ID: 1017494568

View in Genome Browser
Species Human (GRCh38)
Location 6:154972127-154972149
Sequence GCACCTTGCCTGGCTAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 381}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017494558_1017494568 16 Left 1017494558 6:154972088-154972110 CCACCTCAGCCTCCCAGAGGCTG 0: 1
1: 25
2: 327
3: 1856
4: 13264
Right 1017494568 6:154972127-154972149 GCACCTTGCCTGGCTAAATAAGG 0: 1
1: 0
2: 1
3: 28
4: 381
1017494557_1017494568 17 Left 1017494557 6:154972087-154972109 CCCACCTCAGCCTCCCAGAGGCT 0: 1
1: 23
2: 542
3: 7410
4: 61446
Right 1017494568 6:154972127-154972149 GCACCTTGCCTGGCTAAATAAGG 0: 1
1: 0
2: 1
3: 28
4: 381
1017494565_1017494568 3 Left 1017494565 6:154972101-154972123 CCAGAGGCTGGGATTACAGGCAC 0: 3
1: 53
2: 1494
3: 5566
4: 10770
Right 1017494568 6:154972127-154972149 GCACCTTGCCTGGCTAAATAAGG 0: 1
1: 0
2: 1
3: 28
4: 381
1017494561_1017494568 13 Left 1017494561 6:154972091-154972113 CCTCAGCCTCCCAGAGGCTGGGA 0: 3
1: 41
2: 766
3: 3272
4: 7444
Right 1017494568 6:154972127-154972149 GCACCTTGCCTGGCTAAATAAGG 0: 1
1: 0
2: 1
3: 28
4: 381
1017494564_1017494568 4 Left 1017494564 6:154972100-154972122 CCCAGAGGCTGGGATTACAGGCA 0: 29
1: 1556
2: 65275
3: 219322
4: 403051
Right 1017494568 6:154972127-154972149 GCACCTTGCCTGGCTAAATAAGG 0: 1
1: 0
2: 1
3: 28
4: 381
1017494562_1017494568 7 Left 1017494562 6:154972097-154972119 CCTCCCAGAGGCTGGGATTACAG 0: 6
1: 125
2: 1030
3: 5806
4: 14392
Right 1017494568 6:154972127-154972149 GCACCTTGCCTGGCTAAATAAGG 0: 1
1: 0
2: 1
3: 28
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017494568 Original CRISPR GCACCTTGCCTGGCTAAATA AGG Intronic
900197337 1:1383185-1383207 CCACCATGCCTGGCTAATTTTGG - Intergenic
901102954 1:6733519-6733541 CCACCGTGCCTGGCTAATTTTGG - Intergenic
901866171 1:12108363-12108385 CCACCGTGCCTGGCGACATACGG + Intronic
901869439 1:12128985-12129007 CCACCATGCCTGGCTAATTTTGG + Intronic
902751992 1:18522594-18522616 ACACCATGCCTGGCTAATTTTGG - Intergenic
902970508 1:20044777-20044799 GCACCCTGCCAGGCTGAATCAGG - Intronic
903609019 1:24596528-24596550 CCACCATGCCTGGCTAATTTTGG - Intronic
903626997 1:24738023-24738045 CCACCATGCCTGGCTAATTTTGG + Intergenic
904057029 1:27677836-27677858 CCACCATGCTTGGCTAATTATGG - Intergenic
904682222 1:32237246-32237268 CCACCATGCCTGGCTAATTTTGG + Intergenic
905230577 1:36512666-36512688 CCACCCTGCCTGGCTAATTTGGG - Intergenic
905332868 1:37219223-37219245 CCACCATGCCTGGCTAATTTTGG - Intergenic
906049430 1:42858194-42858216 GCTCCTTGCCAGGCTGAATTGGG + Intergenic
906095370 1:43219804-43219826 CCACCATGCCTGGCTAGAGATGG - Intronic
908151411 1:61306426-61306448 CCACCATGCCTGGCTAATTTTGG + Intronic
908286657 1:62611855-62611877 CCACCATGCCTGGCCAGATAAGG - Intronic
908548061 1:65181537-65181559 CCACCATGCCTGGCTAATTTTGG + Intronic
909360176 1:74750409-74750431 CCACCATGCCTGGCTAATTTTGG - Intronic
912282274 1:108328368-108328390 GCACCTTGCTAGTCAAAATAAGG - Intergenic
912572813 1:110637041-110637063 CCACCATGCCTGGCTAATTTGGG - Intergenic
913006383 1:114636510-114636532 CCACCATGCCTGGCTAATTTTGG - Intronic
915467455 1:156105829-156105851 CCACCGTGCCTGGCCAGATAAGG - Intronic
915491860 1:156254594-156254616 CCACCATGCCTGGCTAATTTTGG + Intronic
919876810 1:201875300-201875322 CCACCATGCCTGGCTATAAATGG - Intronic
921235005 1:213117733-213117755 CCACCATGCCTGGCCAAGTAAGG - Intronic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
922140880 1:222885118-222885140 GCACCTGGCCTGTCTAATGATGG + Intronic
922290625 1:224206355-224206377 CCACCATGCCTGGCTAATTCTGG + Intergenic
924320530 1:242843991-242844013 CCACCATGCCTGGCTAATTTTGG + Intergenic
924546715 1:245034446-245034468 CCACCATGCCTGGCTAATTTTGG - Intronic
924653748 1:245953704-245953726 CCACCGTGCCTGGCCAAGTAGGG + Intronic
1062988945 10:1796924-1796946 GCTTCTTGCCTGATTAAATAGGG + Intergenic
1064642281 10:17426947-17426969 CCACCATGCCTGGCTAATTTTGG - Intronic
1065188281 10:23189905-23189927 CCACCGTGCCCGGCTATATATGG - Intergenic
1066092204 10:32034262-32034284 GCACCATGCCAGGCTAATTTTGG + Intronic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067158972 10:43806871-43806893 GCACTTTGGGTGGCTAAAGAGGG - Intergenic
1069483023 10:68801032-68801054 CCACCATGCCTGGCTAATTTTGG - Intergenic
1070096830 10:73345650-73345672 CCACCATGCCTGGCTAATTTTGG - Intronic
1070506269 10:77115940-77115962 GAACCTTGCCAGGTTAAGTAGGG + Intronic
1073483487 10:103801854-103801876 CCACCATGCCTGGCTAATTTTGG + Intronic
1075006025 10:118830809-118830831 CCACAATGCCTGGCTAATTAAGG - Intergenic
1075356851 10:121786514-121786536 TCACCATGCCTGGCTAATTTTGG - Intronic
1075414652 10:122253416-122253438 ACACCTTGCCTGTCTAATCAAGG - Intronic
1076660412 10:132052070-132052092 CCACCATGCCTGGCTAATTGTGG - Intergenic
1077608456 11:3627985-3628007 CCACCGTGCCTGGCCAAATTTGG - Intergenic
1078511789 11:11989968-11989990 GCACAGCGCCTGACTAAATAAGG + Intronic
1078697244 11:13646796-13646818 CCACCTTGCCTGGCTGAAAAAGG + Intergenic
1080505271 11:32906549-32906571 CCACCATGCCTGGCTAAATTCGG + Intronic
1080591220 11:33724513-33724535 GCACAATGCCTGGCCAAAGATGG + Intronic
1080888463 11:36388015-36388037 GCACCTGCCCTGGCTAAAGGAGG - Intronic
1081057998 11:38434806-38434828 CCACCATGCCTGGCTAATTTTGG + Intergenic
1081883994 11:46479044-46479066 CCACCATGCCTGGCTAATTTTGG - Intronic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1083449158 11:62731039-62731061 CCACCATGCCTGGCTAATTTTGG + Intronic
1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG + Intergenic
1084073800 11:66756483-66756505 CCACCATGCCTGGCTAATTATGG + Exonic
1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085542369 11:77284006-77284028 CCACCATGCCTGGCTAATTTTGG + Intronic
1085559971 11:77462677-77462699 GCACCATGCCTGGCTAATTTTGG - Intronic
1087043462 11:93824058-93824080 CCACCATGCCTGGCTAATTTTGG + Intronic
1088680674 11:112239030-112239052 CCACCATGCCTGGCTAATTTTGG - Intronic
1088939859 11:114442290-114442312 GTCCCTTGGCTTGCTAAATAGGG + Intronic
1089420129 11:118325841-118325863 CCACCGTGCCTGGCCAGATATGG - Intergenic
1089430439 11:118419600-118419622 CCACCATGCCTGGCTAATTTTGG - Intronic
1089723083 11:120447663-120447685 CCACCATGCCTGGCTAATTTTGG - Intronic
1091751910 12:3027712-3027734 CCACCATGCCTGGCTAATTTTGG - Intronic
1092425483 12:8372166-8372188 CCACCATGCCTGGCTAATTTTGG + Intergenic
1092686831 12:11058081-11058103 CCACCTTGCCTGGCTAATTTTGG - Intronic
1092692553 12:11129996-11130018 ACACCATGCCTGGCTAATTTTGG - Intronic
1093191476 12:16079852-16079874 CCACCATGCCTGGCTAAATTTGG + Intergenic
1093474830 12:19543417-19543439 CCACCATGCCTGGCTAATTTTGG + Intronic
1095904253 12:47361173-47361195 GCACCTTGCCCCCATAAATATGG + Intergenic
1097034247 12:56112239-56112261 CCACCATGCCTGGCTCAAAATGG + Intronic
1098434396 12:70453324-70453346 CCACCGTGCCTGGCCAAATTAGG - Intergenic
1099058694 12:77878376-77878398 CCACCATGCCTGGCTAATTTTGG + Intronic
1099338950 12:81402699-81402721 CCACCCTGCCTGGCTAATTTTGG - Intronic
1099889921 12:88579044-88579066 GGACATTGCCTGGCTAAAAGAGG - Intronic
1100438234 12:94591601-94591623 CCACCATGCCTGGCTAATTTTGG - Intronic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1101693246 12:107100738-107100760 ACACTGTGCCTGGCTAAAAAGGG + Intergenic
1101703481 12:107197679-107197701 CCACCATGCCTAGCTAAATGAGG + Intergenic
1102362393 12:112299468-112299490 CCACCATGCCTGGCTAATTTTGG - Intronic
1103262995 12:119604918-119604940 ACACCATGCCTGGCTAAGTTAGG + Intronic
1103395237 12:120602016-120602038 CCACCACGCCTGGCCAAATAGGG + Intergenic
1103545389 12:121697607-121697629 GCACCATGCCCGGCTAATTTTGG + Intergenic
1105491769 13:20895023-20895045 CCACCATGCCTGGCTAATTTTGG - Intronic
1107463453 13:40627678-40627700 CCACCATGCCTGGCTAATTTTGG - Intronic
1108402177 13:50057046-50057068 CCACCATGCCTGGCGAAACATGG + Intergenic
1108554351 13:51578472-51578494 CCACCATGCCTGGCTAATTTTGG - Intergenic
1108597134 13:51959354-51959376 CCACCATGCCTGGCTAGATAGGG - Intronic
1109273542 13:60280100-60280122 ACACCATGCCTGGCTAATTTTGG - Intergenic
1109347145 13:61127359-61127381 CCACCATGCCTGGCCAAATCAGG + Intergenic
1109564603 13:64095678-64095700 CCACCATGCCTGGCTAATTTTGG - Intergenic
1109798554 13:67346020-67346042 GCACCTTGCTTGGCATATTAGGG + Intergenic
1112356749 13:98679851-98679873 CCACCATGCCTGGCTAATTTTGG - Intergenic
1115761175 14:36580458-36580480 GCCCCTTGACTGGCTAAGTGGGG - Intergenic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1119497362 14:75091546-75091568 GCACCTTTCCAGGGTAAGTAGGG - Intronic
1120501327 14:85300647-85300669 CCACCATGCCTGGCCAGATATGG - Intergenic
1120843320 14:89105819-89105841 TCATTTTGCCTCGCTAAATAAGG + Intergenic
1121349343 14:93161093-93161115 CCACCATGCCTGGCTAATTTTGG - Intergenic
1121540887 14:94725545-94725567 CCACCATGCCTGGCTAATTTTGG + Intergenic
1124925713 15:34068451-34068473 GCACTTTGCCAGGCCAAATCGGG - Intergenic
1125822378 15:42643347-42643369 CCACCATGCCTGGCTAATTTTGG + Intronic
1126165961 15:45653967-45653989 CCACCATGCCTGGCTAATTTTGG - Intronic
1128056659 15:64704553-64704575 GAACCTTGCCTGGTTGATTATGG - Intergenic
1128270453 15:66304746-66304768 CCACCATGCCTGGCTAATTTTGG - Intronic
1128707186 15:69845166-69845188 TCACCTTACCAGGCTAAGTAAGG - Intergenic
1128754856 15:70174906-70174928 CCACCATGCCTGGCTAATTTTGG + Intergenic
1129113817 15:73353810-73353832 GCACCCAGCCTGGCTCAAGAAGG - Intronic
1129928507 15:79387078-79387100 CCACCATGCCTGGCTAATTATGG + Intronic
1130285764 15:82553164-82553186 GCACCTTTCCTCTCAAAATAAGG - Intronic
1131240983 15:90743147-90743169 CCACCATGCCTGGCTAAAGATGG + Intronic
1132233756 15:100203744-100203766 CCACCATGCCTGGCTAATTTGGG - Intronic
1132753466 16:1470282-1470304 CCACCATGCCTGGCTCAAAATGG + Intronic
1133211726 16:4267012-4267034 CCACCAAGCCTGGCTAATTATGG + Intronic
1133408312 16:5545127-5545149 CCACCATGCCTGGCTAATTTTGG + Intergenic
1133558778 16:6930560-6930582 CCACCATGCCTGGCTAATTTTGG + Intronic
1133753716 16:8745542-8745564 CCACCATGCCTGGCTAATTTTGG - Intronic
1133870100 16:9677942-9677964 CCACCATGCCTGGCTAATTTTGG - Intergenic
1134391145 16:13821304-13821326 CCACCATGCCTGGCTAATTTTGG + Intergenic
1134414834 16:14034324-14034346 CCACCATGCCTGGCCAAAGATGG - Intergenic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135062079 16:19279603-19279625 CCACCATGCCTGGCTAATTTTGG + Intergenic
1135566373 16:23514257-23514279 CCACCATGCCTGGCTAATTTTGG + Intronic
1137266624 16:46874268-46874290 ACACCATGCCTGGCTAATTTTGG - Intergenic
1137841981 16:51649322-51649344 CCACCATGCCTGGCTAATTTTGG + Intergenic
1138061093 16:53891141-53891163 CCACCATGCCTGGCTAATTTTGG + Intronic
1138444789 16:57056809-57056831 CCACCATGCCTGGCTAATTTTGG + Intronic
1138698122 16:58834614-58834636 TCACCATGCCTGGCTAATTTTGG - Intergenic
1138727924 16:59161284-59161306 CCACCATGCCTGGCTAATTTTGG + Intergenic
1139828259 16:69774815-69774837 CCACCATGCCTGGCTAATTTTGG - Intronic
1140757212 16:78078505-78078527 GCACCATGCCTGGCTAATCCAGG - Intergenic
1141380545 16:83572562-83572584 GCACAGTGCCTGGCAACATATGG + Intronic
1142835913 17:2586597-2586619 GCACCGTGCCTGGCCAATGAGGG - Intergenic
1143222750 17:5276274-5276296 CCACCATGCCCGGCTAATTAAGG - Intergenic
1143836004 17:9693546-9693568 CCACCATGCCTGGCTGAATTTGG - Intronic
1144547043 17:16206671-16206693 TCACCATGCCTGGCAAATTATGG + Intronic
1144664753 17:17094761-17094783 CCACCATGCCTGGCTAATTTTGG + Intronic
1145020668 17:19428108-19428130 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145020772 17:19429065-19429087 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145350941 17:22082616-22082638 TCACCGTGCCTGGCAAATTATGG + Intergenic
1145979277 17:29002307-29002329 CTACCATGCCTGCCTAAATATGG - Intronic
1146975033 17:37103887-37103909 TCACCATGCCTGGCTAATTTTGG - Intronic
1147271899 17:39278990-39279012 CCACCATGCCTGGCTAATTTTGG - Intronic
1147682064 17:42255933-42255955 CCACCATGCCTGGCTAATTTTGG - Intronic
1147778410 17:42920703-42920725 CCACCATGCCTGGCTAATTTTGG + Intergenic
1147983369 17:44289015-44289037 CCACCATGCCCGGCTAAATTTGG + Intergenic
1148340997 17:46873332-46873354 GCACAGTGCCTGGCTCACTATGG - Intronic
1148925910 17:51085001-51085023 CCACCATGCCTGGCTAATTTTGG + Intronic
1149661844 17:58338219-58338241 GGAGCTGGCCTGGCCAAATAAGG + Intergenic
1149741923 17:59054951-59054973 CCACCACACCTGGCTAAATAGGG + Intronic
1149779413 17:59385423-59385445 CCACCATGCCTGGCTAATTTTGG - Intronic
1149930925 17:60754355-60754377 CCACCATACCTGGCTAATTACGG + Intronic
1150111587 17:62504994-62505016 CCACCATGCCTGGCTAATTTTGG + Intronic
1150688473 17:67341314-67341336 CCACCATGCCTGGCTAATTTTGG - Intronic
1151584533 17:75001079-75001101 CCACCATGCCTGGCTAATTTTGG - Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153060359 18:988817-988839 CCACCATGCCTGGCTAATTTTGG + Intergenic
1153198492 18:2626109-2626131 CCACCATGCCTGGCTAATTTGGG + Intergenic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1154308474 18:13248111-13248133 CCACCATGCCTGGCTAATTTTGG + Intronic
1155306014 18:24479068-24479090 CCACCATGCCTGGCTAATTTTGG + Exonic
1156261596 18:35449408-35449430 CCACCATGCCTGGCTAATTTTGG - Intronic
1157253428 18:46116406-46116428 CCACCATGCCTGGCTAATTTTGG - Intronic
1157996087 18:52557810-52557832 CCACCATGCCTGGCTAATTTTGG + Intronic
1158128371 18:54126541-54126563 GCACCTGGCCTAGCTACATCAGG + Intergenic
1158625926 18:59071656-59071678 CCACCATGCCTGGCTAATTTTGG + Intergenic
1160205313 18:76826644-76826666 CCACCATGCCTGGCTAACTTTGG - Intronic
1161157683 19:2741502-2741524 CCACCATGCCTGGCTAATTTTGG - Intergenic
1161160674 19:2760363-2760385 CCACCATGCCTGGCTAATTTTGG - Intronic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1162360765 19:10218901-10218923 CCAACTTGCCTGGCTATTTATGG - Intronic
1163268890 19:16237578-16237600 CCACCATGCCTGGCTAATTTTGG - Intronic
1163848645 19:19651337-19651359 GCAGCTTGCCGGGCCAAAGAGGG + Intronic
1163869834 19:19811310-19811332 TCACCATGCCTGGCTAATTTTGG + Intronic
1163983190 19:20921126-20921148 CCACCGTGCCTGGCCTAATATGG - Intergenic
1164774929 19:30845414-30845436 GCAGCTTCCCTGGCTCAGTAAGG - Intergenic
1166021692 19:40037065-40037087 CCACCGTGCCTGGCTAATTTTGG + Intronic
1166537949 19:43587175-43587197 CCACCATGCCTGGCTAATTTTGG - Exonic
1167360285 19:49026444-49026466 GCACCAGGCCTGGCTAATTTTGG - Intronic
1167365210 19:49051197-49051219 GCACCAGGCCTGGCTAATTTTGG - Intergenic
1168527143 19:57098278-57098300 ACAAATTGCCTGGTTAAATATGG + Intergenic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
926209111 2:10856012-10856034 GTCCCTTGCCTGGCTGACTAAGG + Intergenic
926261995 2:11272715-11272737 TCACCGTGCCTGGCTAATTTTGG - Intronic
929236519 2:39610824-39610846 CCACCATGCCTGGCTAATTTTGG + Intergenic
930116317 2:47721464-47721486 CCACCATGCCTGGCTAATTATGG + Intronic
930180419 2:48350405-48350427 GCACATTGCCTTGTTAAATATGG + Intronic
930333944 2:50022001-50022023 CCACCATGCCTGGCTAATTTTGG + Intronic
931469350 2:62522038-62522060 CCACCGTGCCTGGCTGGATATGG + Intergenic
932138822 2:69256773-69256795 CCACCATGCCTGGCTAGAGATGG - Intergenic
932156298 2:69421049-69421071 CCACCTCACCTGGCTAAATTCGG - Intronic
933714045 2:85347379-85347401 GCACCGTGCCTGGCTAATTTTGG + Intronic
935235476 2:101134884-101134906 CCACCGTGCCCGGCCAAATATGG - Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
935762468 2:106334152-106334174 CCACCATGTCTGGCTAATTAAGG + Intergenic
937598506 2:123699550-123699572 CCACCGTGCCTGGCCAAATGTGG - Intergenic
938800333 2:134757174-134757196 TCACCATGCCTGGCTAATTTTGG - Intergenic
938870971 2:135475923-135475945 TCACCATGCCTGGCTAATTTTGG - Intronic
939181255 2:138804745-138804767 CCACCATGCCTGGCTAATTTTGG - Intergenic
939251058 2:139682119-139682141 CCACCATGCCTGGCCACATAGGG - Intergenic
939918565 2:148079702-148079724 CCACCATGCCTGGCTAATTTTGG - Intronic
940785244 2:157974084-157974106 CCACCATGCCTGGCTAATTTTGG + Intronic
941175509 2:162193084-162193106 GCACAGTGCCTGGCTTAATGTGG + Intronic
942605349 2:177684732-177684754 GCAGATTGCCTGGCAAAATTAGG + Intronic
944082961 2:195810562-195810584 CCACCATGCCTGGCTAATTTTGG + Intronic
946270771 2:218591588-218591610 CCACCATGCCTGGCTAATTTTGG - Intronic
947016981 2:225631968-225631990 CCACCATGCCTGGCTAATTTTGG + Intronic
947557012 2:231101966-231101988 CCACCATGCCTGGCTAATTTTGG + Intronic
947852925 2:233303100-233303122 CCACCATGCCTGGCTGAAGAAGG + Intergenic
1169246189 20:4027078-4027100 CCACCATGCCTGGCTAATTTTGG + Intergenic
1169438732 20:5616220-5616242 TCACCATGCCTGGCTAATTTGGG + Intergenic
1169919701 20:10721698-10721720 GCTCTTGGCCTGGCTAAACATGG - Intergenic
1171561193 20:26127572-26127594 TCACCGTGCCTGGCAAATTATGG + Intergenic
1171814693 20:29775320-29775342 CCACCATGCCTGGCTAATTTTGG + Intergenic
1171945675 20:31375300-31375322 CCACCATGCCTGGCTAATTTTGG + Intergenic
1173520482 20:43696391-43696413 CCACCATGCCTGGCTAATTGGGG + Intronic
1174347454 20:49940892-49940914 CCACCATGCCTGGCTAATTTTGG + Intronic
1175412011 20:58776619-58776641 GCACCTTGCCTGGACGAATGGGG - Intergenic
1175525574 20:59631193-59631215 GGACCTTGCCTTGATAATTATGG - Intronic
1176423042 21:6531701-6531723 CCACCTTTCCTGGCTAATTTGGG - Intergenic
1176718816 21:10377223-10377245 CCACCATGCCTGGCTAATTTTGG + Intergenic
1177014241 21:15764285-15764307 TCACCTTGCCAGGGTAAATTTGG + Intronic
1177221929 21:18205887-18205909 CCACCATGCCTGGCTAATTTAGG + Intronic
1177446035 21:21197280-21197302 GCACCACGCCTGGCTAACTTTGG + Intronic
1178361822 21:31954933-31954955 CCACCATGCCTGGCTAATTTTGG + Intronic
1179698536 21:43140017-43140039 CCACCTTTCCTGGCTAATTTGGG - Intergenic
1179814142 21:43892940-43892962 TCACCATGCCTGGCTAATTTTGG - Intronic
1180203871 21:46244855-46244877 GCACCTGGCCTGGCTGAAGCAGG - Exonic
1180217803 21:46337147-46337169 CCACCATGCCTGGCTAATTGGGG + Intronic
1184191882 22:42900372-42900394 GTACCCTGCCTGGCCAAGTATGG - Intronic
1184752465 22:46495661-46495683 CCACCATGCCTGGCTAAACAGGG - Intronic
949765572 3:7522200-7522222 GGACCTTGCCTTTCTAAATCTGG + Intronic
950056956 3:10032591-10032613 CCACCTTGCCTGGCCAGAAATGG + Intronic
951927062 3:27919821-27919843 CCACCATGCCTGGCTAATTTTGG - Intergenic
953398993 3:42596172-42596194 GCACCATGCCTGGCTAATTTTGG + Intronic
953423323 3:42772117-42772139 CCACCATGCCTGGCTAATTTTGG - Intronic
953591889 3:44265402-44265424 CCACCACGCCTGGCTAATTATGG - Intronic
954212735 3:49107408-49107430 CCACCATGCCTGGCCAAAGAAGG + Intergenic
954337410 3:49927746-49927768 CCACCATACCTGGCTAATTAAGG - Intronic
955327225 3:58018485-58018507 CCACCTTGCCTGGCTAGTTTTGG + Intronic
960122332 3:113959507-113959529 GCACCTTACCTGGTGAAACATGG - Intronic
960386864 3:117030943-117030965 GCAACTTGCCTGCTTAAGTAAGG + Intronic
960453258 3:117837230-117837252 CCACCATGCCTGGCTCAATCAGG - Intergenic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960780076 3:121310754-121310776 CCACCATGCCTGGCTAATTTTGG - Intronic
961739394 3:129023479-129023501 CCACCATGCCTGGCTAATTTTGG + Intronic
963705881 3:148687714-148687736 GCACCATGCCTGGCCTACTATGG + Intergenic
964124728 3:153224251-153224273 CCACCATGCCTGGCTAATTTTGG + Intergenic
964558652 3:157968468-157968490 CCACCATGCCTGGCTAAGTTTGG - Intergenic
964750131 3:160046822-160046844 CCACCATGCCTGGCCAAGTAGGG + Intergenic
967837524 3:193977381-193977403 GCATTTTGCCAGGCTGAATATGG + Intergenic
969148957 4:5151986-5152008 GCACTATGTCTGGCTGAATATGG - Intronic
969420622 4:7092833-7092855 CCACCATGCCTGGCTAATTTTGG + Intergenic
971045487 4:22801116-22801138 CCACCATGCCTGGCTAATTTTGG + Intergenic
971344106 4:25796639-25796661 CCACCATGCCTGGCTAATTTTGG - Intronic
972044784 4:34652137-34652159 CCACCGTGCCTGGCCAAATTTGG + Intergenic
972284249 4:37633119-37633141 CCACCGTGCCTGGCCAAACATGG - Intronic
972413166 4:38813208-38813230 TCACCATGCCTGGCTAATTTTGG - Intronic
972589320 4:40469584-40469606 TCACCATGCCTGGCTAATTTTGG + Intronic
973556208 4:52085754-52085776 CCACCATGCCTGGCTAATTTGGG - Intronic
976258365 4:83122246-83122268 CCACCATGCCTGGCTAATTTTGG + Intronic
976902968 4:90202353-90202375 TCACCATGCCTGGCTAACTTTGG + Intronic
979231714 4:118354174-118354196 CCACCTCGCCCGGCTAAAGATGG - Intergenic
980714281 4:136611577-136611599 GCTCCTTGCCAGGCTGAATAGGG + Intergenic
981286715 4:143026448-143026470 GTAACTTGCCTGGCTACACATGG - Intergenic
981327070 4:143461965-143461987 CCACTGTGCCTGGCTAAATTTGG - Intronic
982272750 4:153607958-153607980 CCACCATGCCTGGCTACATTTGG - Intronic
982543408 4:156704642-156704664 CCACCATGCCTGGCTAATTTGGG - Intergenic
984114436 4:175662305-175662327 GAGCCTGGCCTAGCTAAATATGG - Intronic
984585771 4:181562825-181562847 TCACCATGCCTGGCTAATTTTGG + Intergenic
984588966 4:181595276-181595298 TCACCATGCCTGGCTAATTTTGG - Intergenic
985241653 4:187937143-187937165 CCACCTTGCCTGGCCTAAAATGG + Intergenic
985510713 5:311970-311992 CCACCATGCCTGGCCAACTATGG + Intronic
986723492 5:10577280-10577302 CCACCATGCCTGGCTAATTTTGG + Intronic
988443590 5:31259766-31259788 GCACCTTGCCTGGCTCTTGATGG - Intronic
988462321 5:31451047-31451069 CCACCATGCCTGGCTAATTTTGG - Intronic
988598363 5:32616356-32616378 CCACCATGCCTGGCTAATTTTGG + Intergenic
989309461 5:39997719-39997741 CCACCATGCCTGGCTAATTTTGG - Intergenic
989342677 5:40393618-40393640 GCCCCTAGCCTGGCTGAACAGGG - Intergenic
990246996 5:53873170-53873192 CCACCATGCCTGGCTAATTTTGG + Intergenic
990471789 5:56122504-56122526 CCACCATGCCTGGCTAATTTTGG - Intronic
990570303 5:57071764-57071786 CCACCATGCCTGGCTAATTTTGG + Intergenic
991953572 5:71970489-71970511 CCACCATGCCTGGCTAATTTTGG + Intergenic
992042946 5:72855146-72855168 CCACCATGCCTGGCTAATTTGGG + Intronic
992055763 5:72987623-72987645 CCACCGTGCCTGGCTGATTAGGG + Intronic
992294526 5:75314442-75314464 CCACTGTGCCTGGCCAAATAAGG - Intergenic
992882827 5:81127634-81127656 CCACTGTGCCTGGCCAAATAAGG - Intronic
993651526 5:90528891-90528913 GCACCTTGCTTAGTTAAAGAAGG - Intronic
993948938 5:94149902-94149924 CCACCATGCCTGGCTAATTTTGG + Intergenic
994145144 5:96386675-96386697 CCACCATGCCTGGCAAAGTATGG - Intergenic
995972052 5:117984359-117984381 CCACCATGCCTGGCCATATATGG + Intergenic
997157144 5:131573145-131573167 GCACCTTGCCAGGCTGAATCAGG + Intronic
997608800 5:135195893-135195915 CCACCGTGCCTGGCTAATTTTGG + Intronic
998248583 5:140532943-140532965 CCACCATGCCTGGCTAAATTCGG - Intronic
998469031 5:142368964-142368986 CCACCATGCCTGGCTAATTTTGG + Intergenic
999894883 5:156021345-156021367 TCACCATGCTTGGCTAATTAAGG - Intronic
1001090466 5:168736548-168736570 GCAGCTTGCCTTGCTAGAGAAGG + Intronic
1001706129 5:173742196-173742218 GCACCACACCTGGCTAATTAAGG - Intergenic
1001995104 5:176151133-176151155 CCACCATGCCTGGCTAATTTGGG + Intergenic
1002351073 5:178584160-178584182 TCACCATGCCTGGCTAAATTTGG + Intronic
1003637866 6:7850293-7850315 CCACCATGCCTGGCTAATTTTGG + Intronic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004396887 6:15253348-15253370 CCACCGTGCCTGGCCAAATAAGG + Intronic
1004729670 6:18345535-18345557 TCACCATGCCTGGCTAATTTTGG + Intergenic
1006080928 6:31566023-31566045 CCACCGTGCCTGGCTAATTTTGG - Intergenic
1006726203 6:36200799-36200821 GGACCTTGCCTGGCTGGACATGG + Exonic
1007516040 6:42412151-42412173 CCACCATGCCTGGCTAATTTTGG + Intronic
1007536489 6:42595456-42595478 CCACCTTGCCTGGCTGAGGAAGG - Intronic
1008901994 6:56630933-56630955 CCACCATGCCTGGCTAACTTTGG + Intronic
1009460399 6:63905615-63905637 CCACCGCGCCTGGCCAAATAAGG + Intronic
1009481937 6:64169947-64169969 ACCCCTTGCTTGGATAAATAGGG + Intronic
1011778180 6:90755863-90755885 CCACCATGCCTGGCTAATTTTGG + Intergenic
1012722274 6:102759657-102759679 CCACCTTGCCTGGCTAGTTTTGG + Intergenic
1013338051 6:109185504-109185526 GTACCTTGCCTACCTACATAAGG + Intergenic
1013496564 6:110703591-110703613 GCACTTTACCAGGCCAAATAAGG + Intronic
1015990916 6:138942029-138942051 TCACCATGCCTGGCTAATTTTGG + Intronic
1016470837 6:144372645-144372667 CCACCATGCCTGGCTAATTTTGG + Intronic
1017193051 6:151673593-151673615 CCACCATGCCTGGCTTAATTTGG - Intronic
1017494568 6:154972127-154972149 GCACCTTGCCTGGCTAAATAAGG + Intronic
1017509587 6:155102147-155102169 CCACCATGCCTGGCTAATTTTGG + Intronic
1017581776 6:155872705-155872727 CCACCGTGCCTGGCTAATTTTGG + Intergenic
1018193062 6:161327833-161327855 CCACCATGCCTGGCTAACTTTGG + Intergenic
1018755005 6:166841373-166841395 GCACTTTGCCTGGCTCAGCATGG - Intronic
1018861303 6:167712581-167712603 GCACCTGGCCTGGCAGAATCAGG - Intergenic
1018961489 6:168452397-168452419 GGGCCTGGACTGGCTAAATAGGG + Intronic
1019766884 7:2857986-2858008 TCACCATGCCTGGCTAATTTGGG - Intergenic
1019874686 7:3799410-3799432 GCACCTGGCCAGGATAAACAGGG - Intronic
1020062928 7:5166157-5166179 CCACCATGCCTGGCTAATTTTGG + Intergenic
1020283116 7:6661040-6661062 CCACCATGCCTGGCTAATTTTGG - Intergenic
1020398011 7:7739511-7739533 GCACCTTTGCTGTCTAAAAATGG + Intronic
1020696235 7:11417314-11417336 ACACCTTGCTTTGCTAAATATGG + Intronic
1021721741 7:23511082-23511104 CCACCGCGCCTGGCCAAATAAGG - Intronic
1022165989 7:27762797-27762819 CCACCATGCCTGGCTAATTTTGG - Intronic
1023816800 7:43956885-43956907 GCACCATGCCCGGCTAAACAAGG - Intergenic
1023927450 7:44680057-44680079 CCACCATGCCTGGCTAATTTTGG - Intronic
1024083387 7:45874070-45874092 CCACCATGCCTGGCTAATTTTGG + Intergenic
1025100071 7:56127081-56127103 CCACCATGCCTGGCTAATTTTGG - Intergenic
1025929779 7:65984196-65984218 CCACCATGCCCAGCTAAATATGG - Intergenic
1026781135 7:73268262-73268284 CCACCATGCCTGGCTAACTTTGG + Intergenic
1027003177 7:74668857-74668879 CCACCGTGCCTGGCTAAGAAGGG + Intronic
1027021988 7:74821704-74821726 CCACCATGCCTGGCTAACTTTGG + Intronic
1027066033 7:75124213-75124235 CCACCATGCCTGGCTAACTTTGG - Intronic
1027174293 7:75893493-75893515 CCACCATGCCTGGCTAATTTAGG + Intergenic
1027775218 7:82456444-82456466 GCACCATGCCTGGCTAATTTTGG + Intergenic
1029177430 7:98674916-98674938 GCACCTGGGCTGGTTAAACAAGG - Intergenic
1029472664 7:100764340-100764362 CCACCATGCCTGGCTAATTTTGG - Intronic
1029865035 7:103618963-103618985 CCACCATGCCTGGCTAATTTTGG - Intronic
1030308502 7:108044798-108044820 CCACCATGCCTGGCTAATTTTGG - Intronic
1032040793 7:128558902-128558924 CCACCATGCCTGGCTAATTTTGG + Intergenic
1032783796 7:135185020-135185042 CCACCATGCCTGGCTAATTTTGG + Exonic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1033128858 7:138728377-138728399 TCACCATGCCTGGCTAATTTTGG + Intronic
1033434360 7:141319688-141319710 CCACCATGCCTGGCTAATTTTGG + Intronic
