ID: 1017497637

View in Genome Browser
Species Human (GRCh38)
Location 6:154995561-154995583
Sequence CCGCGCGCCGCCCCGCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 1, 2: 6, 3: 95, 4: 565}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017497637_1017497642 7 Left 1017497637 6:154995561-154995583 CCTGCGGGCGGGGCGGCGCGCGG 0: 1
1: 1
2: 6
3: 95
4: 565
Right 1017497642 6:154995591-154995613 TCCCCTCCCTTCCCCTTTGTTGG 0: 1
1: 0
2: 6
3: 42
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017497637 Original CRISPR CCGCGCGCCGCCCCGCCCGC AGG (reversed) Intronic
900227683 1:1540568-1540590 CCGCGCTCCGCTCCGCCCTCGGG + Intergenic
900344479 1:2204586-2204608 CCGCCCGCCGCCGAGCCCCCGGG + Intronic
900349265 1:2227258-2227280 GCCGGCCCCGCCCCGCCCGCCGG - Intergenic
900476102 1:2877075-2877097 CCGGGCGCCGCTCCACCGGCTGG + Intergenic
900607727 1:3531257-3531279 CCTCGCCCCCTCCCGCCCGCCGG - Intronic
900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG + Intronic
900648149 1:3718208-3718230 CCCCGCCCCGCCCCGCCCCGGGG - Intronic
901063755 1:6485459-6485481 CCGCGGTCTGCGCCGCCCGCCGG + Intronic
901540196 1:9910404-9910426 CCGGGCCCCGCCCCGCCCGCAGG - Intergenic
901540210 1:9910449-9910471 CACCGCGCAGCCCCGCCCACAGG - Intergenic
901660706 1:10796304-10796326 CAACGCGCCGCCCCGCGCCCGGG + Intronic
901875868 1:12166934-12166956 CCCCGCCCCGCCCCGCCGCCTGG + Intergenic
902304154 1:15524418-15524440 CTGCGCCTCGCCCCGCCCCCAGG + Intronic
902304370 1:15525154-15525176 CCGCGACTCGCCCCGCCCCCAGG + Intronic
902350013 1:15847586-15847608 CCGCGCGCCTGCGCGCCGGCTGG + Intergenic
902535967 1:17119488-17119510 GGGCGGGCCGCCCCGCCCACCGG - Intergenic
902783174 1:18717223-18717245 CCGCGCGCCTGGCCGCCCCCCGG + Intronic
902870739 1:19312277-19312299 CCGCGCGCCACCGCCCCCGCGGG - Intergenic
903184755 1:21622649-21622671 CCGCGGGCCGGGCCGCCCGGGGG - Intronic
903263387 1:22142999-22143021 GCGCGCCCCGGCCCGCCCGCGGG - Intronic
903349741 1:22710688-22710710 CCGCGCGCCGCCGCGAGCCCGGG - Intergenic
903438318 1:23368945-23368967 CCCCGCGCCGCCCCGCGCCGGGG + Intronic
903649578 1:24914544-24914566 CCGCTCGCCTCCCTGCCCGCTGG - Intronic
904006632 1:27366475-27366497 CCGCGCGCAGCCCCGGCCCGGGG + Exonic
904591412 1:31617620-31617642 CCCCGCCCTGCCCCTCCCGCCGG + Intergenic
904697033 1:32336445-32336467 CCCCGCCCCGCCCAGCTCGCGGG - Intergenic
904897165 1:33825666-33825688 CCGCCCGCCAGCCCGCCTGCCGG - Intronic
905202354 1:36323275-36323297 CCGCGGGAGGCCCCGCCCCCTGG + Intronic
906144201 1:43550349-43550371 CCCCGCCCCACCCCGCCCCCAGG + Intronic
906214255 1:44030139-44030161 CCGCGCCCCTGCCCGCCGGCCGG - Intronic
906264470 1:44417932-44417954 CCGCGCGCCGCCTCGAGGGCCGG + Intronic
906407856 1:45556300-45556322 GCGCGAGCCGCCGCGCCCGGCGG - Intronic
907010652 1:50959935-50959957 TGGCCCGCCGACCCGCCCGCCGG - Exonic
907010660 1:50959955-50959977 TCCCGCGCTGCCCCGCCCGCTGG - Exonic
907069324 1:51519396-51519418 CCGCCCGCCTGCCCGCCCGCCGG + Intergenic
907197490 1:52698359-52698381 CCCCGCCCCGCCCCCTCCGCCGG - Exonic
907364369 1:53946561-53946583 CCGCGGGCCGGGCCGCTCGCGGG + Intronic
908477719 1:64505733-64505755 CTGCGCCCCGCCCCGCCTTCCGG + Intronic
909475220 1:76074634-76074656 GCCCGCGCGGCCCCGCCCCCGGG - Intergenic
910145809 1:84078398-84078420 CCCCGCGCCGGCCCGCCCAGCGG - Intronic
912682588 1:111738773-111738795 CCCCGCGCAGCCCCGCACCCAGG + Intronic
913047949 1:115089542-115089564 CCGGGCCCCGCCCCGCCCCCCGG - Intergenic
914428532 1:147599991-147600013 CGGCCCGACGTCCCGCCCGCGGG - Intronic
914689170 1:150010471-150010493 CCGCGCTCCGCCCCGGCCTAGGG - Exonic
918015842 1:180631997-180632019 CCCCGCCCCTCCCCGCCCTCTGG - Exonic
918064414 1:181089584-181089606 CCGGGCGCCGGGCAGCCCGCTGG - Exonic
919451136 1:197774959-197774981 CCTAGCGCCGTCCCGCCGGCCGG + Intronic
920886886 1:209938163-209938185 CCGGGCCCCGCCCCTCTCGCTGG + Intronic
921167146 1:212515257-212515279 CCCCGCCCCGCCCCGCACACGGG + Intergenic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
922677337 1:227560984-227561006 CCGCGCGCTGCGCCTTCCGCTGG - Intergenic
923056092 1:230426469-230426491 GCGCGCCCCGCCCCGCCCCGCGG - Intergenic
923744299 1:236686400-236686422 CCGCCCCCGGCCCCGCCCGTCGG - Intergenic
924172416 1:241356678-241356700 CCCCGCGCCGCGGCGGCCGCCGG + Intronic
924436749 1:244049084-244049106 GCCCGCGCCGCCCAGCCGGCCGG - Intronic
924511202 1:244730459-244730481 CCGCGCGCCAGCCCCGCCGCCGG - Intergenic
924539731 1:244970268-244970290 CCCCGCCCCGCCCCGCCCAAGGG + Exonic
924778369 1:247126692-247126714 CCGCGCCGCGCCGCGCCAGCAGG - Intronic
924783289 1:247171728-247171750 CCGCGCCGCGCCGCGCCAGCAGG + Intronic
1062843906 10:690040-690062 CCCCGCCCCGCCCCGCCCCGCGG - Intergenic
1063449992 10:6144892-6144914 TCGCCCGCCCCGCCGCCCGCAGG + Intergenic
1063504020 10:6580180-6580202 CCGCGCCCCGCGCCGCCGCCGGG - Intronic
1063664050 10:8051349-8051371 CCGCACGCCGCCCCGGGCCCCGG + Intergenic
1064662210 10:17617425-17617447 CCCCGCCCCGCCCCGCCCCTTGG + Intergenic
1065099663 10:22321036-22321058 CCCCCCGCCGCCCCCCCAGCGGG - Intronic
1065214753 10:23439086-23439108 CCGCGCTCCTCCTCGCCGGCGGG + Intergenic
1066022836 10:31319811-31319833 CCGCGCGCCGCGGCCCCGGCCGG + Intronic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1067471425 10:46541302-46541324 CCCCGCCCCGCCCCGCCCCACGG + Intergenic
1069024045 10:63521334-63521356 CCCCGCCCGCCCCCGCCCGCCGG - Intergenic
1069664629 10:70146285-70146307 CCCCGCTCCGCGCCGCCCCCGGG + Exonic
1069673890 10:70233431-70233453 GCGCTCCCCGCCCCGCCCGCCGG - Intronic
1070152161 10:73811625-73811647 CGGCGCGCCGCCTCCCCCGGTGG - Exonic
1070162526 10:73874621-73874643 GCCCGCCCCGCCCCGCCCCCAGG + Intergenic
1070305317 10:75235795-75235817 GCGCCCGCCCACCCGCCCGCCGG + Intronic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1071573832 10:86711818-86711840 CTGGCCGCCGCCCGGCCCGCGGG - Intronic
1071579647 10:86757109-86757131 CCCCGCGCCGCGTCCCCCGCCGG + Intronic
1071784215 10:88880722-88880744 GCGCGCGCCGGCCCTTCCGCTGG + Intronic
1072139039 10:92573795-92573817 CCTCACGCCGCCCGTCCCGCCGG - Intronic
1072188303 10:93061988-93062010 CCACCCTCCGCCTCGCCCGCAGG + Exonic
1072421127 10:95291135-95291157 CCGCTCCCCGCCCTGCGCGCCGG + Intergenic
1072454168 10:95561508-95561530 CCGCCCCCGGCACCGCCCGCTGG - Intergenic
1072591428 10:96832096-96832118 CCGCCCCGCGCGCCGCCCGCCGG - Intergenic
1072591803 10:96833304-96833326 CCGCGCTCCCTCCGGCCCGCAGG - Intronic
1072654221 10:97319378-97319400 CCGCGGCCCACCGCGCCCGCCGG + Exonic
1073465632 10:103693229-103693251 CCGCCCGCCCGCCCGCCCGCGGG + Intronic
1074121679 10:110498075-110498097 CCCCGCGCCGCGCGCCCCGCGGG - Exonic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1074801515 10:117005282-117005304 GCCCGCCCCGCCCCGCCTGCAGG - Exonic
1075040704 10:119104580-119104602 CGCCGCGCCGCGCCGCCAGCCGG - Intronic
1075393865 10:122113120-122113142 CCACGCGCCGCGCCGCCACCGGG + Intronic
1075501735 10:122980722-122980744 CCCCGCCCCGCCCCGCCCCGCGG - Intronic
1075693819 10:124419033-124419055 CCGTCCTCCGCCCCGCCCTCCGG + Intergenic
1076792729 10:132785644-132785666 CCGCGCGCCACAGCGGCCGCGGG + Exonic
1076864555 10:133160438-133160460 CCGCGCCGCGCACCGCCCCCGGG - Exonic
1076878757 10:133230122-133230144 GCGCGCCCCGCCCCGCCCGCCGG - Intergenic
1076889544 10:133276944-133276966 GCGCGCCCCGCCCCTCCCACCGG - Intergenic
1076998591 11:311144-311166 AGGCGCGCGGCCCCGCCCGGCGG + Intronic
1076998638 11:311264-311286 CCGCGTCCCGCCCACCCCGCGGG - Intronic
1077000105 11:318495-318517 CCGCGTCCCGCCCACCCCGCGGG + Intergenic
1077000152 11:318615-318637 AGGCGCGCGGCCCCGCCCGGCGG - Intergenic
1077076892 11:706095-706117 CCGCGCGCCCGCCCGCTCTCGGG + Exonic
1077095759 11:798382-798404 CCACGCGCCCACCCGCCCCCTGG + Exonic
1077098480 11:810144-810166 CCACGCGCGGCCTCGCCCGGCGG + Intronic
1077143451 11:1034848-1034870 CCTCGCCCTGCCCCACCCGCAGG + Intronic
1077386062 11:2270014-2270036 CCGCGCGCTGCAGCGCCTGCTGG - Exonic
1078216318 11:9314724-9314746 CCCCGCCCCGGCCCGCCCGCGGG + Exonic
1078316019 11:10293969-10293991 CCCCGGGCCTCCCCGCCCCCCGG - Intronic
1078771759 11:14358621-14358643 CCCCGCGCCCTCCCGCCCCCTGG + Intronic
1079251677 11:18791837-18791859 CCCGGCTCCGCCCCGCCCCCGGG + Exonic
1080588350 11:33700556-33700578 GCCCCCGCCGCCCCGCCCACTGG + Exonic
1080779709 11:35419188-35419210 CCGCGCTCCCCTCCGCCCGCGGG + Exonic
1081672404 11:44949628-44949650 CCCCGCCCCGCCCCGCCCAGCGG + Intronic
1081831458 11:46119869-46119891 CCGCGCGCCCCTCCCCCCGGCGG + Intronic
1081860919 11:46332999-46333021 CTGCGCGCCGCGGCGCCCCCCGG - Intronic
1082050455 11:47766922-47766944 CCCAGGGCCGCCCCGCCTGCAGG + Intronic
1082824434 11:57567674-57567696 GCGCGCCCCGCCCCGCCCCGGGG + Exonic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083758426 11:64803265-64803287 CCCGGCGCGGCCCCGCCCCCGGG - Intergenic
1083883300 11:65558631-65558653 CCCCGCCCCGCCCCGCCCGGAGG - Intronic
1084070046 11:66728109-66728131 AAGCGCGCCGCCCCGCGGGCCGG + Intronic
1084546754 11:69818612-69818634 CCCGGCGCCGCCTCCCCCGCGGG + Intronic
1084546930 11:69819280-69819302 CCGCGGGGCTCCCCACCCGCCGG - Intergenic
1085520843 11:77138158-77138180 CCCCTCGCCGTCCCGCCCGCGGG + Intronic
1087141465 11:94768981-94769003 GCGCGCACCGGCCCGCCCGACGG + Intronic
1088259189 11:107928526-107928548 TCCCGGGCCGCCCCACCCGCGGG - Exonic
1088481075 11:110296732-110296754 CCCCGCCCCGCCCCTCCCGCAGG + Intergenic
1088640810 11:111871301-111871323 CCCCGAACCGCCCCGCCGGCCGG + Intronic
1088686739 11:112290203-112290225 CCGCCCGCGTCCCCGCCCCCCGG - Intergenic
1089499883 11:118925726-118925748 CCCGGCGCCGCGCCGCCCGGGGG - Intronic
1089499924 11:118925843-118925865 CCGCGCGCCGCCGCCTCCCCGGG + Intronic
1090385545 11:126355872-126355894 CCCCGCCCCGCCCCGCCCCGCGG - Intronic
1090699313 11:129279631-129279653 AGGCGCGCCGCCGCGGCCGCGGG + Intergenic
1096073569 12:48788937-48788959 CCCCGCCCCGCCGCCCCCGCGGG + Intronic
1096101235 12:48971608-48971630 CCCAGCGCCGCCGCGGCCGCCGG + Exonic
1096389373 12:51217385-51217407 CCGCGCCCTCGCCCGCCCGCGGG - Intronic
1096495432 12:52037115-52037137 ACGGTCCCCGCCCCGCCCGCCGG + Intronic
1097088817 12:56488784-56488806 CCGCGCGCCACGCTACCCGCCGG - Intergenic
1097190390 12:57216779-57216801 CCGCGCCCCGCCCCCAGCGCCGG + Exonic
1098425945 12:70366176-70366198 CTCCGCCCCGCCCCGCCCGGGGG - Intergenic
1100309035 12:93377758-93377780 GTGCGCGCGGCCCCGCCCACCGG + Intergenic
1101381317 12:104216088-104216110 CCGAGGGCTGCCCCGCCCGCTGG + Intronic
1101716943 12:107319811-107319833 CCGCTCGCCGCTCCTCCCCCGGG - Exonic
1102197141 12:111033934-111033956 CCGTGCGCCCCCCCGACCCCCGG - Intergenic
1102681320 12:114692477-114692499 CCGCGCCCCGCCCCGGTAGCTGG - Intergenic
1103698492 12:122835433-122835455 CCGCGCCCGGGCCCGCCCGCCGG - Exonic
1103809557 12:123602448-123602470 CCGCGACCCACCCCGCCCTCGGG + Intronic
1103822815 12:123712297-123712319 CCGCGTCCCGCCCCCCCCGCCGG - Exonic
1103856147 12:123972612-123972634 CCGCGCCCCGCCCAGCCCATGGG - Exonic
1104021175 12:124993582-124993604 CCGCGCCCCGCCCCCGGCGCGGG - Intergenic
1104887419 12:132118849-132118871 CCGCACGCCGCGCAGCTCGCTGG + Intronic
1105921918 13:24971036-24971058 GCGCGCGCCGCCACGCCTGACGG - Intergenic
1105964528 13:25372323-25372345 CCCCGCGCCGCCCCCGCCCCGGG - Intronic
1106109053 13:26760849-26760871 CCGGCCGCCCGCCCGCCCGCGGG + Intergenic
1107133329 13:36919687-36919709 CCGACCGCCGCCCCCGCCGCGGG + Intronic
1107133506 13:36920316-36920338 CCGCCCGCCGCCGCGCGCTCTGG + Intronic
1109858831 13:68171147-68171169 CCGCGCCCTGCCCCGCGCGGAGG - Intergenic
1112216221 13:97434019-97434041 GCGGGCTCCGCCCCGGCCGCCGG + Intergenic
1112504630 13:99968609-99968631 CCGCGCGCGGCCCCGCGCTTGGG + Intronic
1112508862 13:99991246-99991268 CCGCGCGCCCTCCAGCCCTCGGG + Intergenic
1113082810 13:106535501-106535523 CCGCGCGGCTCCCGGCCCCCAGG + Intergenic
1113492846 13:110705987-110706009 CCGCTCGCCGCCCGGCCCGCAGG + Exonic
1113494523 13:110715976-110715998 CCACGCGCGGCCCCACCCTCGGG - Exonic
1113932423 13:113975460-113975482 CGGCGCACCCCCCCGCCCCCAGG + Intergenic
1114473736 14:22980750-22980772 GCGGCAGCCGCCCCGCCCGCGGG + Intronic
1115028198 14:28766627-28766649 CCCACCCCCGCCCCGCCCGCCGG - Intergenic
1115490071 14:33950554-33950576 CGGCGCGCGGCCCCGCCAGCTGG + Exonic
1115610684 14:35046306-35046328 CCGCGCCTCGCCTAGCCCGCCGG - Intronic
1116849431 14:49893358-49893380 CAGCCCTCCGGCCCGCCCGCCGG - Exonic
1116876444 14:50116597-50116619 ACGCGCACCGCCCCGCCCTGCGG + Intronic
1117029293 14:51652078-51652100 CCCGCCGCCGCCCCGCCGGCAGG - Intronic
1117315153 14:54566183-54566205 CCCCGCGCCGCCCGCCCCGACGG + Intergenic
1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG + Intergenic
1118366477 14:65101768-65101790 CCGAGCGCCGCCCCTCCTTCCGG + Intronic
1119260946 14:73237777-73237799 CCGCGCGCCCCCCGGCCTGGAGG + Intronic
1121342808 14:93115456-93115478 CGCCGCGCCGCCCGGCCTGCCGG + Intronic
1122082372 14:99274563-99274585 CCCCGCGCTGCCCCGACGGCGGG + Intergenic
1122131270 14:99605364-99605386 CCCCGCCCCGCCCCGCCTGCTGG - Intergenic
1122137957 14:99645479-99645501 CCGCGCCCCGCCCCGCCCGGTGG - Intronic
1122145124 14:99684311-99684333 CCGCGCGCCGCCTCGGCCCCAGG - Exonic
1122231125 14:100306697-100306719 CCCCGCGCGTCCCCTCCCGCCGG - Intergenic
1122327578 14:100891645-100891667 CCTCGCACAGCCCCTCCCGCAGG - Intergenic
1122418189 14:101560388-101560410 CCCAGCGCAGCCCCGGCCGCTGG - Intergenic
1122543420 14:102509871-102509893 CAGCGGTGCGCCCCGCCCGCCGG - Intergenic
1122635290 14:103126939-103126961 GCGCTGGCCGCCCCGCCCGGTGG + Intronic
1122840468 14:104460027-104460049 CCTCCCCCCGCCCCGCCCCCAGG - Intergenic
1122975004 14:105167494-105167516 CCGCACACCGCCGCGCACGCGGG + Intronic
1123004390 14:105314455-105314477 GGGCGCCCCGCCCCGCCCCCCGG - Exonic
1123004606 14:105315150-105315172 CCCCCCGCGCCCCCGCCCGCCGG + Exonic
1123630713 15:22258136-22258158 CCCCGCGCGCGCCCGCCCGCCGG + Intergenic
1124392207 15:29269532-29269554 CTGCGAGCCGCCCGGCCCGCGGG + Exonic
1125694163 15:41621543-41621565 CCACGCGCCGCTCCGCTCGCGGG - Intronic
1125834478 15:42737216-42737238 CTCCGCCCCGCCCCGCCAGCCGG - Intergenic
1125937395 15:43648871-43648893 CCCCGCCCCGCCCCGCTCTCCGG + Intronic
1125999373 15:44194920-44194942 CGCCGCCCCGCCCCGCCCGCGGG - Intronic
1126777605 15:52112802-52112824 CCGTGCCCCGCCCCGGCCCCCGG + Intergenic
1127221713 15:56887310-56887332 CCGCGCGCGGCCCGGCCCGGCGG - Intronic
1127343075 15:58066426-58066448 CCCCGCGCTGACCCGCTCGCAGG - Intronic
1127790153 15:62391715-62391737 CAGCGCGTCGCCACGCCAGCCGG + Intronic
1127922483 15:63504442-63504464 CCCCTCCCCGCCCCGCCCCCGGG - Intergenic
1128582262 15:68818504-68818526 CCGCGCCCCACCCCGCCTCCAGG + Intronic
1128972279 15:72118111-72118133 CCGCGCGACTCCCCGGCTGCAGG + Intronic
1129051290 15:72783812-72783834 CCGCCCGTCGCCCCGCCCCTTGG - Intronic
1129150280 15:73684183-73684205 CCCCGCCCCGCCCCGCCCCCAGG - Intronic
1129221619 15:74134729-74134751 CCGCCCGCCTCGCCGCCTGCCGG - Exonic
1129710717 15:77819173-77819195 GCGCGCGCCGCGCCGCCGGCGGG + Intronic
1130296133 15:82647963-82647985 CCGCGCGCAGCCCCGCACCCCGG + Intronic
1130531175 15:84748675-84748697 CCCCGCTCGGCCCGGCCCGCGGG - Intronic
1130564407 15:84981637-84981659 ACCCACGCCGCTCCGCCCGCTGG - Intronic
1130564568 15:84982246-84982268 CGGCGGGCCGCGCCTCCCGCAGG + Exonic
1130967104 15:88705592-88705614 CCCCACGCCGCCCCCTCCGCAGG + Intergenic
1132365086 15:101251457-101251479 GCCCGCGCCGCTCCGCCCGCCGG + Exonic
1132498214 16:273726-273748 CCCTGCCCCGCCCCGCCTGCAGG - Intronic
1132498866 16:275961-275983 CCCCGCGCCGCGCCGCGCCCGGG + Intronic
1132544792 16:528094-528116 CCGCGCTCCCCGCCGCCCTCCGG - Intronic
1132604633 16:788564-788586 GCGCGCGCCGCCGGGCACGCCGG + Intergenic
1132828972 16:1918381-1918403 CCGCGCGCCGCTCAGTCCGTGGG + Exonic
1132844057 16:1991952-1991974 CTGAGCGCCGCGCCGCACGCAGG + Exonic
1132885093 16:2179016-2179038 GCGCCCCCCGCCCCGCCCGAAGG - Exonic
1132900445 16:2251362-2251384 CCGCGCGCCGTCTCCGCCGCCGG + Exonic
1133273938 16:4625349-4625371 CAGCACCCCGCCCCGCCCTCGGG - Intronic
1133286594 16:4693630-4693652 CCGCGGGCGGCCGCGCCCCCGGG - Intergenic
1133304859 16:4802490-4802512 CGCCCCGCCGGCCCGCCCGCTGG + Intronic
1135762618 16:25149150-25149172 CTGCATGTCGCCCCGCCCGCAGG - Intronic
1136390603 16:29962011-29962033 CCTCGCGCGGCCCCGCCCCGCGG - Intronic
1137926686 16:52547241-52547263 TGGCGCGCCGCCCGCCCCGCCGG + Intronic
1138105877 16:54286938-54286960 CCCCGCCCCGCCCCGCGCGCGGG - Intergenic
1138106506 16:54289696-54289718 GCGCGCGCCGCAGCGCCTGCAGG - Intergenic
1138619092 16:58197748-58197770 CTGCGCCCCGCGCCGCCCCCCGG - Exonic
1138660867 16:58516121-58516143 CCCCGCCCCGCCCCGCCCCAGGG - Intronic
1138687014 16:58734389-58734411 GCCCACGCCGCTCCGCCCGCCGG - Intergenic
1139496930 16:67326761-67326783 GCGCGCGCCGCCGCGACCCCGGG - Exonic
1139754627 16:69132496-69132518 CCGCGCGGCGCCGCGCTCGGCGG - Exonic
1139805961 16:69565869-69565891 TGGCGCGCCTCCCCGCCCTCCGG + Intronic
1140078500 16:71723503-71723525 CCGCGCGCCGCCCGCCTCGCAGG - Intronic
1140458123 16:75116271-75116293 CCGCGCCCCGCCCCCCACGAAGG - Intronic
1140506981 16:75479707-75479729 ACGCGCGCCTCGCCGCCTGCTGG + Exonic
1141430443 16:83968319-83968341 AGGGGCGCCGCCCCGCCCCCAGG + Intergenic
1141709420 16:85689174-85689196 CCCGGCCCCGCCCCGCCCGTGGG + Intronic
1141972338 16:87492443-87492465 CCCCGCGCGCGCCCGCCCGCCGG - Intergenic
1141989423 16:87602067-87602089 CCGCGCCTCGCCCCTCCCGCCGG - Intronic
1141989682 16:87602765-87602787 CGGCGCGGCGCCCTCCCCGCGGG + Intronic
1142130787 16:88430656-88430678 CCGCCCGCCGCCCCAGCCGCCGG - Intronic
1142173494 16:88634665-88634687 CCGGGCCCCGCCCAGTCCGCAGG + Intergenic
1142188511 16:88706258-88706280 CCGCCCGCCGGCCCGGCCGGCGG + Exonic
1142349886 16:89575194-89575216 CCCCGCCCCGCCCCGGCCTCGGG + Intergenic
1142367498 16:89657759-89657781 CCGCGCCCCGCCCCTCTGGCGGG - Exonic
1142412368 16:89923225-89923247 CAGAGCCCCGCCCGGCCCGCAGG - Intronic
1142429718 16:90019487-90019509 GCGCGCCCCGCCCCGCCCCGCGG - Intronic
1203081430 16_KI270728v1_random:1147723-1147745 CCTCCCGCCGCCCCGTCCCCCGG - Intergenic
1142509699 17:385904-385926 CTGCGCTCCGCCCCGACCTCGGG - Intronic
1142547257 17:713747-713769 CCACGCGCGGCCCTGCCTGCAGG - Intronic
1142603222 17:1067426-1067448 CTGGGGTCCGCCCCGCCCGCAGG + Intronic
1142749187 17:1977518-1977540 CCGCCCCCCACCCCGCCCGCCGG + Intronic
1143026610 17:3945002-3945024 CCACGCGTGGCCCCGCCCCCAGG + Intronic
1143030473 17:3964484-3964506 CCCCGCGCCGCCCCGCCCCGGGG - Intergenic
1143116436 17:4584306-4584328 GGGCCCGCCGCCCCTCCCGCAGG + Intronic
1143519678 17:7438230-7438252 CCGCCCCCTGCCCCGCCCCCGGG + Intergenic
1143742669 17:8965725-8965747 ACAGGCTCCGCCCCGCCCGCCGG - Intergenic
1143904571 17:10198608-10198630 CCGCGAGCTGCCCGGCCCGGGGG - Intergenic
1144339975 17:14302692-14302714 CCGCGCGCCGCCCGCCCGCCAGG - Intronic
1144604561 17:16653487-16653509 CCCAGCGCCGCCAGGCCCGCAGG + Intronic
1144756184 17:17681838-17681860 CCTCGCGCCGCCCCCGCCCCGGG - Intronic
1144784376 17:17823687-17823709 CCCAGCCCCGCCCCGCCTGCAGG + Intronic
1144930890 17:18858104-18858126 CCTCGCCCCTCCCCGCCCACCGG + Exonic
1145243594 17:21253290-21253312 CCGCGCGCCCCGGCCCCCGCCGG - Exonic
1146057618 17:29589218-29589240 CCCCGCCCCGCCCAGCCCTCCGG + Intronic
1146445342 17:32928249-32928271 CCGCGGCCCGCCCGGCCCGGCGG - Intronic
1146887638 17:36483159-36483181 CCGCGCACCGTCCCGCCAGAGGG - Intergenic
1146896524 17:36545400-36545422 CCGCCCGCCCGCCCGCCCGCCGG - Intronic
1147110439 17:38257359-38257381 GCGTGCGCGGCCCCGCCGGCCGG + Intergenic
1147123800 17:38352202-38352224 CCTCGCGCGGCCCGGCCCGCGGG + Intergenic
1147285301 17:39398032-39398054 CCCCCCCCCCCCCCGCCCGCCGG - Intronic
1147424829 17:40341575-40341597 CCGCTCGCCAGCCCGCCCGCGGG - Intronic
1147684020 17:42276323-42276345 CCGCGCGGCGGCCCGGCCGAGGG - Exonic
1147686218 17:42288305-42288327 CCACGCCCGGCGCCGCCCGCCGG + Exonic
1147719810 17:42532137-42532159 GCGCGCGACGCCCGGCCCGGCGG - Intergenic
1147720357 17:42536222-42536244 ACGCGGGCCGCCCCACCCCCTGG + Exonic
1147722282 17:42546694-42546716 CTTCGCCCCGCCCCGCCTGCGGG - Intergenic
1147723467 17:42552864-42552886 CTTCGCCCCGCCCCGCCTGCGGG - Exonic
1147792550 17:43022414-43022436 CGGCGCCCCGCCCCTCCCGCTGG - Exonic
1147896547 17:43755312-43755334 CCGCGCCCCTCCCCACCGGCGGG - Exonic
1147974029 17:44237560-44237582 GCGCGCGCCGCCACGCCTGACGG + Intergenic
1148156583 17:45428188-45428210 CAGTGCCCAGCCCCGCCCGCCGG + Intronic
1148177859 17:45583497-45583519 CCCCGCCCCGCCCCGCCCAAAGG - Intergenic
1148419067 17:47531072-47531094 GCGTGCGCGGCCCCGCCGGCCGG - Exonic
1148576956 17:48719065-48719087 CCCTGCGCCTCCCCGCGCGCCGG + Intergenic
1148664175 17:49362160-49362182 CCCCGCGCTGCCCGCCCCGCCGG - Intronic
1149461655 17:56834102-56834124 CAGCTCGCGGCCCCGCGCGCCGG + Exonic
1149994760 17:61400581-61400603 CCGCGCGCCTTCCAGCCGGCCGG - Intronic
1151728224 17:75896641-75896663 CCGCGCGCTGCCCCCGCCACGGG - Exonic
1151836506 17:76585905-76585927 CCCTGCCCCGCCCTGCCCGCCGG + Exonic
1151856585 17:76726339-76726361 CCGCTCACCGCCACGGCCGCCGG + Exonic
1151875944 17:76868437-76868459 CCGCGCGACGCTACGCCCGGAGG - Intronic
1151875960 17:76868496-76868518 CCGCGCGCTCTCTCGCCCGCTGG - Intronic
1152233329 17:79125716-79125738 CCACGCGGCGCCCTTCCCGCAGG - Intronic
1152357432 17:79813792-79813814 CCTCGCCCCGCCCCTCCCGGGGG + Intergenic
1152468371 17:80477755-80477777 CCCCGCCCCGCCCCGCCCCGGGG + Intronic
1152628610 17:81399664-81399686 CCGCGCGCCGAGCCGCCCCCGGG + Exonic
1152748472 17:82051851-82051873 CCCCGCCCCGCCCCGCGCCCCGG + Intronic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1152810543 17:82379858-82379880 CTGCGCATCCCCCCGCCCGCTGG + Intergenic
1153457234 18:5295285-5295307 CCGCGCGCCGCCCCCGCCCCCGG - Intronic
1153872540 18:9334495-9334517 CCGCCCGCCCGCCGGCCCGCAGG - Intergenic
1154304041 18:13217954-13217976 CGGCGCGCCGCGCTCCCCGCCGG + Intronic
1155199415 18:23503836-23503858 GCGCGCGCCGCCTCCCGCGCTGG - Intronic
1155654297 18:28176927-28176949 CCGCCCGTGGCCCGGCCCGCGGG + Intronic
1156452431 18:37274454-37274476 TCACGCGCCGCCCCGGCCGCAGG - Exonic
1156489001 18:37485441-37485463 CCGCGCGCCGCGCCGCCGCCCGG + Intronic
1158137733 18:54224627-54224649 CCGCGCGCCGCGCTGCGGGCGGG - Exonic
1159797913 18:72867076-72867098 CCGCGCGCCGCCCCCACGCCCGG + Intronic
1160256205 18:77250510-77250532 CCGCGCGCCCCGCCGCTCGCCGG + Intergenic
1160631255 18:80247559-80247581 GCGCGCGCCGCCCCACCTCCCGG + Intergenic
1160725519 19:616374-616396 CCGCGCCCAGCCCGGACCGCAGG + Exonic
1160775523 19:853407-853429 GCGCCCCCCGCCCCGCCCGGCGG - Intronic
1160861264 19:1238039-1238061 CCGCCCCCCGCCCCGCCGGAAGG - Intergenic
1160868494 19:1266578-1266600 CCCCACGGGGCCCCGCCCGCCGG - Intronic
1160895822 19:1401403-1401425 GCGGGCGCCGCCCCCCACGCGGG + Exonic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161153597 19:2721451-2721473 CCCCGCCCCGCCCCGCCCCGGGG + Intronic
1161203704 19:3029379-3029401 CCGCGCCCCCCCCGGCCCCCGGG + Intronic
1161210367 19:3062435-3062457 CCGCCCGCCTCCCCGCTCCCCGG + Intronic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161424980 19:4198385-4198407 CAGCGCCCAGCCCCGCCCTCCGG + Intronic
1161550533 19:4909937-4909959 TCGCGGGGCGCCCCGCGCGCAGG - Intronic
1161779167 19:6279788-6279810 TGGCGCCCCGCCCCGCCCCCGGG + Exonic
1162021009 19:7868657-7868679 CCCCGCGCCGCTCAGCCTGCTGG + Intergenic
1162100400 19:8335359-8335381 GCGCGCCCAGCCCCGGCCGCGGG - Exonic
1162128229 19:8510850-8510872 CCGCGCCCCGACGCCCCCGCGGG - Exonic
1162176186 19:8832208-8832230 CCGAGCCCGGCCCCTCCCGCGGG + Exonic
1162426871 19:10602415-10602437 CCCGGCCCCGCCCCTCCCGCCGG - Intergenic
1162733258 19:12731530-12731552 CCGCGCCCAGCTCCGCCAGCCGG + Intronic
1163453041 19:17390517-17390539 GTGCGCGCCGCGCCGGCCGCCGG + Intergenic
1163517801 19:17775365-17775387 CCGCCCCCCGCCCTGCCCCCAGG - Intronic
1163708543 19:18832061-18832083 CCGCGCGCCCCGGCGCCAGCCGG - Exonic
1164594912 19:29526373-29526395 CCCCGCGCAGCGCCCCCCGCCGG + Intergenic
1164594945 19:29526450-29526472 CCGCGCGGCGCCCCCTCCCCTGG - Intergenic
1165199234 19:34132015-34132037 GCGCGCGCCGCCACGCCTGACGG + Intergenic
1165242900 19:34481845-34481867 CCCCGCCCCGCCCCGCGCCCAGG + Exonic
1166139619 19:40799149-40799171 CCCCGCCCCGCCTCGCCCGGTGG - Intronic
1167104486 19:47422061-47422083 GCGCCCGCCCCTCCGCCCGCTGG + Intergenic
1167509910 19:49890600-49890622 CCCCGCCCCGCCCCGCCTGCAGG - Exonic
1167641879 19:50686849-50686871 GCCCGCTCCGCCCCGCCCCCGGG - Intronic
1167643782 19:50695248-50695270 CCCCGCGCCCCCGCGCCCCCCGG - Intronic
1168336469 19:55600205-55600227 CCGCCCGCCTGCGCGCCCGCGGG - Intronic
1168714690 19:58519840-58519862 CCCTGCGCCGCCGCGACCGCAGG - Exonic
925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG + Intergenic
925170045 2:1744611-1744633 TCTCGCCCCGCCCCGCCCTCGGG - Intronic
925927664 2:8681860-8681882 TCGCGCCCCGCCCACCCCGCGGG + Exonic
926155003 2:10448613-10448635 CCTCGCCCCGCCCCGCCCTGCGG + Intergenic
927558219 2:24050343-24050365 CCGCTCACAGCCCGGCCCGCAGG - Intronic
927692289 2:25216502-25216524 GCGCGAGCCACCGCGCCCGCCGG - Intergenic
927943303 2:27119020-27119042 CCAGCCGCCGCCCCGCCCGCCGG + Exonic
928022519 2:27715766-27715788 CCCCGGGCCGCCCCGGCCTCTGG - Intergenic
928158138 2:28894977-28894999 CCACGCGCCACCCGGCCCGGAGG - Intronic
929075486 2:38076226-38076248 CGGCGCGCCCCGCCCCCCGCAGG - Intronic
929218038 2:39436856-39436878 CCGCGCGCCGCCGAGGCCGTGGG - Intronic
930096462 2:47570347-47570369 CCGAGCGCCGCCCCGGCCCCGGG - Exonic
930730708 2:54725020-54725042 CCCCCCGCCCCCCCGCGCGCCGG - Exonic
932567686 2:72919977-72919999 CCGCGGGCCGCCGCGGCCGAGGG + Intronic
932828003 2:74958960-74958982 CCGCCCTAAGCCCCGCCCGCGGG - Intronic
934098258 2:88627275-88627297 CAGCGTCCCGCCCCGCGCGCAGG + Exonic
934566986 2:95346618-95346640 CCCCGCGCCCCGGCGCCCGCGGG + Intronic
935820459 2:106887532-106887554 CTCCCCGCGGCCCCGCCCGCAGG - Intergenic
936403196 2:112181779-112181801 CCGCGCGCCGCGCTGTGCGCAGG + Exonic
936452858 2:112646259-112646281 CCGCCCGTCTGCCCGCCCGCGGG + Intronic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
937907433 2:127059039-127059061 CCGGGCGTGGCCCCGCCGGCCGG + Exonic
939178597 2:138780155-138780177 CCGCGCGCCGTCCCACACGCCGG - Intronic
940322897 2:152395900-152395922 CCTGCCGCCGCCCCGCCCCCTGG - Intronic
940918899 2:159286582-159286604 CCGCGCGCCCCCGCTCCTGCAGG - Exonic
941508426 2:166376085-166376107 CCCCGCCCTGCGCCGCCCGCAGG - Intergenic
942034752 2:171999918-171999940 TCGCTCGCCGCCCCGCCCGCTGG - Exonic
942653794 2:178194573-178194595 CCGCGCGCCAGTCCGCCTGCCGG + Exonic
945110798 2:206357607-206357629 GCGCGCGCCGCCACGCCTGACGG - Intergenic
945891593 2:215436180-215436202 CCACCCGCCCGCCCGCCCGCCGG + Intergenic
945955413 2:216081868-216081890 CCCGGCCCCGCCCCGCCCGCCGG + Exonic
946326126 2:218985460-218985482 CCGCGCGTCTCCCCGGCTGCGGG - Exonic
946422126 2:219571030-219571052 CCGTGCTCCGCGCCGTCCGCCGG + Exonic
948207047 2:236168009-236168031 CCCCGCGCCGCGCCGCCGCCGGG + Exonic
948438055 2:237967194-237967216 GCGCCCTCCGCCCGGCCCGCAGG - Intronic
948645294 2:239400619-239400641 CCGCGCCCCGCGCAGCCTGCAGG - Exonic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
948958786 2:241315872-241315894 CCCCGCCCCGCCCAGCGCGCAGG - Exonic
1168869791 20:1118607-1118629 CCCCGCCCCGCCCCGTCCCCGGG + Exonic
1169214794 20:3786663-3786685 CCGCCCGGCGACGCGCCCGCCGG - Exonic
1170629640 20:18056465-18056487 CGGCGCGTCCTCCCGCCCGCAGG - Intronic
1171092347 20:22297029-22297051 ACGTGAGCCGCCCCGCCCGGCGG + Intergenic
1171122437 20:22578519-22578541 CCGCCCGCCAGCCGGCCCGCCGG - Intergenic
1171496680 20:25561180-25561202 GCGCGCGCCGCCACGCCTGACGG + Intronic
1172252539 20:33490040-33490062 GCTGGCCCCGCCCCGCCCGCCGG - Intergenic
1172596614 20:36154803-36154825 CCCCGCGCCGCCCCGCCCCGCGG + Exonic
1172954830 20:38748675-38748697 CCGTGCCCCGCCACGACCGCGGG - Exonic
1173251603 20:41366696-41366718 CGCCGCGCCGCCCCCGCCGCTGG + Exonic
1173279839 20:41618251-41618273 CCCGGCCCCGCCCCGCCGGCCGG - Intronic
1173516152 20:43666985-43667007 CCCCGCCCCGCCCCGCCCCCTGG + Intergenic
1175422017 20:58840634-58840656 TCGCGCGCCGCCCAGCACTCAGG + Intronic
1176131602 20:63498874-63498896 CCCCGCGCCGCCCCCCACCCCGG + Intronic
1176178635 20:63739778-63739800 GCCCGCGCCGCGCCGCCCGGAGG - Intronic
1176178685 20:63739923-63739945 CCCCGCCCCGCGCCGCCGGCCGG + Exonic
1176194255 20:63830423-63830445 CCCCGAGCCGCCCCGCCCCGAGG + Intronic
1176207141 20:63895289-63895311 CCGCCCGCCCGCCCTCCCGCCGG - Exonic
1176231232 20:64034100-64034122 GCGCCCTCCTCCCCGCCCGCTGG - Intronic
1176546608 21:8205048-8205070 CCACGGGCCGCCCTGCCAGCCGG + Intergenic
1176547887 21:8209265-8209287 GCGCGCGCCCCGGCGCCCGCGGG - Intergenic
1176554502 21:8249239-8249261 CCACGGGCCGCCCTGCCAGCCGG + Intergenic
1176555770 21:8253433-8253455 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
1176565559 21:8388095-8388117 CCACGGGCCGCCCTGCCAGCCGG + Intergenic
1176566764 21:8392108-8392130 CCCTGCGCCGCGCCGCCGGCGGG + Intergenic
1176573424 21:8432263-8432285 CCACGGGCCGCCCTGCCAGCCGG + Intergenic
1176574707 21:8436467-8436489 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
1176611321 21:8987760-8987782 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
1177010916 21:15729879-15729901 CCCCGCAGAGCCCCGCCCGCCGG - Intergenic
1178584849 21:33863363-33863385 CCGTGCCCGGCCCCGGCCGCTGG - Intronic
1178708196 21:34890784-34890806 GCGCGCGCCCGCCCGCCCGCAGG + Intronic
1178948421 21:36966729-36966751 CCCCGCGCCGCCTGGCCCGGGGG - Intronic
1179213622 21:39348759-39348781 GCGCTCGCCTGCCCGCCCGCCGG + Intronic
1179411789 21:41168164-41168186 CTGCCCGCAGCCCCGCGCGCCGG + Exonic
1179522469 21:41954021-41954043 CCCCGCCCCGCCCCGCCCCGCGG - Intergenic
1179529738 21:42010434-42010456 CCCCCCCCCGCCCCGCCCTCCGG - Intergenic
1179783811 21:43718819-43718841 CCCCGCGCCCCGCCGCACGCAGG - Intergenic
1179828227 21:43980350-43980372 CCACGGGCTGCCCCGCCCACGGG + Intronic
1179988183 21:44932556-44932578 CCACGCGCGGCCCCATCCGCAGG - Intergenic
1180093079 21:45542505-45542527 ACGCGCGAGGCCCCGCCCTCAGG - Intronic
1180559172 22:16601795-16601817 CCGCCCGCGGCCCCTCCCCCGGG - Intergenic
1180620574 22:17159150-17159172 TCCAGGGCCGCCCCGCCCGCAGG - Exonic
1180782731 22:18529871-18529893 CAGTGCCCCGCCGCGCCCGCAGG - Intronic
1181239621 22:21469209-21469231 CAGTGCCCCGCCGCGCCCGCAGG - Intergenic
1181632022 22:24156378-24156400 CCGCGCGCCGCCGCCCAAGCCGG - Intronic
1181697918 22:24603119-24603141 CCTCCCCCCGCCCCGCCCCCAGG + Intronic
1182222944 22:28773009-28773031 CCGCGCGCCGCACTCCCAGCGGG - Exonic
1182237124 22:28884204-28884226 CCGCCCGCCTGCCCGCCCGCAGG - Intronic
1182377539 22:29858819-29858841 GCGCGCGCCGCCACGCCTGACGG - Intergenic
1182445460 22:30387150-30387172 CCCCGCCCCGCCCCGGCCGCCGG + Exonic
1183149938 22:36029027-36029049 CCTGGCCCCGCCCCCCCCGCGGG - Intergenic
1183228145 22:36564284-36564306 CCCCGCCCCGCCCCGCCCCCGGG + Exonic
1183299502 22:37051956-37051978 CCGCTCGCCGCCCACCCCGGGGG - Intronic
1183441389 22:37825012-37825034 TCGGCCGCCGCCGCGCCCGCGGG - Exonic
1184522974 22:45007034-45007056 CCGCGCGCCGGGCCCCCCTCCGG + Intronic
1184698019 22:46150540-46150562 CCGCCCGCTGCCCCCGCCGCGGG - Intronic
1184698063 22:46150656-46150678 CCGCCCGCCCGCCCGCCCCCGGG - Intronic
1185037900 22:48489378-48489400 CCCCGCGCCGGCCCGCCAGGGGG - Intergenic
1185055159 22:48575545-48575567 CTGCGCGCCTCGCCGCCCGCGGG - Intronic
1185333441 22:50261616-50261638 CCGCTCGCCCGCCCGCCCGCCGG + Exonic
1185336005 22:50271118-50271140 CCCCGCGCCTGCCCGCCCGCGGG - Intergenic
1185375687 22:50481767-50481789 CCGCGAGCCACCCCCTCCGCCGG - Exonic
1203251473 22_KI270733v1_random:121314-121336 CCACGGGCCGCCCTGCCAGCCGG + Intergenic
1203252755 22_KI270733v1_random:125518-125540 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
1203259523 22_KI270733v1_random:166396-166418 CCACGGGCCGCCCTGCCAGCCGG + Intergenic
1203260811 22_KI270733v1_random:170604-170626 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
949533403 3:4978538-4978560 CCGGGTGCCCGCCCGCCCGCAGG + Intergenic
952382971 3:32818566-32818588 CTCCGCGCCGCCACTCCCGCAGG + Exonic
952889162 3:38029542-38029564 CCTCCCGCCGCGCCGCCCGTCGG - Intronic
953037647 3:39227205-39227227 GCGCGCGCCGCCACGCCTGACGG + Intergenic
953099259 3:39809483-39809505 TCGCGGGCCGCCCCTCCCGCCGG + Intronic
953881551 3:46693754-46693776 CCCCGCCCCGCCCCGCCTCCGGG + Intergenic
954004189 3:47578752-47578774 CCGGCCGCCGCGCCTCCCGCCGG + Exonic
954085496 3:48241025-48241047 CCGCGCGGCGCGCAGCCTGCCGG - Intergenic
954228603 3:49199359-49199381 ACTCGCGCGGCCCCGCCCCCAGG - Intronic
954228633 3:49199471-49199493 GCACGCGCGGCCCCGCCCCCAGG - Intronic
954838925 3:53494615-53494637 CGCCGCGCCGCGCCGCACGCCGG - Intergenic
954864687 3:53718576-53718598 CCCCCCGCCCCCCCGCCCCCCGG + Intronic
955368708 3:58332859-58332881 CCACGCGCCGCCGGGCCCGCGGG - Exonic
956414627 3:69013397-69013419 ACGCCCGCCTCCCGGCCCGCAGG + Intronic
956675043 3:71725333-71725355 CCGGCCGCCGCGCCCCCCGCCGG - Exonic
958638542 3:96776880-96776902 CCGCGGGCCGCGCCCGCCGCCGG + Intergenic
959849722 3:111071976-111071998 CCGCTCGCCCGCCCGCCCCCCGG - Exonic
961067015 3:123884247-123884269 CGGCGGGGCGCCCCGGCCGCAGG + Intronic
961574473 3:127823270-127823292 CCGCGCCGCCCGCCGCCCGCCGG - Intergenic
961734736 3:128994165-128994187 CCCCGCGGAGCCCCGCCCCCAGG - Intronic
962222299 3:133573990-133574012 CCGCGGGCCGCGCCCGCCGCCGG + Exonic
962520752 3:136195858-136195880 CCCCGCCCCCTCCCGCCCGCCGG - Intronic
966181864 3:177196473-177196495 CCGCGCGCCCCTCCCCCGGCCGG + Exonic
966350140 3:179024838-179024860 CCTCCCCCCGCCCCGCCCCCGGG + Exonic
966696256 3:182793441-182793463 CCCCGCCCCGCCCGGCCCCCCGG - Intergenic
966912886 3:184569182-184569204 CCGCCCGCCGGTCCGCCCGCCGG - Intronic
966912891 3:184569194-184569216 CCTCCCGCCGGTCCGCCCGCCGG - Intronic
967762434 3:193241117-193241139 CCGCCCGCCCGCCCGCCCGCCGG - Exonic
967858266 3:194134309-194134331 CGGCGCGCGGCCCGGCCAGCAGG + Intergenic
967859699 3:194141578-194141600 CCGCCCGCCCGCCCGCCCGCCGG - Intergenic
968114966 3:196082207-196082229 GCGCGCGCATCCCCGCCCCCCGG - Intergenic
968133759 3:196207768-196207790 CCGAGCCCCGCCCCGCCCCCCGG + Intronic
968323462 3:197791584-197791606 CCGGGAGCCGCCCCGGCCGGGGG + Intronic
968506533 4:973597-973619 CAGCGCCCCGCCCCGCCCCGCGG - Intronic
968756508 4:2418776-2418798 CGGCGGGTCGCCCCGCCGGCAGG - Intergenic
968803253 4:2756456-2756478 CCCCGCGCAGCCCCGCCCGACGG + Intergenic
969271356 4:6105443-6105465 CCGCCCCCTCCCCCGCCCGCGGG - Intronic
970636979 4:18021185-18021207 CCTCCGGCCGCCCTGCCCGCCGG + Intronic
972396454 4:38663530-38663552 CGCCGCGCCGCGCCGGCCGCGGG + Intergenic
972686908 4:41360746-41360768 CCCCGCCCCTTCCCGCCCGCCGG - Intronic
973820694 4:54659110-54659132 CCGCCCGCCTCCCCGCCCCCGGG + Intronic
979349277 4:119627338-119627360 CCCCGCGCTGCGCCGCCCCCTGG + Intronic
980053687 4:128061153-128061175 CCGGGTGCCGCCCGGCCCGAGGG - Intergenic
980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG + Intronic
981044471 4:140252869-140252891 CCGAGCGCAGGCCCGCCCGACGG - Intergenic
981128404 4:141132624-141132646 CCGCCCGCCGCCCCGGCCCCGGG + Exonic
984928387 4:184826102-184826124 CGCGGCCCCGCCCCGCCCGCAGG + Intronic
984966390 4:185143613-185143635 CCGCCCGCCCGCCCGCCCGCGGG + Intronic
985630010 5:1009228-1009250 CCGCCCCCCGCCCCGCCCGTCGG - Intronic
986330774 5:6714488-6714510 CCGCGCGGCCCCGCGCCCGCCGG + Intergenic
986721642 5:10564492-10564514 CAGCGCGCCCCGCCGCCCTCCGG - Exonic
987084640 5:14457379-14457401 CCCCCCCCCGCCCCGCCCCCCGG + Intronic
987340671 5:16936356-16936378 CCGCTCGCGGCCCCGCCCCCAGG + Intergenic
991769206 5:70025290-70025312 CCGCCAACGGCCCCGCCCGCTGG - Exonic
991848501 5:70900708-70900730 CCGCCAACGGCCCCGCCCGCTGG - Exonic
992463945 5:76985746-76985768 GCGCGCGCCGCCACGCCTGACGG - Intergenic
992530109 5:77645242-77645264 CCGCGCCCCTCCCCGCCCGGGGG + Intergenic
998467516 5:142357371-142357393 CCGCGCGCCGCCCTTCTCTCCGG + Intergenic
999300126 5:150485908-150485930 CCGCCGGCCGCCCCGGCCTCCGG + Intronic
999731197 5:154477818-154477840 GCGGGCGGCGGCCCGCCCGCAGG + Exonic
1001940862 5:175738543-175738565 CCGGGCGTCCCCCCTCCCGCAGG - Intergenic
1002093474 5:176817798-176817820 CCTCCCGCAGCCCCGCCCGACGG - Intronic
1002160559 5:177311944-177311966 CCCCGGGACGCCCCGCCCGCGGG + Exonic
1002170319 5:177371045-177371067 CCCCGCCCCGCCCCGCCCCGCGG - Intronic
1002487616 5:179550528-179550550 CCCCGCGCCCGCCCGCCCGCTGG + Intergenic
1002498898 5:179634534-179634556 CCGCGCTCCGGCCGGCCGGCAGG - Intronic
1002502778 5:179657990-179658012 CCGCGCTCCGGCCGGCCGGCAGG + Intergenic
1002523971 5:179805814-179805836 CCCCGCGCCGCCCCGCTGGCCGG - Intronic
1002662780 5:180802851-180802873 CCCCGCCCCGCCCCGCCTGCCGG - Intronic
1002662788 5:180802898-180802920 CCCCGCCGCGCCCCGCCCCCCGG + Intronic
1003035004 6:2634349-2634371 CCCCGCCACGCCGCGCCCGCAGG + Intronic
1003427725 6:6008725-6008747 CCCCCAACCGCCCCGCCCGCAGG - Intergenic
1003870398 6:10398352-10398374 CCGCGCGCCCACCCTCCGGCGGG - Exonic
1003995675 6:11537765-11537787 CCGCCCGCCTGCCCGCCCTCGGG - Intergenic
1004503172 6:16227023-16227045 CCCCGCCCCGCCCCGCCCTGCGG + Intergenic
1005605510 6:27473140-27473162 GCGAGCCCCGCCCCGCACGCCGG + Intergenic
1005968392 6:30742902-30742924 CCGCGCCACGCTCCGCCCCCGGG + Intergenic
1006119590 6:31795825-31795847 CCGCGCGGCTCGCCGCCCGCCGG + Exonic
1006210059 6:32385945-32385967 GCGCGCGCCGCCACGCCTGACGG - Intergenic
1006334070 6:33411255-33411277 CCGCGCCCCGCGCCGACCCCCGG - Intronic
1006829362 6:36959375-36959397 CTCCGCCCCGCCTCGCCCGCCGG - Intronic
1007431484 6:41779821-41779843 CCCGGCGCCGCCCGGGCCGCGGG - Exonic
1007431509 6:41779897-41779919 CCCCGCCCCGCCCCGCCCCGCGG + Exonic
1007431574 6:41780109-41780131 CCGCGCCCCGCCTCCGCCGCAGG - Intronic
1007625382 6:43243619-43243641 CCCCGCCCCGCCCCGGCCCCGGG + Intergenic
1007644437 6:43369468-43369490 CTGCGCGCCGCCTCAGCCGCGGG + Intronic
1007844054 6:44739368-44739390 CCGGCCGCCACCCTGCCCGCGGG - Intergenic
1009552746 6:65120004-65120026 GCGCCCGCCACCCCGCCCGGCGG - Intronic
1010083017 6:71886416-71886438 CCCGGCGCCGCTCCGCCCACGGG - Intergenic
1011044403 6:83065926-83065948 GCGCGCCCCGCCCCGGCCTCCGG - Intergenic
1011148795 6:84245466-84245488 GCGCGCGCCGCCACGCCTGACGG - Intergenic
1011258669 6:85450027-85450049 CCGGGCCCCGCCCCTCCAGCCGG + Intronic
1011640439 6:89412193-89412215 CCCTCCCCCGCCCCGCCCGCCGG + Exonic
1011734412 6:90296963-90296985 CAGCGCACCTCCCCGGCCGCTGG + Intergenic
1012470551 6:99568557-99568579 CCGCGGGCCGCTCCGCCGGCTGG - Exonic
1013106147 6:107028182-107028204 CTGCGCCCCGCCCCTTCCGCCGG - Intergenic
1013619281 6:111872872-111872894 GCGCACGCCGCCCCCGCCGCAGG - Intronic
1013619382 6:111873156-111873178 GCCCGCGCCGCACCGCCCGGCGG - Exonic
1014098175 6:117482573-117482595 CCCCGCCCCGCCCCGCACGTCGG - Intronic
1014137858 6:117908340-117908362 CTCCGCCCCGCCCCGCCCGGGGG + Intronic
1014798252 6:125749456-125749478 GCGAGCGCGGCCCCGCCCCCTGG + Intronic
1015328414 6:131950703-131950725 CCTCACGCCCACCCGCCCGCTGG - Intronic
1015626275 6:135182817-135182839 CCCCGCCCAGCCCAGCCCGCGGG - Intronic
1016461741 6:144285792-144285814 CCGCGGGCCTCCTCGCCTGCCGG - Intronic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1017103346 6:150866569-150866591 CCGCGCGCGGCCCCTCCTGCTGG + Intronic
1017497637 6:154995561-154995583 CCGCGCGCCGCCCCGCCCGCAGG - Intronic
1017662401 6:156687356-156687378 CCTCGCGCCGCCGCGCCACCCGG - Intergenic
1019461399 7:1160719-1160741 CCGCGCTGCCCCCCGCCCCCTGG + Intronic
1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG + Intergenic
1019828258 7:3301409-3301431 CCGCGCCGCGCCCCTCACGCGGG + Intergenic
1020049462 7:5072355-5072377 CCGACAGCCGCCCTGCCCGCAGG + Exonic
1020130598 7:5556645-5556667 CCCCGCCCTGCCCCGCCCTCCGG + Intronic
1021106551 7:16645444-16645466 CCGGGCTCCGCCACGCCCCCCGG + Intronic
1021452795 7:20798126-20798148 CCCCGCCCCGCCCCACCCTCCGG + Intergenic
1021828009 7:24573636-24573658 CCGCGCGCCGGGCCGGCCGGGGG + Intronic
1022207710 7:28180106-28180128 CCGCCCCGCGCCCCGCGCGCCGG + Intronic
1022714928 7:32891218-32891240 CCGGGCGCCTCGGCGCCCGCGGG - Intronic
1022923190 7:35036971-35036993 CCGCGCCGAGCCCCGCCAGCCGG - Intronic
1023951226 7:44847828-44847850 CCGAGCCCCTCGCCGCCCGCCGG - Intronic
1023972375 7:45000473-45000495 CCCCGCCCCGCCCCGCCAGCTGG - Intronic
1024521088 7:50304539-50304561 GCGCGCACAGCGCCGCCCGCGGG - Intronic
1025004770 7:55345104-55345126 CCGCGCCCCGCCCTGGCCTCTGG + Intergenic
1026665362 7:72336496-72336518 CGGCGCGGCCCCCAGCCCGCGGG + Intronic
1027001785 7:74658678-74658700 CCCCGCCCCGCCCCGCTCCCAGG + Intronic
1027152061 7:75739582-75739604 CCACGCTGCGCCCCGCCCGCGGG - Intergenic
1027262805 7:76477148-76477170 CCGCCCGCCCGCCCGCCCGAGGG + Intronic
1029110528 7:98211308-98211330 CCTCCCGCCCGCCCGCCCGCAGG + Intergenic
1029461069 7:100694133-100694155 CCGCGCGCCGCCCACGCCCCGGG - Intergenic
1029563856 7:101321839-101321861 CCGCTTTCCGCCCCGCGCGCCGG - Intergenic
1029813875 7:103074857-103074879 CCACGCCCAGCCCCGCCCCCTGG - Intergenic
1030656634 7:112175151-112175173 CCGCGCCCAGCCCCGTCCCCTGG + Intronic
1030714335 7:112790471-112790493 CCGCGCGCCGCCACACACTCAGG + Exonic
1031833920 7:126659032-126659054 CCGCCCCCCGCCCCGCCCCCAGG + Intronic
1031966530 7:128031581-128031603 CGGAGCGCCGCCCCGCGTGCCGG - Intronic
1032074517 7:128830221-128830243 CCCCGCGCCGCCCGGGCGGCGGG - Intergenic
1034166369 7:149028220-149028242 CCGCGCGGAAGCCCGCCCGCCGG + Intronic
1034228044 7:149497876-149497898 CCCCGCCCAGCCCCGCCCGCGGG + Intergenic
1034963090 7:155374359-155374381 CCGGGTCCCGGCCCGCCCGCCGG - Intergenic
1035167452 7:157000073-157000095 CCGCGCCCCGCTCCGCCCCCGGG - Intronic
1035717045 8:1763326-1763348 CCCGGCCCCGCCCCTCCCGCCGG + Intronic
1035751895 8:2002222-2002244 CCCCGCGCCGGCGCGCCCTCGGG - Exonic
1036967741 8:13319461-13319483 CCCCCCCCCGCCCCGCCAGCAGG - Intronic
1037305152 8:17497032-17497054 CCGCGCCCCGCCCCCGCCCCGGG + Intergenic
1037575276 8:20197187-20197209 GCGCGCGCCTCCCAGCACGCTGG + Intergenic
1037901034 8:22689973-22689995 TCGCGCGCATCCCCGCACGCAGG + Exonic
1037903828 8:22703771-22703793 CCCCCCGCCGCCCGGGCCGCGGG + Intergenic
1038002323 8:23402967-23402989 CCCCGCTCCGCCCCGCACTCCGG + Intronic
1038267122 8:26046030-26046052 GCTCGCGCCCGCCCGCCCGCGGG - Intergenic
1038726068 8:30083287-30083309 CCTGTCGCCGCCGCGCCCGCGGG + Intergenic
1039542334 8:38382325-38382347 CCGCGGGCCGCGGCGCCTGCCGG + Intergenic
1040495399 8:47961026-47961048 CCGCGCCACGCCCTCCCCGCCGG - Exonic
1041166922 8:55101172-55101194 CCGCGCCCCGCGCCGCCGCCAGG + Intergenic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1043542584 8:81280431-81280453 CCGGTCCCCGCCCCGCCCGCCGG - Exonic
1045815085 8:106269979-106270001 CCGCGCGCGGCCCCTCTGGCTGG - Intergenic
1046659958 8:116938444-116938466 TCGCGCGCTGCACCGCCCACTGG - Exonic
1046934566 8:119873893-119873915 CTGCGCCCCGCCACTCCCGCTGG - Exonic
1049179135 8:141212144-141212166 CCGCCCGCCCACCCGCCCACTGG + Intronic
1049419658 8:142511091-142511113 CTGCCCGGCGCCCCTCCCGCCGG - Intronic
1049583469 8:143422804-143422826 CGGCGCTCCTCCCCGGCCGCGGG + Intronic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049608600 8:143541481-143541503 GCCCGCTCCGCCCCGCCCGCGGG - Intergenic
1049693709 8:143973605-143973627 CCCGGCCCCGCCCCGCCCGTGGG - Intronic
1049718218 8:144103722-144103744 GCCGCCGCCGCCCCGCCCGCTGG + Exonic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1049802497 8:144524575-144524597 CCGCGCGCAGCCGCGCCTGCTGG - Exonic
1050230897 9:3525507-3525529 GTGGGCGCCGCGCCGCCCGCCGG - Intronic
1051404941 9:16727116-16727138 CCGCCCGCCCGCCGGCCCGCCGG - Intronic
1051404944 9:16727124-16727146 CCGCTCTCCCGCCCGCCCGCCGG - Intronic
1052358602 9:27529783-27529805 CAGCGCGCCGCGCAGCCGGCCGG + Intergenic
1053001224 9:34578154-34578176 CCCCTCGCCCACCCGCCCGCCGG - Intronic
1053003437 9:34590125-34590147 TCACGCGCAGCCCCGGCCGCGGG + Intronic
1053066428 9:35072372-35072394 CCGCGGGCCGCCACAGCCGCCGG - Exonic
1053163462 9:35829211-35829233 CGGCGTGACGCCCCGCCCCCCGG - Intronic
1054274207 9:63052593-63052615 CCGCCCCCCCCCCCGCCCCCGGG + Intergenic
1054434240 9:65196691-65196713 CCGCCCCCCCCCCCGCCCCCGGG - Intergenic
1055030639 9:71768976-71768998 CCCCGCCCGGCCCCTCCCGCCGG + Intronic
1055757556 9:79572420-79572442 CTCCGCGCCCCACCGCCCGCCGG - Intronic
1056732494 9:89178176-89178198 CCGCGCGCCCGCCCGCTCCCGGG + Exonic
1057313447 9:93955237-93955259 CCGCGCGCCGCCCCGAGCTGCGG - Exonic
1057347012 9:94259984-94260006 CCGCGCCCCACCCCAGCCGCCGG + Intronic
1057786073 9:98088047-98088069 CAGCGCGGCGCCCCGCCCCCGGG + Intronic
1058908259 9:109498365-109498387 CCGCCCCCCGCCCGGCGCGCGGG - Intergenic
1059208453 9:112487388-112487410 CCCCGGGCCGCCCCGCCGCCCGG + Intronic
1059309115 9:113376592-113376614 CCCCGCCCCACCCCGCCCCCCGG + Intronic
1059800454 9:117745070-117745092 CCGCGCGCTCGCTCGCCCGCAGG + Intergenic
1060087350 9:120714485-120714507 CCGCGCTGGGGCCCGCCCGCGGG - Intergenic
1060700556 9:125746815-125746837 CCGCCCGGCGCGCGGCCCGCCGG + Intergenic
1060897021 9:127224897-127224919 CCACGCCCCGCCCCGCGCTCCGG - Intronic
1061127964 9:128688956-128688978 CCGTGCGACGCCCCGCCCACCGG + Intronic
1061453420 9:130681221-130681243 CCCCGCCCCGCCCCGCCCCGCGG + Intronic
1061693704 9:132355263-132355285 CCCGGAGCCGCCCCACCCGCAGG - Intergenic
1061808501 9:133149268-133149290 CCCCGCCCCAGCCCGCCCGCAGG + Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062359858 9:136182575-136182597 CCTCGGGCCGCCCCGCCCAGAGG + Intergenic
1203467875 Un_GL000220v1:104465-104487 CCACGGGCCGCCCTGCCAGCCGG + Intergenic
1203469158 Un_GL000220v1:108669-108691 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
1203475696 Un_GL000220v1:148437-148459 CCACGGGCCGCCCTGCCAGCCGG + Intergenic
1203476979 Un_GL000220v1:152641-152663 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
1185471535 X:386725-386747 CCGCGCCCCGCCCCGCCCCGGGG + Intronic
1187281445 X:17860943-17860965 CCGGGCGCCGTCCTGCCCCCGGG + Intronic
1187915549 X:24149802-24149824 CCGGGTGCCGCCGCGGCCGCGGG + Intronic
1190385467 X:49879436-49879458 CCCCGCGCCGCCACGCCCAGTGG + Intergenic
1190708237 X:53048382-53048404 CCGCTCCCCGCCCCGCCCCAGGG + Intergenic
1195108498 X:101623206-101623228 CCGCAGGCCGGCCCGCCCTCAGG - Exonic
1196124329 X:112082932-112082954 CCCCGCCCCGCCCCGCCGCCAGG - Intergenic
1197415269 X:126165982-126166004 CCACGCGCCGCCACCGCCGCCGG - Intergenic
1198321361 X:135521416-135521438 CCCCTCGCCGCCCGCCCCGCCGG - Intronic
1198398985 X:136251445-136251467 CCCCGCCCCGCCCCGCCCACCGG - Exonic
1198767146 X:140091500-140091522 GCACGCCCCGCCCCGCCCGCCGG - Intergenic
1198767163 X:140091576-140091598 CCGCGCGCCCGCCCGCCCGCAGG + Intergenic
1200100786 X:153688420-153688442 CCGCCCGCCGCCCCGTCCCCCGG + Exonic
1200128909 X:153830643-153830665 CCGCGCGCCTCCCCGCCCGCGGG + Intergenic
1200216742 X:154371464-154371486 CCCCACCCCGCCCCGCCCGTTGG + Intronic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic