ID: 1017499795

View in Genome Browser
Species Human (GRCh38)
Location 6:155013172-155013194
Sequence CAGCTGTACTACAGGAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017499795_1017499801 -2 Left 1017499795 6:155013172-155013194 CCATGGCTCCTGTAGTACAGCTG 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1017499801 6:155013193-155013215 TGAGGTTTGGGGTCTACAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 178
1017499795_1017499802 19 Left 1017499795 6:155013172-155013194 CCATGGCTCCTGTAGTACAGCTG 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1017499802 6:155013214-155013236 GGCTTAGTCTGTGCTCCTGCAGG 0: 1
1: 0
2: 0
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017499795 Original CRISPR CAGCTGTACTACAGGAGCCA TGG (reversed) Intronic
900659022 1:3773705-3773727 CAGCTGGGGTCCAGGAGCCAGGG - Intronic
900695946 1:4010530-4010552 CTGCTGAACCACAGCAGCCAGGG - Intergenic
900810313 1:4796840-4796862 CTGCTGTACTGCAGGAGGGAAGG + Intergenic
901238339 1:7679414-7679436 CAGCTGTACCCCAGAAGCTACGG + Intronic
901537608 1:9892712-9892734 CATCTGTGCTACAGAGGCCAGGG + Intronic
902918989 1:19655501-19655523 CTGCTGGAATACAGGAGCCTGGG - Intronic
903354610 1:22738898-22738920 CTGCTAGACTACAGGACCCAGGG - Intronic
903602916 1:24555596-24555618 CAGCTGTATCCCAGGAGCCCAGG - Intergenic
905425921 1:37884604-37884626 CTGCTATACTATAGCAGCCAGGG + Intronic
905920173 1:41714057-41714079 CAGCTGGACTACAGGGGCCCGGG + Intronic
906117001 1:43363751-43363773 CAGCTGCTCTACAGGGACCACGG - Exonic
907499063 1:54865259-54865281 CAGCTGGCCTGGAGGAGCCAGGG + Intronic
907716137 1:56927987-56928009 CAGCTGAATTGCAGGGGCCATGG + Intergenic
909359435 1:74743888-74743910 CAGATGTCCTACAGGCTCCAGGG - Intronic
914932305 1:151946029-151946051 CTGATGTACTGCAGGAACCAAGG - Intergenic
921336614 1:214093183-214093205 CTGCTGTACTGGAGGGGCCAAGG - Intergenic
922022678 1:221720123-221720145 AAGCTATGCTACAGGAACCAGGG - Intronic
1063658137 10:8011948-8011970 CAGCTGTATCACATGAGCCCAGG + Intronic
1067287739 10:44919816-44919838 CAGCTGATATACATGAGCCAGGG - Intronic
1068489477 10:57705207-57705229 TAGCTGTACTACAGAAAGCATGG - Intergenic
1069307166 10:66985302-66985324 ATTCTGTACTACAAGAGCCAGGG + Intronic
1070973534 10:80586845-80586867 CAGCTGCACTCCTGAAGCCAGGG + Intronic
1072630090 10:97139823-97139845 CAGCTGTTCAGCTGGAGCCAAGG - Intronic
1076511561 10:131017830-131017852 CAGCTGCACGACAGGAGCTGTGG - Intergenic
1076715463 10:132361796-132361818 CTGGTGACCTACAGGAGCCATGG - Intronic
1077849970 11:6066807-6066829 CAGCTGGACTTCAGGGTCCAGGG - Intergenic
1079391525 11:20025894-20025916 CAGTTGCAGTACAGGATCCAGGG - Intronic
1081820716 11:45991523-45991545 CAGCTGTATTACAGGTGTGAGGG - Intronic
1083697866 11:64454716-64454738 CAGCTGCACTCCAGTAGCCTGGG - Intergenic
1085126486 11:74005883-74005905 CGGCTGCACCACAGGAGCCATGG - Exonic
1085712363 11:78841661-78841683 CAGCTGTGGGAAAGGAGCCAGGG - Intronic
1091158112 11:133392777-133392799 CAACTGTACTTCAGGAGCCATGG - Intronic
1091318498 11:134632823-134632845 GAGCTGTGAGACAGGAGCCATGG + Intergenic
1091579198 12:1771322-1771344 CCACTGTACTCCAGGAGCCTGGG + Intronic
1091970020 12:4779300-4779322 CACCTGCACCACAGGATCCATGG - Intronic
1092268120 12:6999285-6999307 CAGCTGTGATACAGGACTCATGG + Intronic
1092523678 12:9296549-9296571 AAGCTGACCTACAGGATCCACGG - Intergenic
1092543619 12:9435350-9435372 AAGCTGACCTACAGGATCCACGG + Intergenic
1094292025 12:28862249-28862271 GAGCTGTACTCCAGGAAACAGGG - Intergenic
1094319967 12:29173108-29173130 CAGATGTCCTACAGGATCTAGGG - Intronic
1094407557 12:30134199-30134221 TAGCTGGACTACAGGTGTCAGGG + Intergenic
1094509324 12:31086701-31086723 AAGCTGACCTACAGGATCCATGG - Intronic
1095318020 12:40790265-40790287 CAGATGAACTTCAGGAGCCAGGG + Intronic
1095743598 12:45633394-45633416 CATCTGGACTAGAGAAGCCAAGG + Intergenic
1096119922 12:49081918-49081940 CAGATGAACTATAAGAGCCATGG + Intergenic
1101360512 12:104021736-104021758 CAGCTGGAGTGCAGCAGCCATGG - Intronic
1103288550 12:119824836-119824858 CCGCTGTACTACAGCAGCCTGGG - Intronic
1105002769 12:132702134-132702156 CAGCTGTAATTCATGAGCCCAGG - Intronic
1106114820 13:26808261-26808283 GAGCTGTACTCCAGGTGCTATGG - Intergenic
1108061320 13:46536454-46536476 CAGCTGTCCTATTGGAGCTAAGG - Intergenic
1108106918 13:47020635-47020657 CAGCTGGCCTCCAGGAGCTAAGG + Intergenic
1109453248 13:62546493-62546515 CAGGTGCAATACATGAGCCAGGG + Intergenic
1111817573 13:93173084-93173106 CTGCTGTACTATAGGGGCCAAGG - Intergenic
1116592103 14:46790362-46790384 CACATGTACTACAGGTGCTATGG + Intergenic
1119461627 14:74809558-74809580 CAGCTGTAGAACAGGAACGATGG + Exonic
1122117064 14:99533080-99533102 CAGCAGAACCAGAGGAGCCACGG - Intronic
1123106949 14:105846130-105846152 CAGCTGCCCTGCAGGGGCCATGG + Intergenic
1129599604 15:76990909-76990931 AAGCAGGACCACAGGAGCCAAGG - Intergenic
1130563631 15:84977552-84977574 CAGCTGAACTACAAAAACCAAGG + Intergenic
1132089760 15:98938570-98938592 CAGCTGGACTTCAGTTGCCAAGG + Intronic
1132342669 15:101088141-101088163 GAACTGTACTTCAGGAGCCAGGG - Intergenic
1134240005 16:12498969-12498991 CAGCTGTCCAAAAGGAGCTATGG - Intronic
1134346159 16:13393686-13393708 GAGCTGTACTACCTAAGCCAAGG - Intergenic
1135247657 16:20870883-20870905 CAGCTTTTCTACAGCTGCCAGGG + Intronic
1138354825 16:56368813-56368835 CTGCTGTCATACAGCAGCCATGG - Intronic
1139106824 16:63835984-63836006 CTGCTATGCTAGAGGAGCCAAGG - Intergenic
1140204718 16:72924422-72924444 CAGGTGTATAACAGGAGCCTGGG - Intronic
1141791770 16:86241806-86241828 CCGCTGTGCTCCGGGAGCCAGGG + Intergenic
1142746772 17:1963315-1963337 CAGCTGGACTCCCAGAGCCACGG - Intronic
1143607212 17:7994400-7994422 CTGCTGGAGGACAGGAGCCAAGG - Intergenic
1146439555 17:32882109-32882131 CAGCTGGACCACAGGAACAATGG - Intergenic
1147562809 17:41519453-41519475 CAGGTGGAGGACAGGAGCCAGGG + Exonic
1147795659 17:43040654-43040676 CAGATGGTCTACAGGACCCAGGG + Intergenic
1151645753 17:75430340-75430362 AAGCTGGACTCCAGCAGCCAGGG + Intergenic
1152283250 17:79397707-79397729 CAGCTGCATCACAGGAGTCACGG + Intronic
1152762940 17:82119030-82119052 TAGTTGTTCTCCAGGAGCCAAGG - Intronic
1156125037 18:33894043-33894065 CATCTGTACTAATGGAGCAAAGG - Intronic
1156389163 18:36634617-36634639 CAGCCTTCCTCCAGGAGCCAGGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1160096289 18:75876668-75876690 CATCTGGTCTACAGCAGCCATGG - Intergenic
927286339 2:21360829-21360851 CAGCTGCACACCAGGTGCCAGGG - Intergenic
931630449 2:64293823-64293845 CAGCTGTACTCCAGGCGACTCGG - Intergenic
932798135 2:74715524-74715546 CAGCCGTACTGCCGGCGCCAGGG + Intergenic
933832638 2:86223231-86223253 CAGCAGGGCTACAGCAGCCAGGG + Intronic
939249833 2:139669124-139669146 CAGCTGTACCATAGGTACCAGGG - Intergenic
947279458 2:228433653-228433675 CAGCTGTATTATACCAGCCATGG + Intergenic
948991335 2:241555993-241556015 CAGAGGTACTTCAGGAACCATGG + Intergenic
948996535 2:241583027-241583049 GGACTGTACTCCAGGAGCCAAGG - Intergenic
1169112381 20:3042636-3042658 CACCTGGACTTCAGCAGCCAAGG - Intergenic
1169411231 20:5372138-5372160 CTTCTGTACTACAGGATCCCAGG - Intergenic
1170494903 20:16915116-16915138 CAGCTGTACCTCAGGAGGCAGGG - Intergenic
1171019091 20:21568803-21568825 CAGAAGTACTGGAGGAGCCATGG - Intergenic
1172672554 20:36644375-36644397 AAGGTGCACTACAGGCGCCACGG + Intronic
1175340392 20:58225700-58225722 CAGCTGTACTGCAGGGGCTGGGG - Intronic
1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG + Intergenic
1176824053 21:13685186-13685208 CAGGGGTACTACAAGAGCCTGGG + Intergenic
1182718179 22:32376680-32376702 CAGCAGGAGGACAGGAGCCATGG - Intronic
1184046453 22:41975499-41975521 CATCTGCACTTCAGGAGACAGGG - Intergenic
1185094795 22:48800386-48800408 CAGCTGTGATTCAGGAGCCAGGG - Intronic
949881002 3:8660611-8660633 CAGCTGTACTTAAGAAGCCAGGG - Intronic
953341674 3:42139837-42139859 CAGCTGAACCACAGTAGCCTGGG - Intronic
953420222 3:42748469-42748491 CAGCTGAACTTCAGGAAGCAGGG + Intronic
958813704 3:98892637-98892659 CAGCTAGACTTCAGGAACCAAGG - Intronic
961552390 3:127676801-127676823 AAGCTGTTCTACAGGCCCCAGGG - Intronic
962471675 3:135714669-135714691 CAGCTTTTCTCCAGGAGCCCAGG + Intergenic
964418139 3:156471607-156471629 CAGCTGCCCTTCTGGAGCCAAGG + Intronic
967381792 3:188867136-188867158 CAGCTGTAATACAGGAAAGAAGG - Intronic
968948920 4:3680204-3680226 CAGCTGTCCTCCCGGAGGCACGG - Intergenic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
977953808 4:103003724-103003746 CTGCTGTGCTGCAGGAGCCAAGG - Intronic
978523970 4:109645791-109645813 CCGCTGTACTGCAGGAGGGAAGG - Intronic
979254974 4:118599675-118599697 CAGGTGGACTACTGGAGGCAAGG + Intergenic
982961675 4:161846004-161846026 CCACTGTACTCCAGGAGCCTGGG + Intronic
983812583 4:172081760-172081782 CAGCCATACTACAGGAACCCTGG + Intronic
984153013 4:176157977-176157999 TAGCTGGAGTGCAGGAGCCAGGG + Intronic
991454882 5:66792292-66792314 CAGCTCTACGACAGGGGCAAGGG - Intronic
992965664 5:81997272-81997294 CTGCTGCACTGGAGGAGCCAAGG - Intronic
994729211 5:103472092-103472114 CAGCAGTCCTACATGTGCCATGG + Intergenic
995488074 5:112659091-112659113 CTGCTGCACTGGAGGAGCCAAGG - Intergenic
995955041 5:117767376-117767398 CAAATGTTCTACAGCAGCCAGGG - Intergenic
996118679 5:119647193-119647215 CACTGGTATTACAGGAGCCAAGG + Intergenic
997319163 5:132963601-132963623 CAGCTGGACTCCTGCAGCCAGGG + Exonic
998514358 5:142739183-142739205 CCACTGTAGTACAGGCGCCACGG - Intergenic
1000992132 5:167922271-167922293 CAGGTGCACTTCAAGAGCCAGGG - Intronic
1004160192 6:13206006-13206028 CAGCTGCAGTACGGCAGCCACGG + Exonic
1005175102 6:23035774-23035796 CAGGTGTCCTGCAGGATCCAAGG + Intergenic
1007585658 6:42987672-42987694 CACCTGTTCTGCAGGAGCCAGGG + Intronic
1008538335 6:52525163-52525185 CAGCTGTGCTACTGACGCCAGGG + Intronic
1010681962 6:78808297-78808319 CTGCTGTACTGAAGGGGCCAAGG + Intergenic
1017499795 6:155013172-155013194 CAGCTGTACTACAGGAGCCATGG - Intronic
1017958300 6:159198562-159198584 CAGCTGGACTTGGGGAGCCAAGG - Intronic
1018276886 6:162142269-162142291 CATCTGTGCTGCATGAGCCAGGG - Intronic
1019682600 7:2359915-2359937 CAACTGAACTGCAGGAGACAGGG - Intronic
1020907390 7:14080431-14080453 CAGGAGAACTCCAGGAGCCAAGG - Intergenic
1021636234 7:22696795-22696817 CAGAGGTACTTCAGAAGCCAAGG - Intergenic
1028242904 7:88443205-88443227 CAGCTGTGCACCAGGAACCAGGG - Intergenic
1029992329 7:104973682-104973704 CAGCTATATTACTGGAGCCTTGG - Intergenic
1031423682 7:121580357-121580379 AATCTGTACTACAGGAGTTAGGG - Intergenic
1032947214 7:136868697-136868719 CTGCTGTACTAAAGGCGCCAGGG + Exonic
1033175314 7:139118434-139118456 CAGGTGTTCTACAGGAGATATGG + Intergenic
1033290616 7:140079638-140079660 CAGGTGGACTGCAGGAACCAAGG + Intergenic
1034990081 7:155542620-155542642 CGGCTGCACCACAGGAGCCCCGG - Intergenic
1037686474 8:21143847-21143869 CAGCTGTAAAACAAAAGCCAAGG + Intergenic
1038995728 8:32920847-32920869 CAATTGTACTACAGATGCCAGGG + Intergenic
1039299152 8:36190858-36190880 GAGCTGCACTCCAGGAACCAGGG - Intergenic
1040485087 8:47863427-47863449 CTTCTGTAATACACGAGCCATGG + Exonic
1047215391 8:122872029-122872051 CAGCAGGACTGCAGGGGCCAGGG - Intronic
1047810689 8:128405577-128405599 AAGCTGGACTTCAGGAGCCTGGG + Intergenic
1049124982 8:140778623-140778645 CAGTTGTGCTACAGCAGACATGG + Intronic
1049612681 8:143562722-143562744 CAGCTGTTCCCCAGGAGCCCGGG - Exonic
1056139142 9:83657573-83657595 CCACTGCACTACAGGAACCAGGG - Intergenic
1057249561 9:93489472-93489494 CAGCTGTCCTACTGGAACCTGGG - Intronic
1058833140 9:108837347-108837369 GAGCTGTACACCAGGAGCCAGGG - Intergenic
1185745209 X:2567085-2567107 CAGCTGCACTGCAGGAGTGAAGG - Intergenic
1186464637 X:9775369-9775391 GAGGTGAACAACAGGAGCCACGG + Intronic
1186771705 X:12824966-12824988 TAGCTGAACTACAGGGGACAGGG + Intergenic
1190110974 X:47588676-47588698 CAGATGTTCTACAAGAGCAATGG - Intronic
1192183344 X:68929824-68929846 CAGCTTGACTCCAGGAGCCAGGG + Intergenic
1195620806 X:106952751-106952773 AAGCTGAACTACATGACCCAAGG + Intronic
1198506114 X:137302921-137302943 CAGCTGGACCACAGGAAGCAGGG - Intergenic
1200054090 X:153449670-153449692 CATCTGGAGTACAGGGGCCAAGG - Intronic
1200873503 Y:8127932-8127954 CAGCTGCACTCCTGAAGCCAGGG - Intergenic
1201264728 Y:12194672-12194694 CAGCTGAAGGACTGGAGCCAGGG - Intergenic
1201787126 Y:17796973-17796995 CAGCAGTACTCAAGAAGCCAAGG - Intergenic
1201814427 Y:18109015-18109037 CAGCAGTACTCAAGAAGCCAAGG + Intergenic
1202198131 Y:22317367-22317389 CAGCTGGACTGCTTGAGCCACGG - Intronic