ID: 1017491041

View in Genome Browser
Species Human (GRCh38)
Location 6:154945322-154945344
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017491033_1017491041 7 Left 1017491033 6:154945292-154945314 CCTTTCTGTCTGGCACAACCACC 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1017491041 6:154945322-154945344 CCAGCCCCGGTCTACCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr