ID: 1017491138

View in Genome Browser
Species Human (GRCh38)
Location 6:154946208-154946230
Sequence GTGGGGAAGGGGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4818
Summary {0: 1, 1: 2, 2: 54, 3: 774, 4: 3987}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017491138_1017491145 -10 Left 1017491138 6:154946208-154946230 CCTTCCACCCTCCCCTTCCCCAC 0: 1
1: 2
2: 54
3: 774
4: 3987
Right 1017491145 6:154946221-154946243 CCTTCCCCACTCCCAGCCTCTGG 0: 2
1: 1
2: 18
3: 197
4: 1189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017491138 Original CRISPR GTGGGGAAGGGGAGGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr