAT GGG Intronic
907658787 1:56372450-56372472 ATGCTGGTGGGACTATAAATTGG - Intergenic
907755292 1:57305022-57305044 AAGCTGAGCTGAGTTTGAATAGG - Intronic
909839365 1:80299622-80299644 AAACTGAGAGGAAAATAAATAGG + Intergenic
910338433 1:86158190-86158212 AAGCTGAGGGAAGTATATATAGG - Intergenic
910548538 1:88449213-88449235 AAGCTGAGCTGACCCCAAATAGG - Intergenic
912057192 1:105617571-105617593 AAACTGAGTGAACTGTAAATAGG - Intergenic
912759588 1:112355246-112355268 AAACTGAGCTGTCTATAAAGAGG - Intergenic
915931763 1:160065100-160065122 ATGCTTAGAAGACTATAAATTGG + Intronic
917220157 1:172720122-172720144 AATCTGAGGGGAACATAAATTGG + Intergenic
921959094 1:221015435-221015457 AGGCTGAGCGGATTACAAGTCGG - Intergenic
924202785 1:241677211-241677233 AAGCTGAGAGGACTTTAAACAGG + Intronic
924737743 1:246773725-246773747 TGGCTGAGAGGAGTATAAATTGG - Intergenic
924799611 1:247318381-247318403 AAGCTGAGCAAACTCTAAACAGG + Intronic
1069503811 10:68978574-68978596 AAGCTGAGCAGAGTATACAAAGG - Intronic
1072423569 10:95310120-95310142 AAGCTGGGAGGACCATATATAGG + Intergenic
1079677829 11:23253408-23253430 AAGATGAGAGGAATATAAAGTGG - Intergenic
1082753101 11:57043925-57043947 CAGCTGATGGGACTATAAACTGG + Intergenic
1089717981 11:120382599-120382621 CCGCTGATCAGACTATAAATTGG - Intronic
1095864135 12:46952879-46952901 AAGCTGTACACACTATAAATGGG - Intergenic
1097486060 12:60202691-60202713 AAGCTGAGCAGAATATAGACAGG - Intergenic
1098302964 12:69072948-69072970 ATGCTGATGGGACTATATATTGG - Intergenic
1102374152 12:112408215-112408237 AAGATGTGGGGACTGTAAATTGG - Intronic
1105047602 12:133018180-133018202 AAGCTGAGAGAACCAGAAATAGG + Exonic
1107517910 13:41149700-41149722 AAGCTGAGAGATCAATAAATGGG + Intergenic
1109205126 13:59474597-59474619 GAGCTGAGCTGACAAGAAATGGG + Intergenic
1143023609 17:3928970-3928992 AAGCTGAGCGGACAAAGATTGGG - Intronic
1146507043 17:33414453-33414475 AAGCTGAGCAGGCTATCTATTGG + Intronic
1146533318 17:33628988-33629010 AAGCTGAGAGGACTTTGGATGGG - Intronic
1149063699 17:52455078-52455100 AAGCTTAGGGGACTTTAAATAGG + Intergenic
1165000388 19:32756886-32756908 AAGGTGAGGGGACTAAAAACTGG - Intronic
933188593 2:79306927-79306949 AAGCTGAGGAAACTATGAATGGG - Intronic
937618794 2:123960955-123960977 AAGCTCAGCTGTCTAAAAATGGG - Intergenic
938410603 2:131060821-131060843 AAGTTGAGCGGACAATACAGTGG - Intronic
939438921 2:142217852-142217874 AAGCTGAGAGGTCTTCAAATAGG - Intergenic
941332359 2:164194529-164194551 AAGCTGAATTGACTAAAAATGGG - Intergenic
1168873888 20:1156410-1156432 AAGCTCAGCAGACCCTAAATAGG + Intronic
1172000558 20:31772951-31772973 AAGCCGATGGCACTATAAATTGG - Intronic
1173399614 20:42712688-42712710 TAGCTGATAGGCCTATAAATTGG + Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
955889709 3:63636943-63636965 AAGCTGAGTGAACTCCAAATTGG + Intergenic
956080910 3:65555070-65555092 AAGCTGAGAGGAGAATAAATGGG + Intronic
957645693 3:82921879-82921901 AAGATGAGTTGGCTATAAATGGG + Intergenic
959427681 3:106212794-106212816 AAGTTGATTGGCCTATAAATTGG - Intergenic
964271657 3:154963031-154963053 ATGCTGAGGGGTCTAAAAATAGG + Intergenic
967718990 3:192795267-192795289 ATGCTGAGAGGGCTAGAAATGGG - Intergenic
978907559 4:114025791-114025813 AAGTTGAGCTGACAATAAAAAGG - Intergenic
986116713 5:4782467-4782489 AAGCTGAACGGACTGTAGAAGGG + Intergenic
986449648 5:7851308-7851330 AAGGTGAGCGGGCTGGAAATGGG - Exonic
987425828 5:17771775-17771797 AAGCTGAGGGAACCACAAATAGG - Intergenic
987473422 5:18360641-18360663 AAGTTGATGGGATTATAAATGGG + Intergenic
991205259 5:64042385-64042407 AAGCTGAGGGAAATATAAAGGGG + Intergenic
1005572501 6:27158757-27158779 AAACTGAACGGGCTAGAAATGGG - Intergenic
1007084000 6:39130000-39130022 AAGCTCAGAGGAGTAGAAATGGG + Intergenic
1012764220 6:103344406-103344428 AAGCAGAGTGAACTTTAAATAGG - Intergenic
1014233172 6:118927109-118927131 GAGATGAGGGGACTAGAAATGGG - Intronic
1014986706 6:128020250-128020272 AAGCTGAGCTGAACATTAATGGG + Intronic
1015730858 6:136346758-136346780 AAGATGAGGGGATTATAATTTGG + Intronic
1017385287 6:153875904-153875926 AAGCTGAGAAAACTATAAGTGGG - Intergenic
1017489840 6:154935304-154935326 AAGCTGAGCGGACTATAAATGGG + Intronic
1020654204 7:10910209-10910231 AAACAGAGAGGACTTTAAATGGG - Intergenic
1022085878 7:27067045-27067067 AATATGAGGGGACTATACATAGG + Intergenic
1031138711 7:117917294-117917316 AAGCTGAGAGGACTGAACATTGG + Intergenic
1032776463 7:135119169-135119191 AAGCTGAGCAGACCATTAATAGG + Intronic
1033506503 7:142007879-142007901 AAGCTGAGGTTACTATAATTAGG + Intronic
1043078858 8:75739148-75739170 AAGCTGAGAGGACTGAAAATTGG - Intergenic
1044409106 8:91865640-91865662 AAGCAGAGGGGACTATGCATGGG - Intergenic
1053181847 9:35979230-35979252 AAGCTGAGCAAACTCCAAATTGG - Intergenic
1053510512 9:38683969-38683991 AGGCTGAGAGGAGTAGAAATGGG - Intergenic
1057075533 9:92136380-92136402 GAGCTGAGCGGACTAGAACGGGG + Intergenic
1187645970 X:21347923-21347945 AAGCTAAGCATACTCTAAATAGG - Intergenic
1191920169 X:66247164-66247186 AAGCTCAGCTGACTAAAAGTAGG - Intronic
1194963654 X:100263836-100263858 TTGCTGGCCGGACTATAAATTGG - Intergenic
1195369029 X:104155283-104155305 AAACGGAGCTGACAATAAATTGG - Intronic
1195767238 X:108308705-108308727 ATGCTGATGGGAATATAAATTGG + Intronic
1200448585 Y:3296428-3296450 CAGCTGACCTGACTATGAATGGG + Intergenic