1033469374 7:141630968-141630990 GCACCATGCTTGGCTGAGTAGGG + Intronic
1033816569 7:145081674-145081696 GCCCCATGCCTGGCTAATTTTGG + Intergenic
1033920551 7:146386539-146386561 CCACCATGCCTGGCTAATTTTGG + Intronic
1034122996 7:148644316-148644338 GCCACTTGCCTGGCTAGATTTGG - Intergenic
1036951495 8:13144012-13144034 GCAACTTGACTGGGTAAAAAGGG + Intronic
1037728714 8:21505771-21505793 CCACCATGCCTGGCTAATTTTGG - Intergenic
1038714249 8:29977603-29977625 CCACCATGCCTGGCTAATTTTGG - Intergenic
1038827634 8:31022121-31022143 CCACCATGCCTGGCTAATTTTGG + Intronic
1039043695 8:33431257-33431279 CCACCGTGCCTGGCCAACTAGGG - Intronic
1040025772 8:42780751-42780773 CCACCATGCCTGGCTAATTTTGG + Intronic
1040881406 8:52208864-52208886 GGACCTTGCCTGTCTAAGCATGG + Intronic
1043596855 8:81897554-81897576 CCACCATGCCTGGCTAATTTTGG - Intergenic
1043677100 8:82970614-82970636 GCACCATGCCTGGATAATTTTGG - Intergenic
1044112313 8:88290263-88290285 CCACCGTGCCTGGCCCAATAAGG - Intronic
1044679995 8:94767577-94767599 CCACCTTGCCTGGCTCAACGAGG + Intronic
1045031989 8:98145751-98145773 CCACCATGCCTGGCTAATTTTGG - Intronic
1045082226 8:98639398-98639420 GCACCATGCCTGGTCCAATATGG + Intronic
1045624664 8:104029442-104029464 CCAGCTTTCCTGGCTCAATATGG + Intronic
1046537909 8:115539703-115539725 CCACCATGCCTGGCTAATTTTGG - Intronic
1046560203 8:115827000-115827022 CCACCATGCCTGGCTAATTTGGG + Intergenic
1048854272 8:138673360-138673382 CCACCATGCCTGGCTAACTTTGG + Intronic
1048969351 8:139635979-139636001 TCACCTTAACAGGCTAAATAGGG + Intronic
1049009748 8:139879444-139879466 ACACCGTGGCTGGCTAACTAAGG + Intronic
1050318947 9:4431555-4431577 GCACCATGCCTGGCCCTATATGG - Intergenic
1050958357 9:11693872-11693894 CCACCATGCCTGGCTAATTTTGG + Intergenic
1051640447 9:19220039-19220061 CCACCATGCCTGGCTAATTTTGG - Intergenic
1052660333 9:31420590-31420612 CCACCATGCCTGGCTAATTTTGG - Intergenic
1053051947 9:34969352-34969374 CCACCGTGCCTGGCGAAAGAGGG - Intronic
1053326125 9:37153321-37153343 CCACCATGCCTGGCTAATTTTGG + Intronic
1053507021 9:38651807-38651829 GCCCCTAGCCTGGCTACATAAGG + Intergenic
1055652562 9:78420914-78420936 TCACCATGCCTGGCTAATTTTGG + Intergenic
1055710064 9:79050951-79050973 CCACCATGCCTGGCTAATTTTGG + Intergenic
1057089131 9:92240414-92240436 CCACCATGCCTGGCTAATTTTGG + Intronic
1060190029 9:121586665-121586687 CCACCTTGCCTGGCTAATTTTGG - Intronic
1060269974 9:122133333-122133355 GCACCTTTCCTGCCTGGATAAGG - Intergenic
1060856511 9:126917996-126918018 GCACCTTGCCTGGCCATAGTAGG + Intronic
1061346078 9:130026339-130026361 CCACCCTGCCTGGCTAATTTTGG - Intronic
1186830941 X:13389734-13389756 GCACCTAGCCTGGGTGATTAAGG - Intergenic
1188076018 X:25776045-25776067 CCACCGTGCCTGGCTCATTAAGG - Intergenic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189541564 X:41996668-41996690 CCACCATGCCTGGCTAATTTTGG + Intergenic
1189827414 X:44933728-44933750 CCACCATGCCTGGCTAATTCTGG + Intronic
1191967154 X:66771679-66771701 GCACCATGCCTGGCTAATTTTGG + Intergenic
1192764741 X:74129219-74129241 GCTCCTTGCCAGGCTGAATCAGG - Intergenic
1192963497 X:76153450-76153472 TCACATTGCCTGTCTAAAAATGG + Intergenic
1193472039 X:81917981-81918003 ACACCATGCCTGGCTAATTTGGG - Intergenic
1194454361 X:94083604-94083626 ACACCATGCCTGGCTAATTTTGG + Intergenic
1194671991 X:96745157-96745179 CCACCATGCCTGGCTAATTTTGG + Intronic
1195311381 X:103634742-103634764 GCAACTTGCCTGGCCAACTCCGG + Intergenic
1196742287 X:119035833-119035855 CCACCATGCCTGGCTAATTTTGG - Intergenic
1196895961 X:120335851-120335873 TCACCGTGCCTGGCTAGATGTGG + Intergenic
1198617926 X:138479103-138479125 CCACCATGCCTGGCTAATTTTGG + Intergenic
1199965060 X:152812836-152812858 TCACCACGCCTGGCTAAAGAAGG - Intergenic
1200284921 X:154811388-154811410 CCACCGTGCCTGACTAAAGATGG - Intronic