ID: 1017501668

View in Genome Browser
Species Human (GRCh38)
Location 6:155031425-155031447
Sequence GAAAATGAAGAGATGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 994
Summary {0: 1, 1: 1, 2: 6, 3: 95, 4: 891}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017501668 Original CRISPR GAAAATGAAGAGATGAGGCT GGG Intronic
900199025 1:1394452-1394474 GAAAATTAACTGTTGAGGCTGGG + Intronic
900253851 1:1686486-1686508 AAAAATGAAAAAAAGAGGCTGGG + Intronic
900262848 1:1741251-1741273 AAAAATGAAAAAAAGAGGCTGGG + Intronic
901062482 1:6478462-6478484 TAAAATGGAGAAATAAGGCTGGG - Intronic
901196223 1:7441487-7441509 GAAAATGCAGAGCCGAGGCCAGG + Intronic
901252006 1:7785959-7785981 CAAAATGCAGTAATGAGGCTGGG + Intronic
901574652 1:10191196-10191218 GTAAAGGAATATATGAGGCTGGG + Intergenic
901673855 1:10871531-10871553 GAAAAAGAAAAGAAAAGGCTGGG - Intergenic
901948416 1:12722034-12722056 GAAAACGAAGAGATGAAGCCGGG + Intronic
902145463 1:14395171-14395193 GAAAAGGAAGAAAAGAGGCAGGG + Intergenic
902494595 1:16861460-16861482 GAAAATGAAGAAATAAAGGTTGG - Intronic
902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG + Intergenic
902656794 1:17874625-17874647 GTAACTGAAGAGATGACGCAAGG + Intergenic
902669816 1:17965294-17965316 GAAAATGATGTCATGAGGCTGGG + Intergenic
902755227 1:18545033-18545055 GAAAACGAAGCAGTGAGGCTTGG + Intergenic
902770267 1:18641688-18641710 GACATTGAAAAGACGAGGCTGGG + Intronic
903392007 1:22971282-22971304 GAGACAGACGAGATGAGGCTAGG - Intergenic
903695314 1:25201892-25201914 GTAAATGAATACCTGAGGCTGGG - Intergenic
903890055 1:26563520-26563542 AAAAAAGAAGAAAAGAGGCTGGG - Intronic
904088254 1:27926272-27926294 GAAAGTGAAAAGATCAGGCTGGG - Intergenic
904247368 1:29197284-29197306 GCAGATGAAGAGATGAGGTCTGG - Intronic
904673324 1:32181824-32181846 GAAAATGGAGACGGGAGGCTAGG + Intronic
904849058 1:33443511-33443533 GAAGATGATGAGTTCAGGCTGGG + Intergenic
904912831 1:33948166-33948188 GAAAATTAATGGATGAGGCAGGG - Intronic
904970072 1:34412610-34412632 CAACATAAAGAGAGGAGGCTGGG - Intergenic
905135421 1:35795576-35795598 GAAAAAGAACAGTTGAGGCCGGG + Intergenic
905164688 1:36072830-36072852 GAAAATGGGGAGACGACGCTAGG + Intergenic
905654791 1:39679181-39679203 GAAAAGAAAGAGAAGAAGCTGGG - Exonic
905809726 1:40903117-40903139 AAAAATCAAGAGATGAAACTTGG - Intergenic
906039267 1:42774934-42774956 GAAAATGTAGACATGTGGATTGG + Intronic
906247547 1:44287635-44287657 GAACATGAGGAAATGAGGCAAGG + Intronic
906658670 1:47567096-47567118 GTCAATGAAGAGACTAGGCTGGG - Intergenic
906793972 1:48682002-48682024 TAAAATGAGGTCATGAGGCTGGG + Intronic
906931836 1:50177623-50177645 GAAGGTGAAAAGATGAGGATGGG + Intronic
906971213 1:50516279-50516301 GAAGAATAAGAGATGAGGATAGG - Intronic
906972799 1:50534567-50534589 AAAAATCAACAGAAGAGGCTGGG - Intronic
906989886 1:50726399-50726421 AAAAATGAAGAAAATAGGCTGGG + Intronic
907049262 1:51318561-51318583 GAAATTGAAGAGGTCAGGCCTGG + Intronic
907279602 1:53338240-53338262 GACAAAGAAGAGATTAGGCATGG - Intergenic
907673565 1:56498448-56498470 GAAAATGTGGAGCTGGGGCTGGG - Intronic
908029147 1:59981579-59981601 ATGAATGAAGAGGTGAGGCTTGG - Intergenic
908087527 1:60652274-60652296 GAAGAGGAAGACATGAGGCATGG - Intergenic
908123039 1:61003865-61003887 GAGAATGAAAAGATGAAGCGAGG - Intronic
908286976 1:62616563-62616585 GAAAATGAAGTAAGAAGGCTTGG + Intronic
908501554 1:64747808-64747830 TAAAATAAAGAAATGAGGCCAGG - Intronic
908526088 1:64989029-64989051 TAAAATACAGAGATAAGGCTGGG + Intergenic
908734730 1:67264003-67264025 CAACATGAAAAGCTGAGGCTAGG + Intergenic
908829363 1:68164009-68164031 GAAAAGGAAGAGATGATCCATGG + Intronic
909609674 1:77539289-77539311 GAAGTTGAAGAGATGAGCCAGGG - Intronic
909615911 1:77607628-77607650 GAAAATACAGAGAGGAGGCCGGG + Intronic
909649074 1:77953192-77953214 TAAAATTAACAGGTGAGGCTGGG + Intronic
910263200 1:85311741-85311763 TAAAATTAATAAATGAGGCTGGG - Intergenic
910292668 1:85614618-85614640 GAAAATGAAGATGTCAGACTAGG - Intergenic
910718360 1:90257209-90257231 GATACTGAAGAGATGAGGTTGGG + Intergenic
910719312 1:90268436-90268458 GGAAAAGAACAGATAAGGCTTGG + Intergenic
910863513 1:91766331-91766353 TAAAATGTAGAAATTAGGCTAGG - Intronic
911204609 1:95079720-95079742 GAAAATGAAGACAGGAGGGTGGG + Intergenic
911414526 1:97555234-97555256 GAAAATGAAGAGGTGAAGAGGGG - Intronic
911451144 1:98062625-98062647 TAAAATGAAGGAATGAGGCCAGG - Intergenic
911622259 1:100078772-100078794 GAAAATTTACTGATGAGGCTGGG + Intronic
911675550 1:100654750-100654772 GAGTGTTAAGAGATGAGGCTGGG + Intergenic
912423609 1:109566032-109566054 TAAAATGAAGTGAGGTGGCTGGG + Intronic
912549436 1:110475504-110475526 GAAGCTGCAGAGATGAGGCTGGG + Intergenic
913420532 1:118663147-118663169 GAAAATAAACAGATGAATCTAGG + Intergenic
914782844 1:150801412-150801434 AAAAAAGAAGAGATGTGGCCAGG - Intronic
914819094 1:151085948-151085970 AAAAAGGTAGAGAAGAGGCTGGG + Intronic
914876816 1:151518480-151518502 GAAGATGAAGAAATGAGTTTAGG - Intronic
915014548 1:152720687-152720709 GAAAATGGAGATTTGAGGGTTGG + Intergenic
915150015 1:153823078-153823100 TAAAATTAAGAAATGAGGCAGGG - Intronic
915174707 1:154005144-154005166 GAAAAAGAAAAGAGGAGGCCGGG - Intronic
915394701 1:155574059-155574081 CAAAAAGAAGACATTAGGCTGGG + Intergenic
916089186 1:161293944-161293966 AAAAAGGAAGAAATTAGGCTGGG + Intergenic
916488228 1:165278326-165278348 GAAAATCAAGAGCTGTGTCTGGG + Intronic
916811558 1:168309999-168310021 CAAAATTAAAAGATGAGGCTTGG + Intronic
917061839 1:171049576-171049598 GAAAATGAAGAAATGGGGGGTGG - Intronic
917367348 1:174247199-174247221 GAAAAAGAAGAGATGAGAAAGGG + Intronic
917488293 1:175475247-175475269 GAGAATGGGGAGATGACGCTAGG - Intronic
917551673 1:176038522-176038544 GTAAAAGAAGAGATAGGGCTGGG + Intronic
917839606 1:178967012-178967034 GAAAATAGAGAAATGTGGCTGGG + Intergenic
918198823 1:182247809-182247831 GAAAAAAAAGAGAGGAAGCTGGG + Intergenic
919190309 1:194208398-194208420 TCAAAAGAAGATATGAGGCTGGG + Intergenic
919311666 1:195917470-195917492 GAGAGTGAAGAGTTGAGGCTTGG + Intergenic
919682496 1:200449822-200449844 GAAAATGAGGGGATGAGGTTAGG - Intergenic
919714769 1:200764806-200764828 TAAAAAGAAAAGATGTGGCTGGG + Intronic
919721406 1:200840557-200840579 GAAAGTGAAGAAAAGAGGCTGGG - Intronic
919902282 1:202052953-202052975 CAAAATGCTGGGATGAGGCTGGG - Intergenic
920121728 1:203663897-203663919 GAAATTGGAGAGAAGAGGCTGGG - Intronic
920130103 1:203725442-203725464 TAAAAAGGAGAGCTGAGGCTGGG - Intronic
920320868 1:205121521-205121543 GAATTTGAAGAAGTGAGGCTTGG - Intronic
920520191 1:206618682-206618704 GAAAATGAAAAGATTAGCCATGG + Intergenic
920575707 1:207058786-207058808 TAAAATGAAGACTTGAGGCTGGG - Intronic
921113974 1:212069148-212069170 GAAAAAAAAAAGGTGAGGCTGGG - Intronic
921350999 1:214234507-214234529 AAAATTGAAAAGATGAGGCAAGG + Intergenic
921870336 1:220132819-220132841 GAAAAAGGAGACATGGGGCTGGG - Intronic
922052162 1:222002608-222002630 GAAAATTATGATATGTGGCTAGG - Intergenic
922076202 1:222247411-222247433 GAAAACAAAGGGATGAGGTTAGG + Intergenic
922378010 1:224988928-224988950 AAAAAAGAAGAGTTCAGGCTGGG - Intronic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
922502557 1:226108144-226108166 GAAAATGAAAATAAGAAGCTAGG - Intergenic
922533470 1:226362435-226362457 TAAAATGAGCACATGAGGCTGGG - Intronic
922884762 1:229009644-229009666 AAAAAAGAAGAAATGAGGCTGGG + Intergenic
923095914 1:230775034-230775056 AAAAATGGAGAGAGAAGGCTGGG - Intronic
923748399 1:236724510-236724532 GAAGAGGAAGGGAGGAGGCTTGG + Intronic
923927170 1:238644681-238644703 GAATAAGAAGACATGAGGCCGGG - Intergenic
924240118 1:242032274-242032296 GAAAATGAAGAGATGCGCTAGGG + Intergenic
924514345 1:244753634-244753656 AAAAATGGAGAGAGGAGGCCAGG - Intergenic
1062942290 10:1433130-1433152 GAAAATGAAGTGAAGAGAGTAGG + Intronic
1063042384 10:2356553-2356575 GGAACTGAAGAGATGAAACTGGG - Intergenic
1063102895 10:2965936-2965958 GAAAAGGAAAAAAAGAGGCTGGG + Intergenic
1064136718 10:12757266-12757288 TAAAATGAATAAATGAGGCCGGG - Intronic
1064218882 10:13422547-13422569 GTAAAGTAAGAGATGAGCCTGGG + Intergenic
1064615008 10:17144142-17144164 GAAAAAGAAGAGCAGAGGCTTGG - Intronic
1064653550 10:17534337-17534359 AAAAATATACAGATGAGGCTGGG + Intergenic
1064669433 10:17695465-17695487 GAAAATGAATAGATTAAACTAGG - Intronic
1065145681 10:22765447-22765469 TCAAATGAAGAAAGGAGGCTGGG + Intergenic
1065217399 10:23462491-23462513 GAAAATGAGGAGATTAATCTGGG + Intergenic
1065345453 10:24743850-24743872 GAAAATGAAAAGAGCAGGCTGGG - Intergenic
1065675236 10:28166700-28166722 AAAAATTAAAAGATAAGGCTGGG - Intronic
1065748238 10:28861332-28861354 CAAAAGGAAGAGATGAGTCTTGG - Intronic
1065762940 10:28999876-28999898 GGAAATAAAGAGATCAGTCTTGG + Intergenic
1065920600 10:30389192-30389214 GAAAAAGAAGATATGGGGCCAGG + Intergenic
1066208204 10:33210421-33210443 TAAAATGAAGAGATGAGCCTGGG - Intronic
1066224017 10:33364979-33365001 GAAAATGAAAGGGAGAGGCTTGG - Intergenic
1067215841 10:44302087-44302109 AGAAATGAAGAGATGGGGATGGG - Intergenic
1067222554 10:44354300-44354322 GAAAATGATGAGAGGAGCCCAGG + Intergenic
1067572133 10:47379459-47379481 GAAAATGAGGAGATGAAACTAGG + Intronic
1067575504 10:47406106-47406128 GAAAAGGAAGAGAAGAGCCAAGG + Intergenic
1067852687 10:49764332-49764354 GAAAAAAAAGAGGTGAGGTTGGG - Intergenic
1067930240 10:50553523-50553545 GAATATGATGAGATGTAGCTTGG - Intronic
1067970390 10:50963537-50963559 GGAAAGGATGAAATGAGGCTGGG + Intergenic
1068170081 10:53381767-53381789 TAAAATGCAGAGCTGAGGCCGGG - Intergenic
1068634902 10:59337973-59337995 GAAAATGAAAAGTTCAGGCTGGG - Intronic
1068787527 10:60992346-60992368 GAAAATGAAGATAATAGGATTGG - Intronic
1069054675 10:63832223-63832245 GAGAAGAAAGATATGAGGCTGGG + Intergenic
1069857329 10:71448539-71448561 CAAAAAGAAGAGAAGAGGCTGGG - Intronic
1070509173 10:77144876-77144898 GGAGATGAGGAAATGAGGCTAGG - Intronic
1070920368 10:80181153-80181175 TAAAATGACAAGATGAGGCCAGG + Intronic
1071148077 10:82598752-82598774 GAAAATGATGAGAAGAGGCCGGG + Intronic
1071438756 10:85670792-85670814 GAAAATGAAGAGGTGAACCATGG - Intronic
1072455036 10:95568041-95568063 GAGACTGAAGAGATGAGGAGAGG + Intergenic
1072837862 10:98735977-98735999 AAAAATGAGGACATGAGGTTTGG + Intronic
1072886955 10:99285629-99285651 GAAAATATATAAATGAGGCTGGG + Intergenic
1072953007 10:99864698-99864720 TAAAATAAATAGATGATGCTGGG - Intergenic
1072978825 10:100082143-100082165 GAAAAGGAAAAGATTAGCCTCGG + Intergenic
1073092752 10:100956627-100956649 GAAAAAGAACATATAAGGCTAGG + Intronic
1073113208 10:101074969-101074991 AAAACTTAAAAGATGAGGCTGGG - Intergenic
1073133193 10:101204152-101204174 GAAAATGAAAAGGTAAGGCAGGG + Intergenic
1073202967 10:101751009-101751031 TAAAATGAACACAGGAGGCTGGG - Intergenic
1073455817 10:103636111-103636133 GAAAGAGTAGAGATGAAGCTGGG + Intronic
1073549486 10:104384664-104384686 GAAAATGCAGAGAAAAGGTTTGG + Intronic
1074161768 10:110841630-110841652 TAAAAGGAAGAGCAGAGGCTTGG - Intergenic
1074310281 10:112316495-112316517 TAAAATTAACAAATGAGGCTGGG - Intergenic
1075526838 10:123194141-123194163 CCAGATGAAGAGCTGAGGCTCGG - Intergenic
1076769420 10:132654965-132654987 AAAAATGAGGATATTAGGCTGGG + Intronic
1077399052 11:2344177-2344199 TAAAATGAAGACATTAGGGTGGG + Intergenic
1077431824 11:2519457-2519479 AAAAATTAAGACATGAGGCCGGG + Intronic
1077700518 11:4437232-4437254 AATAATGGAGAGCTGAGGCTTGG - Intergenic
1078181219 11:9012813-9012835 AAAAATGGACAGAGGAGGCTGGG - Intergenic
1078183689 11:9033272-9033294 TAAAATGAAGAGAGGAGGTCTGG - Intronic
1078209646 11:9260131-9260153 GGAATTGAAGAGAAGTGGCTAGG - Intronic
1078397404 11:10993284-10993306 GATACAGAAGAAATGAGGCTGGG - Intergenic
1078869317 11:15328824-15328846 GAAAAGGCAGAGTTGAGGCCTGG - Intergenic
1079142332 11:17820206-17820228 GACAATGAAGAGAAGGGGCTTGG - Intronic
1079384446 11:19966465-19966487 GGAAATGAAGAAATGAGGCTAGG - Intronic
1080043254 11:27781907-27781929 CAAGTTGAAGAGATCAGGCTAGG + Intergenic
1080123029 11:28699083-28699105 AAAAATGAAGATCAGAGGCTGGG - Intergenic
1080171340 11:29306649-29306671 GAAAAAGAAGAGATGAGGTTAGG - Intergenic
1080891586 11:36413222-36413244 GAGAGTGAAGAGATGAGGAAAGG - Intronic
1081275941 11:41149208-41149230 TAAAATGAAGGGCTGAGGCCGGG + Intronic
1081865385 11:46356943-46356965 GAAAGAGCAGAGAGGAGGCTGGG + Intronic
1082139861 11:48596050-48596072 AAAATGCAAGAGATGAGGCTTGG - Intergenic
1082714788 11:56598999-56599021 CAAAATGAAGAAATGTAGCTTGG - Intergenic
1082736940 11:56866288-56866310 AAAAATGAAGACATGAGATTTGG + Intergenic
1083181901 11:60992172-60992194 AAAAATAAAAAAATGAGGCTGGG - Intronic
1083941327 11:65897633-65897655 GAAAATGAAGATACTAGGCTGGG - Intronic
1084597462 11:70125547-70125569 AAAAAGAAAGAGAAGAGGCTGGG + Intronic
1084892159 11:72241880-72241902 AGAATTGAAGAAATGAGGCTTGG - Intronic
1085622907 11:78050691-78050713 CAAAATGAAGAGTCAAGGCTTGG + Intronic
1085624007 11:78058143-78058165 AAAAATGAATAAATCAGGCTGGG + Intronic
1085673351 11:78490519-78490541 GAAAAAGAGAAAATGAGGCTGGG + Intronic
1085844308 11:80048323-80048345 GAAGGAGAAGAGATGAGGCATGG + Intergenic
1085882372 11:80483347-80483369 AAAAATGAAGAAACAAGGCTGGG + Intergenic
1086082982 11:82924517-82924539 AAAAATAAACAAATGAGGCTGGG + Intronic
1086218891 11:84417686-84417708 AGAAATGAAGAGCTGAGGATAGG - Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1086918056 11:92554165-92554187 GAAAATGAATGGAGGAGGCCGGG + Intronic
1086966979 11:93038694-93038716 GAAAATGAATAGAGTGGGCTGGG - Intergenic
1087030820 11:93702435-93702457 GAAAAAGTGGAGATGAGGGTGGG - Intronic
1088355361 11:108937975-108937997 TAAAATGCAGAGCTCAGGCTTGG + Intronic
1088649401 11:111944133-111944155 GAAGATGAGGAGATGAGGGTGGG - Intronic
1088927772 11:114319819-114319841 GCAAATGAAGGGATCAGGATGGG - Intergenic
1089031129 11:115330637-115330659 GGGAAGGAAGAGATGAGGGTGGG - Intronic
1089050824 11:115544301-115544323 GTTAATGAAGAGATGGGGCTGGG - Intergenic
1089265610 11:117258360-117258382 GAAAAAGAAAAGACGGGGCTGGG - Intronic
1089293312 11:117451350-117451372 TACAATGGAGAGATGAGGATAGG - Intronic
1090168920 11:124581233-124581255 GAAAAGCAAGAGATGAGGCCTGG + Intergenic
1090578329 11:128132812-128132834 GGAAATGAAGAAATGAGGGCTGG - Intergenic
1090638595 11:128710241-128710263 AAAAATGAAGAGATGAAGAAAGG + Intronic
1091146070 11:133281525-133281547 GTAAAGGAATACATGAGGCTGGG - Intronic
1091898937 12:4127743-4127765 TAAAATGAAGAGATAAGCCATGG - Intergenic
1091951434 12:4596274-4596296 GAACAAGAAGAGGTGTGGCTTGG + Exonic
1092293507 12:7180099-7180121 GAAAATAAAGAAATTAGGCCAGG + Intergenic
1092915898 12:13188721-13188743 GAAATTGCAGATATGAGGATTGG - Intergenic
1093242284 12:16691959-16691981 GGAAAGGAAGAGATGAACCTCGG + Intergenic
1093332758 12:17863166-17863188 GATAATGAGGATATGAGGCATGG - Intergenic
1093456628 12:19371300-19371322 GAAAAGGAAGAAAAAAGGCTGGG - Intronic
1093569769 12:20653639-20653661 GAAAATGCAATGGTGAGGCTGGG - Intronic
1093811154 12:23493473-23493495 GAAAATGTAAAGATAAGTCTGGG - Intergenic
1094280525 12:28732489-28732511 GCATATGAAGAGTTGAGGCCAGG + Intergenic
1094327261 12:29254493-29254515 GAAAATGTATATATCAGGCTGGG - Intronic
1094421537 12:30276764-30276786 TAACATGAGGAGATGAAGCTTGG - Intergenic
1095427659 12:42094360-42094382 AAAAAAAAAAAGATGAGGCTGGG + Intronic
1096058251 12:48673650-48673672 CAAAATTAAGAGATGAGGCCAGG + Intronic
1096074470 12:48794064-48794086 ATAAATGAATAGATGAGGCTGGG + Intergenic
1096114219 12:49045827-49045849 TAAAATAAGGAGATGAAGCTAGG + Intronic
1096162165 12:49387733-49387755 GAACCTGAAGAGATTAGGCCTGG + Intronic
1096617645 12:52843069-52843091 GAAAGAAAAGAGATGAAGCTGGG + Intronic
1096688986 12:53307881-53307903 GAAAGTGATGAGCTGGGGCTGGG + Exonic
1097371932 12:58794557-58794579 GAATATGTAAAGATGAGGCTGGG + Intronic
1097674527 12:62584406-62584428 GAAAAATAAGGCATGAGGCTGGG + Intronic
1097908166 12:64942006-64942028 TAAAATGAAAAAATGAGTCTTGG + Intergenic
1097987544 12:65799852-65799874 GAGAATAAAGAGATGAGACCTGG - Intergenic
1098048085 12:66422958-66422980 GAAAATTAAAACATGGGGCTAGG - Intronic
1098222486 12:68284971-68284993 GAGAATGAACAGGTGGGGCTAGG - Intronic
1098275943 12:68811202-68811224 GAAAATGGACAGATAAGACTAGG - Intronic
1098444381 12:70551189-70551211 AAGAATCAAGAGATGCGGCTGGG - Intronic
1098652179 12:72986314-72986336 GAAATTGAAACCATGAGGCTGGG - Intergenic
1098892550 12:76024115-76024137 GAAAAAGAAGTGCTGAGGCCAGG + Intergenic
1099213959 12:79831284-79831306 GAGATTGAAAAGAGGAGGCTGGG + Intronic
1099319919 12:81133309-81133331 CACAATGAACAGAGGAGGCTTGG - Intronic
1099341915 12:81448236-81448258 GACAATGAGGACATGAGGGTAGG - Intronic
1099639485 12:85267972-85267994 GAAAATCAAGATATTAGGCCAGG - Intergenic
1100375584 12:94013410-94013432 GAGAAAGAAGAGAAGAGGCTGGG + Intergenic
1100664778 12:96738954-96738976 TAAAATGAGGACATTAGGCTGGG - Intronic
1100918248 12:99452993-99453015 AACAAAGAAGAGATGAGGCCGGG + Intronic
1101127637 12:101653906-101653928 TAAAAAGAAGACATGAGGCTGGG + Intronic
1101140507 12:101790859-101790881 GGAAAAGCAGAGGTGAGGCTGGG - Intronic
1101319323 12:103659331-103659353 CCAAATGCAGAGAGGAGGCTGGG + Intronic
1101327786 12:103731856-103731878 GAAATTGAGGATTTGAGGCTGGG + Intronic
1102052107 12:109870168-109870190 GAAAAAGAAGGTATTAGGCTGGG + Intronic
1102052548 12:109873337-109873359 GAAAAGCCAGAGCTGAGGCTGGG + Intronic
1102076977 12:110067485-110067507 GAAAAGGAAGTGAGGAGGGTAGG - Exonic
1102315910 12:111887374-111887396 AAAAATGAGGAGATAAGGCCAGG + Intronic
1102489794 12:113283337-113283359 TAATATGTAGAAATGAGGCTGGG + Intronic
1102506991 12:113389999-113390021 GAAAATGGACAAATGAGGCCAGG - Exonic
1102524355 12:113500635-113500657 GGGAATGGAGAGATCAGGCTCGG + Intergenic
1103728326 12:123010124-123010146 GAACATGGAGAGATGTGGGTGGG - Intronic
1104179881 12:126368890-126368912 GAAAGTGAGGAGTTGTGGCTGGG + Intergenic
1104251856 12:127102182-127102204 AAAATTGTATAGATGAGGCTGGG + Intergenic
1104665652 12:130645728-130645750 GATAAGGAAGAGATCAGGCACGG - Intronic
1105432114 13:20345784-20345806 GAAGATGAAAAACTGAGGCTTGG + Intergenic
1105571572 13:21608017-21608039 GAAAATGAGGAGATGGGTTTTGG + Intergenic
1105714706 13:23051519-23051541 TAAGATGAAGAGATGACGTTGGG - Intergenic
1106019676 13:25902711-25902733 GAGAATGAAGACCTGAGTCTTGG - Intronic
1106663631 13:31828223-31828245 GAAAATGAAAGGATGGGGATTGG + Intergenic
1106965231 13:35056719-35056741 TAATATTAAGAGATGAGGTTAGG + Intronic
1107093581 13:36511060-36511082 AATATTGAAGAGCTGAGGCTAGG - Intergenic
1107098844 13:36566195-36566217 AAAAATAAAGAAATGAGGTTGGG - Intergenic
1107691782 13:42960820-42960842 GAGAATGAAGAGATGATACCAGG - Intronic
1107948329 13:45439922-45439944 GAAAAAGAAAAGAAAAGGCTGGG + Intergenic
1108047424 13:46396406-46396428 TAAAATGAAGAGATTATCCTGGG + Intronic
1108410157 13:50137699-50137721 TAAAATGAAGAGTTGGGGCCAGG - Intronic
1108495261 13:51018589-51018611 GAATATGAAGAGAGGATGATAGG - Intergenic
1108727392 13:53198182-53198204 GAAGAGGAAGACATGAGACTTGG + Intergenic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1109023486 13:57130129-57130151 GAAAATCTAGAGAGTAGGCTGGG + Intergenic
1109444972 13:62424586-62424608 TAAAATGAAAAGATTAGGCTAGG + Intergenic
1109849244 13:68038927-68038949 AAAACTGAAGAGATTTGGCTGGG + Intergenic
1109898799 13:68734191-68734213 CAAAATGAAATGATGAGGCATGG - Intergenic
1110301333 13:73931150-73931172 GAAAATTAAAATATGTGGCTAGG - Intronic
1110465548 13:75796804-75796826 GAAAAAGAAGAGAGGAGGAAGGG - Intronic
1111086336 13:83380392-83380414 GAAAATGAAGAAATGATGTAAGG - Intergenic
1111521891 13:89415468-89415490 GAAAATGAAGAGCATAGGTTAGG - Intergenic
1111736449 13:92146106-92146128 GAAAATAAATAGATGAGAATTGG + Intronic
1111936058 13:94557938-94557960 GCAAATGAGGAGAATAGGCTAGG - Intergenic
1112442033 13:99431628-99431650 GAAAAAGAAAAGATGCGGCCGGG + Intergenic
1112614935 13:100994594-100994616 AGAAAAGAACAGATGAGGCTGGG + Intergenic
1112865751 13:103895489-103895511 GAAAATGGAAAGAAGAGTCTCGG + Intergenic
1113067526 13:106387384-106387406 GAAAATGAAAAGATGATTCAGGG + Intergenic
1113136416 13:107095423-107095445 GAAAAAGAAGAGATGAAGAAGGG - Intergenic
1113225930 13:108159520-108159542 AAAAAAGAGGAGATGAGGCCGGG + Intergenic
1113299410 13:109001195-109001217 GAAAAGGAAGAGAAGGGGATTGG + Intronic
1113503638 13:110798190-110798212 GCAAGTGAAGAGAACAGGCTTGG - Intergenic
1114377611 14:22164979-22165001 GAAAATGTACAGATGAGCTTAGG + Intergenic
1115044363 14:28972474-28972496 AAAAATTAATAGATGAGGCCGGG - Intergenic
1115507669 14:34108485-34108507 GAAAATAAAGATTTGTGGCTGGG - Intronic
1115961841 14:38842775-38842797 AAAAAAGAAGAAATTAGGCTGGG + Intergenic
1117040420 14:51764091-51764113 CAAAATGCAGACATGATGCTGGG - Intergenic
1117091470 14:52255009-52255031 GATATTAAAGAGATAAGGCTGGG - Intergenic
1117719882 14:58618993-58619015 GAAAACGTGGAGATGCGGCTGGG + Intergenic
1118029805 14:61808973-61808995 AAAAAGAAAGAGACGAGGCTGGG + Intergenic
1118196246 14:63629311-63629333 GAGAATAAAGAGATGAAGTTTGG - Intronic
1118211993 14:63774037-63774059 AAAACTGAAGACAAGAGGCTGGG + Intergenic
1118297951 14:64587755-64587777 GAAAAAAAAAAGAGGAGGCTGGG - Intronic
1118462965 14:66003504-66003526 GAAAATGAAGAGTTGGGGGCGGG - Intronic
1119360730 14:74047021-74047043 GAAAGTTAAGAAATGTGGCTTGG - Intronic
1119585512 14:75831425-75831447 GAAAATAAAAAGATAATGCTGGG - Intronic
1119766036 14:77188112-77188134 GAAGATGAACAGATGAGGATAGG - Intronic
1119866496 14:77979446-77979468 AAAGTTGAAGAGACGAGGCTGGG + Intergenic
1120047213 14:79821009-79821031 CAAAATGAAGAGATGATGCAAGG + Intronic
1120878130 14:89393234-89393256 TAAAAAGAAGAGAGGAGGCCAGG - Intronic
1120982322 14:90301015-90301037 GAAAATGGTGAGATGTGGATAGG - Intronic
1121160098 14:91730186-91730208 GAAAATGAAGTCATTAGGGTGGG + Intronic
1121927033 14:97936941-97936963 GAGAATTAAGAGATGAAGTTAGG - Intronic
1122037461 14:98959078-98959100 GAAAAAGTGGAGAGGAGGCTTGG - Intergenic
1123012278 14:105355290-105355312 GAAAATGATGAGAGGAGCCTGGG + Intronic
1123538051 15:21259423-21259445 GAATAATAAGAGATGAGGTTAGG - Intergenic
1123792222 15:23733245-23733267 AAAAATTAAGAAAGGAGGCTGGG - Intergenic
1123999556 15:25743488-25743510 AAAAATCCAGAGTTGAGGCTGGG + Intronic
1124029670 15:25999012-25999034 GAGAGAGAAGAGAAGAGGCTTGG - Intergenic
1124116791 15:26851103-26851125 AAAAATCAAAAGAAGAGGCTGGG - Intronic
1124799556 15:32817700-32817722 GGAAATAAAGAAATGAGGCTTGG + Intronic
1125117111 15:36107241-36107263 GTAAACGAAGAAATCAGGCTAGG - Intergenic
1125179930 15:36871011-36871033 GAATATGAAGAGATCAGATTTGG + Intergenic
1126162569 15:45627957-45627979 AAAAATGAAGAGGTGAGGAAGGG + Intronic
1126595216 15:50377983-50378005 GAAACATAAGAGATAAGGCTTGG + Intergenic
1127419448 15:58790882-58790904 CAAAATGGAGCGATCAGGCTGGG + Intronic
1127915637 15:63452667-63452689 GAAAGTGAGGTGTTGAGGCTGGG + Intergenic
1127991479 15:64121544-64121566 TAAAATGAAGACATTAGGGTGGG - Intronic
1128290279 15:66473277-66473299 GAAAAATGAGAGATCAGGCTGGG + Intronic
1128668832 15:69559098-69559120 GAAAATGGGCTGATGAGGCTGGG - Intergenic
1128897108 15:71384959-71384981 GAAAAAGAAATGATGAGGATAGG + Intronic
1129506017 15:76082045-76082067 GAGGATGAAGAGATGAAGCATGG - Intronic
1129572881 15:76708768-76708790 AAGAATGAAAAGAGGAGGCTGGG + Intronic
1129784515 15:78300297-78300319 AAAAAAAAAGAGATGGGGCTGGG + Intergenic
1130526302 15:84709736-84709758 AAAAATGAACAGAAGAGGCCAGG - Intronic
1131085040 15:89568756-89568778 GAAGATGCAGAGGTGAGTCTGGG - Intergenic
1131407432 15:92176751-92176773 TAAAAGGAAAAGATGAGGTTAGG - Intergenic
1131468388 15:92673897-92673919 GAAAATGAGGACATTAGGGTGGG - Intronic
1132142209 15:99405426-99405448 GGAAATGCAAAGATGAGCCTAGG + Intergenic
1132432351 15:101772194-101772216 GACAAGGAAGAGATGAAGGTAGG - Intergenic
1133105020 16:3501811-3501833 GAAACCGAGGAGAGGAGGCTGGG + Intronic
1133124006 16:3632879-3632901 ACAATTAAAGAGATGAGGCTGGG - Intronic
1133202202 16:4210776-4210798 AAAAATAGAGATATGAGGCTGGG - Intronic
1133242551 16:4423944-4423966 GTATGTGATGAGATGAGGCTAGG - Intronic
1133406293 16:5527136-5527158 GAAAATGAAGGCTTGAGGCTTGG + Intergenic
1133643491 16:7740736-7740758 GGAAGTGATGAGAGGAGGCTTGG - Intergenic
1133919431 16:10139011-10139033 GAAAAAGAACAGAACAGGCTTGG + Intronic
1133977769 16:10612304-10612326 AAAAATGCAGATCTGAGGCTGGG + Intergenic
1134169064 16:11953969-11953991 AAAAAAGATGATATGAGGCTGGG - Intronic
1134366544 16:13584314-13584336 GAAAATAAAATGATAAGGCTAGG + Intergenic
1134481309 16:14621895-14621917 AAGATTGAAGAGATGAGGCTGGG + Intronic
1135073501 16:19373126-19373148 GAAAATGATCAGGTGAGGGTGGG + Intergenic
1135141811 16:19928405-19928427 GAAAATCAATAGATTAGGCTGGG - Intergenic
1135757999 16:25113929-25113951 AAAAATGAAAAGACTAGGCTGGG - Intronic
1136929382 16:34405609-34405631 GTAAAGTAAGAGATGAGCCTGGG - Intergenic
1136975192 16:35006196-35006218 GTAAAGTAAGAGATGAGCCTGGG + Intergenic
1137644589 16:50063100-50063122 CAAAATGAAGAGGTGAGGCTGGG + Intergenic
1137649909 16:50110864-50110886 GAAAATGCTAAGATGACGCTTGG + Intergenic
1137663963 16:50237195-50237217 AAAAGTGAAGAGATGGGGCGGGG + Intergenic
1137680337 16:50337553-50337575 AAGAATGAACAGATGAGGCCAGG - Intronic
1137687364 16:50395623-50395645 TAAAATGGGGAGGTGAGGCTGGG + Intergenic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1139940399 16:70601400-70601422 GAAAAAGAAGGAATCAGGCTAGG - Intronic
1140045672 16:71439071-71439093 GGCACTGAGGAGATGAGGCTGGG + Intergenic
1140543401 16:75781723-75781745 CAAAATGATGAGATGAGACAGGG + Intergenic
1140725334 16:77806636-77806658 AAAAATAAAGAGATCAGCCTGGG - Intronic
1140734445 16:77885511-77885533 AGAAATGAAGAGATGTGGCCTGG + Intronic
1140853635 16:78957850-78957872 GAATTTGCAGAGAAGAGGCTGGG + Intronic
1141142215 16:81503979-81504001 ATAAATGGAGAGGTGAGGCTTGG + Intronic
1141521423 16:84582437-84582459 AGAAATGAAGAAATGAGGCCGGG - Intronic
1141532937 16:84659296-84659318 GAAATTAAACAGAAGAGGCTGGG - Intronic
1142025572 16:87811250-87811272 GAAAATGAATAGATGGGCCCGGG - Intergenic
1142167350 16:88599368-88599390 GAAAATGAGGAAGTGGGGCTGGG - Intronic
1143363830 17:6392575-6392597 CAAAATCAAGAGACGGGGCTGGG + Intergenic
1143825724 17:9605414-9605436 GACAATAAAAAGATCAGGCTGGG + Intronic
1144185575 17:12792054-12792076 GAATGTGAAGAGATGAGAATGGG - Intronic
1144670532 17:17130334-17130356 GAAAATGAAGAAAGGAGGGAAGG - Intronic
1144770731 17:17758015-17758037 GGAAAGGGAGAGATGAGGGTGGG - Intronic
1144835108 17:18152701-18152723 GGAAGAGAGGAGATGAGGCTGGG - Intronic
1145020293 17:19424993-19425015 GAAAATTAAGAGCTGAGGCCAGG - Intergenic
1145187102 17:20804204-20804226 GAAAAAGTAGAAATGAGGCCGGG - Intergenic
1145415715 17:22712136-22712158 GAAAAGGCAGAGTTGAAGCTGGG - Intergenic
1145866826 17:28247160-28247182 GAAAATGGAGACATGAGTCCTGG - Intergenic
1146045713 17:29504372-29504394 GGAAATGAGGAAATGAGGCCAGG + Intronic
1146144204 17:30397435-30397457 GAAAAAGAGAAGATGTGGCTGGG + Intronic
1146287365 17:31582873-31582895 GAAAATGAAGAGATGAGGCCAGG + Intergenic
1146710043 17:35033231-35033253 GAAAAAGAAGTGATATGGCTGGG + Intronic
1146851747 17:36228040-36228062 GAAAACGTAGAAATGAGGCCGGG + Intronic
1146867657 17:36351913-36351935 GAAAACGTAGAAATGAGGCCGGG + Intronic
1146949015 17:36892838-36892860 GAAAATGAAGAGTTGGAGTTTGG - Intergenic
1147070531 17:37952530-37952552 GAAAACGTAGAAATGAGGCCGGG + Intergenic
1147082057 17:38032052-38032074 GAAAACGTAGAAATGAGGCCGGG + Intronic
1147098004 17:38156017-38156039 GAAAACGTAGAAATGAGGCCGGG + Intergenic
1147192223 17:38744649-38744671 TAAAATGGAGAGATGGGTCTGGG - Intronic
1147302695 17:39542484-39542506 GAAAAAGAAAATAAGAGGCTGGG - Intronic
1147431183 17:40371742-40371764 GGTAAAGAAGGGATGAGGCTTGG - Intergenic
1147834000 17:43317145-43317167 GAAGAAGAAGAAAGGAGGCTGGG - Intergenic
1148160269 17:45445798-45445820 GGAGATGAAGAGATTTGGCTAGG + Intronic
1148187847 17:45657454-45657476 TAAAATGAGGAGCTGAGGCCAGG - Intergenic
1148324322 17:46774266-46774288 GGCATTGAAGAGATCAGGCTGGG + Intronic
1148575261 17:48706177-48706199 GAAAAGGAAGAGAGAGGGCTAGG - Intergenic
1148612157 17:48971702-48971724 GAAATTGAAAAGATGACCCTGGG + Intergenic
1148862859 17:50613581-50613603 GACAATGTAGAGGAGAGGCTGGG - Intronic
1148891534 17:50811136-50811158 GCTAATCAAGTGATGAGGCTGGG - Intergenic
1149083798 17:52689908-52689930 GTAAATGAAGAGATGAGATTAGG + Intergenic
1149239529 17:54632971-54632993 GAAATGGAAGTGATGAGACTGGG + Intergenic
1150079701 17:62226122-62226144 GAAAACGTAGAAATGAGGCCGGG + Intergenic
1150306906 17:64093380-64093402 GAAACTGAACAGATGGGGCCAGG - Intronic
1150391560 17:64792677-64792699 GGAGATGAAGAGATTTGGCTAGG + Intergenic
1150651656 17:67014281-67014303 GAAAATGAATAGCTGATGCAAGG - Intronic
1150732055 17:67704248-67704270 GAAAATGAATAGTGGTGGCTGGG - Intergenic
1150918577 17:69460420-69460442 GAGTATTGAGAGATGAGGCTGGG + Intronic
1150968078 17:69994849-69994871 GAAAATAAATAGCTGAGACTTGG - Intergenic
1151342163 17:73478544-73478566 GAAGATGAAGAGATGAGCTCAGG + Intronic
1151865413 17:76798730-76798752 GAAAATAAGGAAATGAGGCAGGG + Intergenic
1152029824 17:77835017-77835039 GGCAATGAAGAAATGGGGCTAGG - Intergenic
1152887859 17:82863068-82863090 AAAAGTGAAGATATGAGGATGGG + Intronic
1153189841 18:2525772-2525794 GAAAATGAGAAAATGAGGCCAGG + Intergenic
1153214541 18:2807647-2807669 GAAAATGAAATGACCAGGCTGGG + Intergenic
1153994039 18:10424160-10424182 GAAAAAGAAGAGATGATGCCTGG + Intergenic
1154093524 18:11387739-11387761 GAAATTTCAGAGATGAGCCTGGG - Intergenic
1155338997 18:24795372-24795394 CAAATTGAAGAAATGAGGATTGG + Intergenic
1155688562 18:28586718-28586740 GAAAATGAAAAGATTACACTTGG - Intergenic
1156376052 18:36516250-36516272 GCAGATCAAGAGAAGAGGCTGGG + Intronic
1157354754 18:46922496-46922518 AAAAATAAAAAGTTGAGGCTGGG + Intronic
1157356397 18:46939044-46939066 ATAAATGACGAAATGAGGCTAGG + Intronic
1157848001 18:51021705-51021727 GAGAAGCGAGAGATGAGGCTGGG - Intronic
1157894589 18:51453152-51453174 TAAAATGGAGAAATGAGGGTTGG + Intergenic
1158707180 18:59803321-59803343 TAGACTGAAGAGATGAGGCAAGG - Intergenic
1158936139 18:62366358-62366380 GAAAATGGGGAGATGTGGGTCGG + Intronic
1159572714 18:70137555-70137577 GGAAATGATGGGATGAGGCAGGG - Intronic
1159815932 18:73073596-73073618 AAAAATAAAGATATGTGGCTGGG - Intergenic
1159852297 18:73538950-73538972 CAAAATGAAGAGAAGTGACTGGG + Intergenic
1159908112 18:74116842-74116864 GGAAGTAAAGGGATGAGGCTGGG - Intronic
1160882298 19:1326573-1326595 TAAAGTGCTGAGATGAGGCTGGG - Intergenic
1161303352 19:3553784-3553806 GGAAAAGAAAAGAAGAGGCTGGG + Intronic
1161378661 19:3952972-3952994 GAAAAAGAAGAGAGAAGGCAAGG - Intergenic
1161505676 19:4642183-4642205 GAAAAAGAAGAGAATTGGCTGGG + Intronic
1162213912 19:9116317-9116339 AAAAAAAAAAAGATGAGGCTGGG - Intergenic
1162309929 19:9900212-9900234 GAAAATGAAGAGAGGTGTCAGGG + Intronic
1162483991 19:10947412-10947434 GAAAATTAAGAAAAAAGGCTGGG + Intergenic
1162503953 19:11071393-11071415 AAAAATAAAGACAGGAGGCTGGG - Intergenic
1162597138 19:11638366-11638388 GAAAATGAAGGTCTGGGGCTGGG + Intergenic
1162953087 19:14083437-14083459 GAGAATGGAGGGGTGAGGCTGGG + Intronic
1163014443 19:14445597-14445619 GAAAATGAATAGAGTAGGCCAGG + Intronic
1163105628 19:15121518-15121540 GAAGAAGAAGAGAAGAGGCCAGG + Intronic
1163138556 19:15331662-15331684 GAAGGTGAAGAGATGGGGGTGGG + Intronic
1163724344 19:18913935-18913957 GAGAAGGAAGAGATGTGGCTTGG - Intronic
1163903701 19:20131859-20131881 GAAAATGAATACAACAGGCTGGG - Intergenic
1164315977 19:24088201-24088223 AAAAATTAAGAAACGAGGCTGGG - Intronic
1164890859 19:31821921-31821943 AAAAATAAATAAATGAGGCTGGG + Intergenic
1165371352 19:35408391-35408413 GAAAATCAAGGGGTTAGGCTGGG - Intergenic
1165495284 19:36149142-36149164 GAAAGTGAAGAAATCAGGATTGG - Intronic
1166153929 19:40896447-40896469 GAAAAAAAAGATGTGAGGCTAGG - Intronic
1166249916 19:41563021-41563043 GAAAATGAAATACTGAGGCTGGG - Intronic
1166511448 19:43411950-43411972 GAAAATGAAGAGGTTAGGCTGGG - Intronic
1167083403 19:47292556-47292578 AAAAATGAATAAATGAGGCCAGG - Intronic
1167296680 19:48654571-48654593 GTGAGAGAAGAGATGAGGCTGGG - Intergenic
1167589802 19:50398269-50398291 GAAAATAAAGAGATGTGCCAAGG + Intronic
1167805591 19:51781871-51781893 CAAAAAGAAGAGAGAAGGCTGGG + Intronic
1168298952 19:55392526-55392548 AAAAAAAAAAAGATGAGGCTGGG - Intronic
925324517 2:3007519-3007541 GAGAATGGAGAGATGGCGCTGGG + Intergenic
925850898 2:8081184-8081206 GATAATGAAGAGAGGAGTCTGGG - Intergenic
927420438 2:22925325-22925347 AAGAATTTAGAGATGAGGCTGGG - Intergenic
927791561 2:26014076-26014098 TAAAATGAGGAGGTGAGGCCGGG + Intergenic
927997551 2:27496633-27496655 GAAGAGGAAGACCTGAGGCTCGG - Intergenic
928073909 2:28245431-28245453 GAACATGAAGAAATGATGTTGGG - Intronic
928242149 2:29595964-29595986 GATAATGAGAAAATGAGGCTGGG + Intronic
928546412 2:32333098-32333120 AAAAATAAATAGAAGAGGCTGGG + Intergenic
928977776 2:37106746-37106768 TAGAACAAAGAGATGAGGCTGGG + Exonic
929050858 2:37835444-37835466 AAAAATGAAGAGAAGCGGCCGGG - Intergenic
929266740 2:39926879-39926901 GGAAATGGAGTGATTAGGCTGGG - Intergenic
930211411 2:48642557-48642579 GAAAGTGAAAAGATGTGGCCGGG + Intronic
930211672 2:48645560-48645582 CAAAATCAAGAGATGGTGCTCGG - Intronic
930603378 2:53467485-53467507 GAAAAAGAAGAAATCAGGCAGGG + Intergenic
930756661 2:54981173-54981195 TAAAAATAAGAGATGCGGCTGGG + Intronic
931384541 2:61786269-61786291 GAAAATGAGAACGTGAGGCTGGG + Intergenic
931518053 2:63063501-63063523 GAAAATAGAAAGATGAGACTTGG - Intergenic
931563255 2:63587617-63587639 TAAAAGGAAGATATGATGCTCGG - Intronic
931766477 2:65461182-65461204 GAAAAGGGAGTGAAGAGGCTGGG - Intergenic
932490900 2:72119633-72119655 GAGAATGAAGAGAAGGGGCATGG - Intergenic
933047204 2:77554098-77554120 GAAAAGGGAGAGATGGGGCAAGG - Intronic
933668080 2:84980939-84980961 GCCATAGAAGAGATGAGGCTAGG - Intronic
933677083 2:85066512-85066534 GAAGAGGAAGAGATGAGGGAAGG - Intergenic
934754983 2:96818544-96818566 AGAAAAGAAGAGGTGAGGCTGGG - Intronic
934919727 2:98333030-98333052 CACAATGAAGAGATGAGCGTTGG + Intronic
935485673 2:103650649-103650671 TAAAATTAAGATATGTGGCTGGG + Intergenic
936561615 2:113543430-113543452 GAAAATGAAAAGGAGAGGGTTGG - Intergenic
936810420 2:116393339-116393361 CAAAATGAAGCGATGATTCTAGG - Intergenic
937242396 2:120470718-120470740 GAAAATGAAGAGGTTGGGCTAGG - Intergenic
937523593 2:122740424-122740446 GAAAGTGAACAGCAGAGGCTGGG + Intergenic
937722303 2:125116158-125116180 GAAAATGAATAGACCAGCCTGGG + Intergenic
939403324 2:141723549-141723571 GAGAATGAAGAGAAAAGGCAGGG + Intronic
939531022 2:143362086-143362108 AAAAATGAGGAAATGTGGCTAGG - Intronic
939739939 2:145893787-145893809 GAAAAATAAGAGAAGAGTCTGGG + Intergenic
941018576 2:160384635-160384657 ACAGATGAAGAGATGAGACTTGG - Intronic
941280424 2:163543367-163543389 GAAAAAGATGAGTTCAGGCTAGG - Intergenic
941578180 2:167262368-167262390 TAAAATGAGGTCATGAGGCTGGG - Intergenic
941982582 2:171475468-171475490 GAATAAGAAGAGAAGGGGCTGGG + Intronic
942041572 2:172069204-172069226 GAAAATGATTACTTGAGGCTGGG - Intronic
942174911 2:173323898-173323920 GAAATTCTAGAGCTGAGGCTAGG - Intergenic
942221427 2:173772782-173772804 GCAAATGAAGAGTTCAGACTTGG - Intergenic
942455597 2:176136336-176136358 GAGAAGGAAGAGAGGAGGCGGGG + Intergenic
943464651 2:188214232-188214254 GAAAATCAAAAGATAAGCCTGGG - Intergenic
943525945 2:189017592-189017614 GAAATAGAAGAGATCAGGCCAGG + Intergenic
943876441 2:193072908-193072930 GACAATGAGGGGATGAAGCTGGG + Intergenic
944151407 2:196562583-196562605 GGAAATGCAGTGATAAGGCTGGG - Intronic
944407452 2:199401250-199401272 GAAAATAATAGGATGAGGCTGGG + Intronic
944761821 2:202823668-202823690 GAACATGTAGAGAAGAGACTTGG - Intronic
944874990 2:203954288-203954310 GAAAATGAAAAAGTGGGGCTGGG + Intronic
945423433 2:209667884-209667906 GAAAATGAAGAGAAGGGATTGGG - Intronic
945793085 2:214329969-214329991 TAAAATGAAAAGTTTAGGCTGGG + Intronic
945889844 2:215418310-215418332 GGAAATGGAGGAATGAGGCTTGG + Intronic
945916130 2:215705899-215705921 TAAAATGAAGACATGAGGGTGGG - Intergenic
945932452 2:215868706-215868728 GAGAATAAAGAGATGCGTCTTGG - Intergenic
946223118 2:218246225-218246247 AAAAAAAAAGAGTTGAGGCTGGG + Intronic
946279250 2:218654658-218654680 TAAAAATAAGAGATGTGGCTGGG - Intronic
946436525 2:219659980-219660002 TAAAATTAAAAGTTGAGGCTGGG + Intergenic
946615085 2:221500466-221500488 GTTAATGAATGGATGAGGCTGGG - Intronic
947183110 2:227430206-227430228 CAAAATCAAGAAATGAGGCCGGG + Intergenic
1169158038 20:3350663-3350685 GGAAATGTAAAGATAAGGCTGGG + Intronic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169442436 20:5643865-5643887 GAAAGAGCAGAGATGTGGCTGGG - Intergenic
1169702487 20:8463320-8463342 GAAAATGAAGGGATAAGGGAAGG - Intronic
1170489952 20:16862767-16862789 GAAACTGCAGAAATGAGGGTTGG - Intergenic
1171165027 20:22962241-22962263 GAAAAATCAGAAATGAGGCTGGG - Intergenic
1171342086 20:24437676-24437698 GAAAAGGAATAAGTGAGGCTTGG - Intergenic
1171814717 20:29775461-29775483 AAAAATGAACAGAGGTGGCTGGG - Intergenic
1172055640 20:32152521-32152543 GAAGATGCAGAGATGGGGGTGGG - Intronic
1172064427 20:32208912-32208934 GAAAATAAAGAGAGCAGGGTAGG + Intronic
1172065040 20:32213475-32213497 AAAAATATAAAGATGAGGCTGGG + Intronic
1172103654 20:32502241-32502263 GAAATTGAAGTGGGGAGGCTGGG + Intronic
1172475467 20:35234200-35234222 GTGAATGAACAGAAGAGGCTAGG - Intronic
1172823256 20:37757797-37757819 AAAAAAGTAGAGATGTGGCTGGG + Intronic
1173528167 20:43748675-43748697 AAAACAGGAGAGATGAGGCTAGG - Intergenic
1174760126 20:53199200-53199222 TAAAATCAAGACATGTGGCTGGG + Intronic
1174921283 20:54705056-54705078 CAAGATGAAGAGAAGGGGCTGGG - Intergenic
1175037705 20:56015992-56016014 TAAAATGTAGAGCTCAGGCTGGG - Intergenic
1176188241 20:63793246-63793268 GAAAAGGAAGAGATGACATTCGG + Intronic
1177185989 21:17796877-17796899 GAAATTAAACAGATGATGCTGGG + Exonic
1177466516 21:21489288-21489310 AAAAGTGAAAACATGAGGCTGGG - Intronic
1177722669 21:24928115-24928137 AAAATTTAAGAGTTGAGGCTTGG + Intergenic
1178178911 21:30136838-30136860 GGAAATGAAGAAATAAAGCTAGG - Intergenic
1178417617 21:32416622-32416644 GAAAAAGAAAAGGAGAGGCTGGG - Intronic
1178604576 21:34024747-34024769 GAATATGGAGAGATCAGACTGGG + Intergenic
1179201943 21:39232706-39232728 GAAATTTAGGAGATGATGCTAGG - Intronic
1180688651 22:17691160-17691182 GAAAATAAATAAATAAGGCTAGG - Intronic
1181092770 22:20485570-20485592 GAAAAGGCAGAGAAGAGGCCAGG + Intronic
1181392374 22:22593113-22593135 GAAAATGAGGTCATGAGGGTGGG + Intergenic
1181404350 22:22672099-22672121 GAAAATGAAGTCATGAGGGTGGG + Intergenic
1181660324 22:24342373-24342395 GAAAAAGAATAGAGGAGGCCAGG + Intronic
1182409564 22:30171936-30171958 GAGAAGCAAGATATGAGGCTAGG + Intronic
1182502857 22:30760518-30760540 GAAAATCAATAAATGGGGCTGGG + Intronic
1182628567 22:31666669-31666691 TAAAATTAAAAAATGAGGCTGGG - Intergenic
1182673167 22:32015116-32015138 GAAAAAGCAGAGATGAGGCCGGG + Intergenic
1182684527 22:32111381-32111403 TAAAATGAAGACATTAGGGTGGG - Exonic
1182703626 22:32260775-32260797 GAATAAGAAGTCATGAGGCTGGG + Intergenic
1183329928 22:37213881-37213903 GTGAATGAATACATGAGGCTGGG - Intergenic
1183556023 22:38527812-38527834 AAAAATGAAGAAGTAAGGCTGGG - Intronic
1183967747 22:41452953-41452975 GAAAATGAAAATATCAGGCCAGG + Intergenic
1184025137 22:41850152-41850174 GAAAGTAATGAGATGGGGCTGGG + Intronic
1184127265 22:42496423-42496445 TAAAATTAAGACATCAGGCTGGG - Intergenic
1184134370 22:42538044-42538066 TAAAATCAAGATATCAGGCTAGG - Intergenic
1184317674 22:43709375-43709397 AAAAATGAAGAAATAAGGCCGGG - Intronic
1184377832 22:44125656-44125678 GAGAGCCAAGAGATGAGGCTGGG + Intronic
1184741254 22:46430193-46430215 GAGACTGAAGAGAGGAGGGTGGG + Intronic
949280732 3:2343792-2343814 GAAAAGGAATACTTGAGGCTGGG + Intronic
949345934 3:3076684-3076706 GTAAAAGAAATGATGAGGCTTGG + Intronic
949952942 3:9244059-9244081 TAAAATGAAGAAAGCAGGCTGGG - Intronic
949963138 3:9331340-9331362 AAAGATGAAGAGATGAAGCTTGG + Intronic
951008322 3:17646064-17646086 TAAACTGAAGTGATGAGGATGGG + Intronic
951584446 3:24201144-24201166 GAAAATGAAGAGAAGCAGGTAGG + Intronic
951706741 3:25551426-25551448 GATAAGGAAGAGAGGAGGATAGG + Intronic
951711210 3:25586176-25586198 GAACATGAGGAGAAGAGGGTGGG - Intronic
952268857 3:31813264-31813286 CAAAATGAAGACAGTAGGCTGGG - Intronic
952280062 3:31914214-31914236 AAAAATGAAAGGAAGAGGCTGGG - Intronic
952391019 3:32880322-32880344 AAAAATAAATGGATGAGGCTGGG - Intronic
952553863 3:34509605-34509627 GAAAATGATGAAATAAGGCAAGG - Intergenic
952932797 3:38373193-38373215 GAGGAGGAAGAGAAGAGGCTAGG - Intronic
953005394 3:38972982-38973004 GAAAATTAATTAATGAGGCTTGG + Intergenic
953202841 3:40792728-40792750 GAAAAGGAAGACAGGAGGCAGGG - Intergenic
953240734 3:41147294-41147316 GAAAATGATGGAATGAGCCTAGG - Intergenic
953358968 3:42278429-42278451 GAAAATGAAGAAGTGAGACAGGG - Intergenic
953682349 3:45049217-45049239 CAACATGAAGATATGAGTCTGGG + Intergenic
953889220 3:46738242-46738264 GAAAGTAAAAAGATGTGGCTGGG + Intronic
954032333 3:47828474-47828496 AAAAAAAAAAAGATGAGGCTGGG + Intronic
954206044 3:49059715-49059737 GAAAATAAATAAATAAGGCTAGG - Intronic
954728156 3:52634141-52634163 GATAATGAACAGTTAAGGCTGGG + Intronic
954999258 3:54911705-54911727 TAAAATGAAGAGGTGAAGGTTGG - Intronic
955290187 3:57684806-57684828 GGAAAGGAATAAATGAGGCTGGG + Intronic
955304608 3:57817433-57817455 GTAAATGATGAGATGAGTCTAGG + Intronic
955853518 3:63247711-63247733 GAAAGGGAAGAAATGAGGTTTGG - Intronic
956008015 3:64801149-64801171 ATAAAGGAAGAGATGAGGGTGGG - Intergenic
956018118 3:64905772-64905794 GGAAATGAAAACATAAGGCTTGG + Intergenic
956185929 3:66562008-66562030 GAGAATGAAGATGTGATGCTTGG - Intergenic
956235488 3:67066150-67066172 GAAAAAAAGGATATGAGGCTGGG + Intergenic
956657823 3:71568940-71568962 GAAAATTCAGAGAACAGGCTGGG - Intronic
956741726 3:72280745-72280767 ACAGATGAAGAGAGGAGGCTTGG + Intergenic
956769208 3:72510237-72510259 GAAAATAAAGAGGAGAGGCTGGG + Intergenic
956851565 3:73232662-73232684 GAAATTATAGACATGAGGCTGGG - Intergenic
957265399 3:77956946-77956968 GAAAATGAAGAGATAATACAGGG - Intergenic
957508759 3:81159921-81159943 AGGAATGAAGAGATGATGCTAGG + Intergenic
958623750 3:96598415-96598437 GAAAATGGAGAGGTAGGGCTTGG - Intergenic
958686547 3:97405386-97405408 GAAACAGAAGGTATGAGGCTAGG - Intronic
958777930 3:98507698-98507720 TAAATTTAAGAGATGAGGCCAGG - Intronic
959064727 3:101644779-101644801 GAAAATAAAGGAATAAGGCTGGG - Intergenic
959172523 3:102860103-102860125 GAAAGTCAAGAGTTGAGGTTTGG - Intergenic
959293249 3:104501707-104501729 GTAAATGAATACTTGAGGCTGGG + Intergenic
959637541 3:108591989-108592011 AAAAAAAAAGAGATGAGTCTGGG + Intronic
959785177 3:110288330-110288352 GAAATTAAAAAGATGGGGCTGGG - Intergenic
960025546 3:113004772-113004794 TAAAATGAAAAAATGAGGTTAGG - Exonic
960431972 3:117580460-117580482 GAAAATTTGGAGATGAGTCTGGG - Intergenic
960590659 3:119362470-119362492 TAAGAAGTAGAGATGAGGCTGGG + Intronic
961179931 3:124868482-124868504 GAAAATGAAGGCAAGAGGCCAGG + Intronic
961187471 3:124928209-124928231 GAAAAGAATGAGTTGAGGCTGGG - Intronic
961234307 3:125351044-125351066 AGAAATGAGGAGTTGAGGCTGGG + Intronic
961266713 3:125648895-125648917 GAAAAAGAAAAGATAAGGCTTGG + Intergenic
961692356 3:128679287-128679309 GAAAACAAAGAGAAGAGGGTTGG - Intronic
961959736 3:130842635-130842657 GAGAATGAATATATGGGGCTAGG + Intergenic
961972648 3:130986774-130986796 GAAAAAGACAAGATGAGGGTGGG - Intronic
961976939 3:131035548-131035570 GAATATGAAAAGCTGAGGCCTGG - Intronic
962557644 3:136571885-136571907 TAAAATGAATAAATAAGGCTGGG + Intronic
962851346 3:139310577-139310599 GAACATGAAAAGATGTCGCTGGG + Intronic
962992357 3:140589892-140589914 AAAAAGGAAGAGATTGGGCTGGG + Intergenic
963105173 3:141640999-141641021 GAAAAAGAAGGGAATAGGCTGGG + Intergenic
964274443 3:154994472-154994494 GTAAATGCAGCTATGAGGCTTGG + Intergenic
964433938 3:156632950-156632972 GTAAATGAATACTTGAGGCTGGG - Intergenic
965010972 3:163090385-163090407 GAAAATGAATGGATGAGGCTAGG + Intergenic
965659169 3:171022590-171022612 GAAAATGCAGGGATGAGACTGGG - Intronic
965888705 3:173482438-173482460 GAAAGTGTGGAGATGGGGCTGGG - Intronic
966383239 3:179365155-179365177 GAGAATGAAAATATTAGGCTTGG - Exonic
966441035 3:179944555-179944577 GAAAAGGAAGGGATGAGAATGGG - Intronic
966688678 3:182722864-182722886 GAAATTGAAGGGAGGAGGGTGGG - Intergenic
967015660 3:185479352-185479374 GAAAAGGCAGAGCTGAGGCTTGG - Intronic
967326664 3:188247506-188247528 TAAAATGATGTGATCAGGCTGGG + Intronic
967356075 3:188573347-188573369 GAAAAATAAGAGATGAGGTTTGG + Intronic
967955109 3:194871929-194871951 GAAAATGAATAAATTAGGCTTGG + Intergenic
968036134 3:195549628-195549650 TAAAATGAAAAGAGGAGGCCAGG - Intergenic
968296136 3:197577793-197577815 GAAGCTGAAGAGAAGAGACTGGG + Intergenic
969518384 4:7661475-7661497 GGAAAAGAAGAGCTGAGGCTGGG - Intronic
970051035 4:11915508-11915530 GAAAATTGAGAGATGAAGATTGG + Intergenic
970166997 4:13249170-13249192 GGAAATGAAGGGATGAGAATAGG + Intergenic
970471931 4:16387590-16387612 GAAAGTGCATAGATGAGCCTAGG - Intergenic
970681374 4:18512325-18512347 GAAGAAGAAGAGAAGAGGCAAGG - Intergenic
970826818 4:20286284-20286306 GAAAATGATGGGATGAGGGTGGG - Intronic
970933500 4:21540873-21540895 ATAAATCAAGAGATGAGGCCTGG + Intronic
971385491 4:26137584-26137606 ACAAATGAAGCGAAGAGGCTCGG - Intergenic
972168716 4:36318907-36318929 GAAAATGCACAGAAGAGGCCAGG - Intronic
972463164 4:39325676-39325698 GAAGATTCACAGATGAGGCTGGG - Intronic
974508154 4:62804208-62804230 GAAAATCAACAGAGAAGGCTGGG - Intergenic
974514643 4:62893870-62893892 TAAAATAAAAAGATGAGGCAAGG - Intergenic
974601579 4:64089723-64089745 GTAAAAGAATATATGAGGCTGGG + Intergenic
974996027 4:69160236-69160258 GAAAATGAAGAGTGGAGGGATGG + Intronic
975700034 4:77055760-77055782 GAAATTGAATAGGTTAGGCTGGG - Intronic
976153368 4:82115624-82115646 GAAAATGAAAAGTAGGGGCTTGG - Intergenic
976665684 4:87588357-87588379 GATAATGTAGAGATCAGGCCTGG - Intergenic
977270170 4:94908518-94908540 GAAAAAGAAGAGATGTTGATAGG - Intronic
977278725 4:95011721-95011743 GAAAAAGAAAAGATGGGGTTGGG + Intronic
977611676 4:99040701-99040723 AAAAAAGAACAGATGAGCCTGGG - Intronic
978425050 4:108573370-108573392 AAAAAAGAATAGAAGAGGCTGGG + Intergenic
978619435 4:110623387-110623409 AAAGGTGAAGAGATGAGGCTAGG + Intronic
978830251 4:113075557-113075579 GAACAGAAAGACATGAGGCTGGG + Intronic
978986446 4:115019410-115019432 GATGATGAAAAGATTAGGCTGGG - Intronic
979395587 4:120184792-120184814 TAAGATGAAGAGATGAGTCTAGG + Intergenic
980055599 4:128076298-128076320 GAATACAACGAGATGAGGCTGGG - Intronic
980200093 4:129645447-129645469 GATACTGAAGAGAAGAGGCTGGG - Intergenic
980303652 4:131027169-131027191 GAAAAAGAAGACATGAGTCTGGG - Intergenic
980317565 4:131222314-131222336 GAAAATGGAGTGATGAGAGTGGG - Intergenic
980953617 4:139406719-139406741 GAAAATGAAAGCTTGAGGCTGGG + Intronic
981467269 4:145087749-145087771 AACAATAAAGAGATGAGGCCAGG + Intronic
981680986 4:147398003-147398025 GAAACAAAAGAGTTGAGGCTGGG + Intergenic
982349673 4:154400900-154400922 GAAAGTGATGAGAAAAGGCTTGG - Intronic
982413415 4:155104682-155104704 GAAATTTAATAGGTGAGGCTGGG - Intergenic
983156763 4:164357336-164357358 GACAATGAAGTGATGAGCTTTGG - Intronic
983273957 4:165595055-165595077 GAAAATCAAGAGCTCAGGTTTGG + Intergenic
983522605 4:168725819-168725841 GAAATTAAAGAGAACAGGCTGGG - Intronic
983597857 4:169490846-169490868 GAAAGAGAAGAGATGAGGCCGGG + Intronic
983816258 4:172130349-172130371 GAAAATTAAGAAATGATTCTTGG - Intronic
983854794 4:172630603-172630625 AAAAAAGAAAAGATGAGGATTGG - Intronic
984262783 4:177461947-177461969 GAAAATCCAGAGCTGGGGCTGGG + Intergenic
984409336 4:179375588-179375610 GAAAATGAAGGGGTGAGGCGAGG - Intergenic
984732323 4:183079419-183079441 AAAAAAGAAGACAAGAGGCTGGG - Intergenic
984802937 4:183731371-183731393 GAAAATGAAGAAGGCAGGCTAGG - Intergenic
984927014 4:184815823-184815845 TAAAAAGCAGAGATGAGGCCAGG + Intronic
985000665 4:185479311-185479333 GAATATGAAAATATGAGGTTAGG + Intergenic
985117296 4:186604921-186604943 GAAAAGGAAGAGACGAGGCCAGG + Intronic
985157974 4:187012731-187012753 GAACAGGAAGACCTGAGGCTGGG + Intergenic
985288177 4:188358597-188358619 GAAGAGGAAGAGAGGAGGCCTGG - Intergenic
985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG + Intronic
986298222 5:6456910-6456932 GAATAGGAATAGAAGAGGCTCGG - Intronic
986339225 5:6775298-6775320 CAAAATGAGGAGATGTGGCAAGG + Intergenic
986776711 5:11022087-11022109 GAACAAAAAGAGATGAGACTTGG - Intronic
986934555 5:12866891-12866913 GTAAATAAAGATCTGAGGCTTGG - Intergenic
987106093 5:14641035-14641057 GAAAAGGAAGCGATGCGGCATGG + Intergenic
987294716 5:16539539-16539561 GAGCAGGAGGAGATGAGGCTGGG - Intronic
987301418 5:16601069-16601091 GAAAAAGAAGAAAACAGGCTGGG + Intronic
987306279 5:16640768-16640790 GAAAAAGTGGAAATGAGGCTGGG + Intergenic
987686642 5:21212890-21212912 GAGAAAGAAGAGATGAAGGTAGG + Intergenic
987978906 5:25054234-25054256 GAAAATAAACAAATAAGGCTGGG + Intergenic
988412286 5:30902090-30902112 GAAAATCAAAAGATGAGGTAGGG + Intergenic
988579797 5:32458920-32458942 AGAAATCAAGAGCTGAGGCTTGG - Intergenic
988792485 5:34621351-34621373 GAAAATACAGAAATGAGGCTGGG - Intergenic
988966580 5:36424615-36424637 GAAAATGAATGTATAAGGCTGGG - Intergenic
988980799 5:36566707-36566729 AAATATGAAGAAATGAGGCCTGG - Intergenic
989155712 5:38343106-38343128 TAAAATGAAGGGATGGGGCCAGG + Intronic
989301356 5:39897834-39897856 TATAATGAAGAGATGAGTATGGG + Intergenic
989386386 5:40858704-40858726 GAAAATGCAGAAATAAGGCCAGG + Intronic
990023266 5:51155114-51155136 GAAAATAAATAGATTAGGCCAGG + Intergenic
990037933 5:51345548-51345570 GACAAGGAAGAAATGAGGATGGG + Intergenic
990047262 5:51448350-51448372 AAAAATGAACAGATGAACCTTGG - Intergenic
990439921 5:55834018-55834040 CAAAATGAAAATATGGGGCTTGG + Intergenic
990467551 5:56084167-56084189 AAAAATAGGGAGATGAGGCTGGG - Intergenic
990528397 5:56650817-56650839 CAAAACGAAGAGAGGAGGCTGGG - Intergenic
990907376 5:60819002-60819024 GAAAAAGAAGAGAAGAGGAGAGG + Intronic
990936195 5:61152218-61152240 AAATATTAATAGATGAGGCTTGG + Intronic
991238459 5:64427252-64427274 AAAAAGGAAGAGAAAAGGCTAGG + Intergenic
991264800 5:64705115-64705137 GTAAATAATGAGTTGAGGCTGGG + Intronic
991294986 5:65071208-65071230 GAAAATAAAGGGATGGGGCAGGG - Intergenic
991696985 5:69282264-69282286 GAAAATGTAGAAAATAGGCTGGG + Exonic
992252652 5:74890691-74890713 AAAAAAGAAAATATGAGGCTGGG - Intergenic
992350957 5:75928779-75928801 GAAGATGGAGAGAGGAGACTGGG - Intergenic
992457215 5:76926906-76926928 GAAATTGAAGACAGGAAGCTGGG - Intergenic
992742863 5:79791423-79791445 GAAAAGGCATAGAAGAGGCTGGG + Intronic
993176861 5:84497613-84497635 GAAAATCAAGAGGAAAGGCTGGG + Intergenic
993535331 5:89077367-89077389 GAAACTGATGAGAGGAGGCTTGG + Intergenic
993622371 5:90183828-90183850 GAAAATGTAGAGATGTAGATTGG - Intergenic
993702975 5:91140130-91140152 GAAGATGAAGAGAGAAGGCAAGG - Intronic
993830807 5:92755730-92755752 GAAGTTGAAGACATTAGGCTGGG + Intergenic
993944319 5:94099327-94099349 GAAAATCAATAAATGTGGCTGGG + Intronic
994331587 5:98512486-98512508 GAAAATGAAGAACTGTGGATAGG + Intergenic
994581258 5:101645129-101645151 CAAAATGAAGAGATCATGTTTGG + Intergenic
995122248 5:108548682-108548704 TAAAATGCATAGATGAGGCCAGG + Intergenic
995191322 5:109321880-109321902 GGAAAAGAAAAGATGAGCCTAGG - Intergenic
995331744 5:110954626-110954648 GAAAATCAAGAGCTGTGGTTTGG - Intergenic
996055711 5:118980027-118980049 GAAAATGAAGAAATGAACATTGG - Intronic
996642580 5:125774801-125774823 GGAAATGCAGAGATAAGGCAAGG - Intergenic
996748679 5:126868055-126868077 GAAGAGGAAGAGATGAGGAGTGG - Exonic
996791972 5:127303034-127303056 GAATATCAAGAGATAAGGTTGGG + Intronic
996817577 5:127590776-127590798 GAAACTGTAGAGATGAGGTTAGG - Intergenic
996943444 5:129037914-129037936 GAAAATGGAGAGTTAGGGCTAGG + Intergenic
997813812 5:136997184-136997206 GAAGAAGCAGATATGAGGCTGGG - Intronic
998348002 5:141481520-141481542 AAAAATCTAGAGATGGGGCTGGG + Intronic
998553075 5:143095865-143095887 GAAGAAGAAGATATGAGGCCTGG - Intronic
998595909 5:143530240-143530262 GAATATGAAAGGATGAGGATAGG - Intergenic
998628852 5:143876225-143876247 GAGAATGAAGAGAAGGGGCTTGG + Intergenic
998931739 5:147188703-147188725 GACAATGAAATGATGAGGCTGGG - Intergenic
999277151 5:150338963-150338985 GATCATGAAGAGATCAGGGTTGG - Intronic
999827036 5:155283422-155283444 GAGACAGAGGAGATGAGGCTTGG + Intergenic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1000656835 5:163889430-163889452 CAAAATGATGAGATGTGGGTAGG + Intergenic
1001905254 5:175466842-175466864 GGGAATGAAGAGGAGAGGCTGGG + Intergenic
1001973198 5:175973779-175973801 GAAAATGAAAAGAATAGGCCGGG + Intronic
1002244239 5:177870004-177870026 GAAAATGAAAAGAATAGGCCGGG - Intergenic
1003495934 6:6663214-6663236 TAAAATGAAGCCATGAGGGTGGG - Intergenic
1003666420 6:8115849-8115871 GAAAAACAAGAGAAGAAGCTCGG + Intergenic
1003782237 6:9442563-9442585 CAAAAAGAAGAAATGAGGCCAGG + Intergenic
1003921408 6:10837092-10837114 AAAACTGAAGAGATAAGGCTTGG + Intronic
1004221575 6:13751993-13752015 GAAATTGGAGAGAGGGGGCTGGG - Intergenic
1004249822 6:14014674-14014696 GAAAGTGGAGAGAGAAGGCTGGG - Intergenic
1004783594 6:18940340-18940362 AAAACTGGAGAGATAAGGCTGGG - Intergenic
1005209892 6:23448419-23448441 AAAAATGAGGTGAGGAGGCTGGG - Intergenic
1005296657 6:24433788-24433810 AGAAATGTAGAAATGAGGCTGGG - Intronic
1006255954 6:32832471-32832493 GAGAAGAAAGAGATGAGGCTGGG + Intronic
1006532696 6:34670547-34670569 CAAAATTAAAAGATGAGGATAGG + Intronic
1006535356 6:34695558-34695580 GAAAATGGAGAACTTAGGCTGGG - Intronic
1006785031 6:36660729-36660751 AAAAATGAAGACATGAGGCCGGG - Intergenic
1006828826 6:36956502-36956524 GAGGAGGAGGAGATGAGGCTGGG + Intronic
1006858748 6:37155061-37155083 TAAGAAGAGGAGATGAGGCTGGG - Intergenic
1007355496 6:41312531-41312553 GAAAATAAAGAGAACAGGCCAGG + Intergenic
1007392699 6:41559515-41559537 GAAAAAAAAGAGAAGGGGCTAGG + Intronic
1008380283 6:50833414-50833436 GAACATGAGGATAGGAGGCTGGG + Intronic
1008581616 6:52913432-52913454 GGAACTGAGGATATGAGGCTGGG - Intergenic
1008936063 6:56993993-56994015 TAAAATGAAGAAATAAGGCCAGG - Intronic
1009309739 6:62135041-62135063 GAAAATGAGGACATGAGATTTGG + Intronic
1010852761 6:80798335-80798357 GAAAATGGAGAGGTGGGGCCAGG - Intergenic
1011050823 6:83147990-83148012 GGAAATGGAGAGACCAGGCTAGG + Intronic
1011097211 6:83679537-83679559 GAAAAAGAAGAGATAGGGATGGG - Intronic
1011484694 6:87829681-87829703 GATAAAGAAGAGAAGAGGCCTGG - Intergenic
1011624331 6:89271131-89271153 AAGAAGGAAGAGAGGAGGCTGGG + Intronic
1011903811 6:92335013-92335035 TAAAATGAAGACATTAGGGTGGG + Intergenic
1011925688 6:92642208-92642230 GAAAATGAAGAAATGAGCCAAGG - Intergenic
1012189993 6:96267180-96267202 GAAAATGAAGAGGAGATGGTGGG + Intergenic
1012281974 6:97338489-97338511 TCAAATGTAAAGATGAGGCTGGG + Intergenic
1012880206 6:104778497-104778519 TAAAAGTAAGAGAAGAGGCTGGG + Intronic
1013194198 6:107831144-107831166 GAAAAGGAAGAGATGAGGGGAGG + Intergenic
1013346474 6:109265328-109265350 GAAAAGTAAGAGATGAGACCTGG - Intergenic
1013418933 6:109948970-109948992 GGAAAGGAACAGATGAGGCAGGG + Intergenic
1013502021 6:110761656-110761678 GAAATTGAAGTCATGAGACTAGG + Intronic
1013502522 6:110766837-110766859 GAAAATAAACAAATAAGGCTGGG + Intronic
1014365529 6:120536707-120536729 GAAAATAAAGAGAGAAGGGTAGG - Intergenic
1015563704 6:134543727-134543749 GAAAATGAAGAGAAATGGCCAGG + Intergenic
1015716625 6:136199383-136199405 GAAGATTAAGAGTTGAGGCATGG + Intergenic
1016134379 6:140520726-140520748 TAAAAACAAGAGATGAGGCAGGG - Intergenic
1016262892 6:142194721-142194743 GAAAAGAAAGAAATGAGGATTGG - Intronic
1016879551 6:148897473-148897495 AAAAATAAAAAGATAAGGCTGGG - Intronic
1017501668 6:155031425-155031447 GAAAATGAAGAGATGAGGCTGGG + Intronic
1017548365 6:155476652-155476674 CAAAATTAAAAGATGAGGCCAGG + Intergenic
1017598707 6:156058500-156058522 GCATAAGAGGAGATGAGGCTAGG - Intergenic
1017926584 6:158915898-158915920 GAAAATGAAGAGATGGAGGCCGG + Intergenic
1018387258 6:163316232-163316254 TAAAATGAAGAAATGAGGCCAGG + Intergenic
1018894659 6:168005351-168005373 GAAAATGAAGAGTTGAGGAGTGG + Intronic
1020004309 7:4774224-4774246 GAGAATGAAGAGATGGGAATCGG - Intronic
1020123475 7:5518977-5518999 GAAAATAAACAGGTCAGGCTGGG - Intergenic
1020157510 7:5738411-5738433 GAAAATTAAGAAATATGGCTGGG + Intronic
1020245289 7:6424609-6424631 GAAAATGAGGATGTGAGCCTGGG - Intronic
1020701554 7:11490112-11490134 CAAAATGAATAGGTGATGCTGGG + Intronic
1020761097 7:12269250-12269272 GAAAATGCAGACAGGAGGCATGG + Intergenic
1021024757 7:15651052-15651074 CAAAGAGGAGAGATGAGGCTTGG + Intronic
1021205881 7:17780332-17780354 GAAAATGAAGATTTTAGGCCAGG + Intergenic
1021244775 7:18247527-18247549 GAAAATGAAAAGAGGAGAATTGG + Intronic
1021531649 7:21653169-21653191 TAAAAAGAATAGATTAGGCTGGG - Intronic
1022214997 7:28250406-28250428 AAAAATGAAGAGATGGGGGTCGG - Intergenic
1022345475 7:29510111-29510133 GAAAAATAAGAGACCAGGCTGGG - Intronic
1022385937 7:29899164-29899186 GCAAATGAAGTCATGAGGATGGG - Intronic
1022586538 7:31618541-31618563 GAAAAGGTAGAGATGATGTTAGG + Intronic
1023371715 7:39518565-39518587 GGAAATGTGGTGATGAGGCTGGG - Intergenic
1024114947 7:46183706-46183728 GAAAAAGAACAAAGGAGGCTGGG - Intergenic
1025888105 7:65618296-65618318 GAAAATGAATATATGATGCTGGG + Intergenic
1026120800 7:67535246-67535268 GAAAATGAAGAGAGCAAACTAGG - Intergenic
1026445814 7:70483612-70483634 GAAAATGAAGATCTAAGGCTAGG + Intronic
1026655619 7:72254034-72254056 TAAAATGGGGATATGAGGCTGGG - Intronic
1026806056 7:73430206-73430228 GGAAATGAAGAGGTGAGGCGGGG + Intergenic
1026993824 7:74603138-74603160 GAAAATGCAAAAATGAGGCCGGG + Intergenic
1027007127 7:74704586-74704608 CAAAATGCTGAGATTAGGCTGGG - Intronic
1028088971 7:86673456-86673478 GAAAATGTAGACAGAAGGCTTGG - Intronic
1028108946 7:86915602-86915624 GAAAATTCAGAGTTTAGGCTTGG - Intronic
1028191995 7:87864666-87864688 GAAAATGAAGGGATGGGGAAAGG - Intronic
1028468908 7:91183816-91183838 GACAATGAATAGATAAGGCATGG - Intronic
1028798977 7:94939181-94939203 CTAGATGAAGAAATGAGGCTGGG - Intronic
1029265226 7:99333839-99333861 TAATATGACAAGATGAGGCTGGG + Intronic
1029371063 7:100151000-100151022 AAAAAAAAAGAGATGAGACTGGG + Intronic
1029691214 7:102183307-102183329 AAAAATTAAGAGATGGGGCCGGG - Intronic
1029907536 7:104106435-104106457 GACAAGGCAGAGATGAGCCTTGG - Intergenic
1030002591 7:105081084-105081106 AAAAAAGAATTGATGAGGCTGGG + Intronic
1030011256 7:105170395-105170417 ACAAATGAAGAAATGAGGCCGGG + Intronic
1030263989 7:107597369-107597391 GAGAATGAAGAGGTATGGCTGGG - Intronic
1030492375 7:110254148-110254170 GAAAAGGCAGAAATGAGGCATGG - Intergenic
1030839313 7:114328529-114328551 GAAAAGAAAGGGCTGAGGCTGGG - Intronic
1031160023 7:118155334-118155356 GTAAATGAAGAGATTTGACTAGG - Intergenic
1031873350 7:127110970-127110992 GAATATGGAGAGAAGAGGGTGGG - Intronic
1031943197 7:127811394-127811416 GAAGATCAAGAGATTAGTCTTGG - Intronic
1032380194 7:131471349-131471371 GAAAATGAAGAGAGGTTGGTGGG + Intronic
1032820789 7:135522422-135522444 CAAAATTAAGAACTGAGGCTGGG + Intergenic
1032875701 7:136035810-136035832 GAAAATGAATAGATGATATTAGG - Intergenic
1033302105 7:140195717-140195739 GAAAATGAAGAATTTAGGCCAGG - Intergenic
1033598469 7:142872498-142872520 GAGAAGTCAGAGATGAGGCTGGG + Intronic
1033845036 7:145421451-145421473 GTAAATGAAAACCTGAGGCTAGG - Intergenic
1034189737 7:149204821-149204843 TAAAATGAAGAAAGGGGGCTGGG + Intronic
1034971499 7:155422524-155422546 GAAAATGAGGAGATGATGTGAGG + Intergenic
1036520486 8:9487111-9487133 GAAAATAAGGAAATGAGGCCAGG + Intergenic
1036580731 8:10072829-10072851 GAAAATGAAAAGCTTAGGTTAGG - Intronic
1037220584 8:16515473-16515495 AAAATTGAAGACATGAGGCCGGG + Intronic
1037296660 8:17409161-17409183 AAAAATAAAGTAATGAGGCTGGG + Intronic
1037422979 8:18724101-18724123 GAAGATGAAAATATGAGCCTAGG + Intronic
1037492846 8:19412126-19412148 GAAAATGAGGATAGCAGGCTGGG - Intronic
1037706945 8:21323284-21323306 GGAAGTGAAGAGATAAGGCTTGG - Intergenic
1038021623 8:23555938-23555960 CAAAATGAAGAGTTGAGACCTGG - Intronic
1038433715 8:27520135-27520157 AAAAAAGGAGAGATTAGGCTGGG - Intronic
1038562304 8:28590993-28591015 GAAAATGCATTGAGGAGGCTGGG - Intergenic
1038908379 8:31933575-31933597 TAAAATGAAGATAATAGGCTGGG - Intronic
1039310620 8:36314353-36314375 TAAAATGAGGTCATGAGGCTGGG - Intergenic
1039423700 8:37467679-37467701 GAAAATAATGAGGTGAGTCTTGG + Intergenic
1039909377 8:41812163-41812185 GAAAATGAAGATATTTGGGTTGG - Intronic
1040072640 8:43200946-43200968 GAATTTGAGGAGAAGAGGCTAGG - Exonic
1040727093 8:50394362-50394384 GAAAATGGAGAGAGGAGGATGGG + Intronic
1040903083 8:52437477-52437499 GAGGATGAAGAGGTGAGCCTAGG - Intronic
1041162801 8:55062053-55062075 GTAAAGGAATAAATGAGGCTGGG - Intergenic
1041173667 8:55171331-55171353 AGAAGGGAAGAGATGAGGCTTGG + Intronic
1041351287 8:56950434-56950456 AAATATGAGGACATGAGGCTGGG - Intergenic
1041513959 8:58679429-58679451 GTAAATAGAGAGATGAGGCATGG + Intergenic
1041631180 8:60089118-60089140 AAATATGAAGAGATGAAGTTTGG + Intergenic
1042813799 8:72855522-72855544 GAATATGGAGAGATGATACTGGG - Intronic
1042948439 8:74177308-74177330 GAAAGTAAAGGAATGAGGCTGGG - Intergenic
1043438845 8:80259301-80259323 GAAAAGAAAGAAAAGAGGCTGGG + Intergenic
1043439576 8:80265473-80265495 GAAAAGAAAAAGATGTGGCTGGG - Intergenic
1043508329 8:80924693-80924715 GAAAATGTATGGATGAGGCAAGG - Intergenic
1043586782 8:81779257-81779279 GAGTAGGAAGAGATGAAGCTGGG + Intergenic
1043595505 8:81880729-81880751 GAAAATGGAAAGAGCAGGCTGGG + Intergenic
1044424033 8:92030801-92030823 GAAGATGAGGAGATGAGGAAGGG - Intronic
1044582820 8:93839097-93839119 GAAAAGGAAGAAAGGAGGCCAGG - Intergenic
1044770673 8:95628129-95628151 GAGAAAGAAGAGATGAGTCTTGG + Intergenic
1044835986 8:96296431-96296453 GAAAAAGAACACATGGGGCTGGG - Intronic
1044836849 8:96303993-96304015 GAAAATCCAGAGATAAGGCAGGG - Intronic
1044898762 8:96921896-96921918 GAAAGTGAATAGATGAGGTGGGG + Intronic
1045083998 8:98660804-98660826 GAAAGTGAAGAGAAGAGGGAAGG - Intronic
1045553494 8:103193407-103193429 GAAAATGGAGAAAAGAGGCAGGG - Intronic
1045784296 8:105902731-105902753 AGAAATTAAGAGTTGAGGCTTGG - Intergenic
1046228798 8:111325076-111325098 GAAAATGAAGGAATGGGGTTAGG - Intergenic
1046635452 8:116670287-116670309 GAGAATGCGGAGGTGAGGCTAGG + Intronic
1047257402 8:123225634-123225656 TAAAAGGAAGAGATCAGGCATGG + Intronic
1047715484 8:127591230-127591252 GAAAATGGAGAGAAGAGGAATGG + Intergenic
1047879858 8:129180983-129181005 GAAAAAGAATAGAACAGGCTGGG - Intergenic
1047962742 8:130022802-130022824 AAAAATCAAGAGAGGGGGCTGGG + Intergenic
1048290485 8:133177664-133177686 GAAAATGAAAAGAAGAGGAGAGG - Intergenic
1048334896 8:133495211-133495233 GGAAAAGAATAGAGGAGGCTGGG - Intronic
1048390260 8:133956604-133956626 GAGAAGGAAGAGATTAGGGTAGG - Intergenic
1048969315 8:139635623-139635645 GAAAATAAAGACAGGTGGCTGGG - Intronic
1049056667 8:140242377-140242399 GAGAAAGAACAGATGAGCCTTGG + Intronic
1049820535 8:144630574-144630596 GGAAATGAAGAGGAGAGTCTAGG - Intergenic
1049891067 9:71888-71910 GAAAATGAAAAGGAGAGGGTTGG + Intergenic
1050288644 9:4130619-4130641 GAAATGCAAGAGTTGAGGCTTGG + Intronic
1050354009 9:4765713-4765735 GAAAAGTAAAAGATGAGTCTGGG + Intergenic
1050561537 9:6839609-6839631 AAAAATTAAGACATGTGGCTGGG + Intronic
1050943886 9:11493946-11493968 TCAGAAGAAGAGATGAGGCTGGG + Intergenic
1051109590 9:13620702-13620724 GAAAAAGAAGAAATGAGGGAGGG - Intergenic
1051112566 9:13656048-13656070 AAAAATGAATTGATGAGACTTGG + Intergenic
1052101547 9:24452510-24452532 GAAAATGCAGATATTAGGCATGG + Intergenic
1052681507 9:31699066-31699088 GATAATGAAGATATGAAGATGGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053067103 9:35076487-35076509 CACAATGAAGGGGTGAGGCTAGG + Exonic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053732508 9:41072943-41072965 GAAAATGAAAAGGAGAGGGTTGG + Intergenic
1054695923 9:68358632-68358654 GAAAATGAAAAGGAGAGGGTTGG - Intronic
1054843601 9:69769399-69769421 GAAAAGGAATACCTGAGGCTGGG + Intergenic
1055074565 9:72200289-72200311 GAAAAGAAGGAGAGGAGGCTGGG - Intronic
1055421463 9:76147851-76147873 AAAAAAGAACAGATGTGGCTGGG - Intronic
1055548375 9:77406710-77406732 AAAAAAAAAAAGATGAGGCTGGG - Intronic
1055788721 9:79898902-79898924 GAAAATGTAGAGAAGAGTATGGG + Intergenic
1056202340 9:84288840-84288862 TAAAATGATGTAATGAGGCTGGG - Intronic
1056391494 9:86145476-86145498 GTAAAGGAAGAAAAGAGGCTGGG - Intergenic
1056418510 9:86400998-86401020 GGAAAAGAACACATGAGGCTGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056915615 9:90743499-90743521 CAAAATGCAGACATGATGCTGGG - Intergenic
1057405344 9:94765260-94765282 AAAATTGAAAAGATAAGGCTGGG - Intronic
1057588551 9:96351020-96351042 GAAAATGAAAAACTGAGGATGGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057804049 9:98208231-98208253 GAACCTGAAGACATGAGCCTAGG - Intronic
1057926175 9:99152236-99152258 GAGATTGAGCAGATGAGGCTTGG + Exonic
1058374089 9:104303798-104303820 CAATGTTAAGAGATGAGGCTTGG + Intergenic
1058533870 9:105934336-105934358 GCCAATAAAAAGATGAGGCTGGG - Intergenic
1058666085 9:107317238-107317260 GAGAATGAAGAGATGGGTTTGGG + Intronic
1058745008 9:107981911-107981933 GAAAATGCATGGATGAGGCTGGG - Intergenic
1058793365 9:108472974-108472996 GGAAATCAAGAGATGTGGGTGGG + Intergenic
1059563930 9:115363685-115363707 GAACATTAAGAGATGAGGGTAGG - Intronic
1059583698 9:115581934-115581956 GAAAATAAAGGGAAGGGGCTGGG - Intergenic
1060029170 9:120199379-120199401 AAAAAAAAAGAAATGAGGCTGGG - Intergenic
1060119819 9:120978392-120978414 TAAAATGAAGAGTTGAGTTTAGG + Intronic
1060122446 9:121006546-121006568 GAAAATAAAGACTTGAGGCTGGG + Intronic
1060154011 9:121306313-121306335 AAAAATGAATTGATCAGGCTTGG - Intronic
1060290651 9:122299605-122299627 GATAATGAAAAGAAGAGGTTTGG + Intronic
1060647687 9:125295725-125295747 AAAAATTAACACATGAGGCTGGG - Intronic
1061336402 9:129940489-129940511 GAAAAAGAAGTTATGAGGCGTGG + Intronic
1061826364 9:133260747-133260769 GAGGAGGGAGAGATGAGGCTGGG + Intronic
1062654287 9:137594424-137594446 GAAAATAGAGAGGTGGGGCTGGG + Intergenic
1203366388 Un_KI270442v1:261774-261796 AAAAATGAACAGAGGTGGCTGGG - Intergenic
1185886528 X:3788592-3788614 GAAAAAGAAGAGAAAAGACTGGG + Intergenic
1186338061 X:8613519-8613541 GAAAACCAGCAGATGAGGCTAGG - Intronic
1186604146 X:11071293-11071315 GAAAATGAGGTGATGATGCAAGG - Intergenic
1187037704 X:15559419-15559441 GAAAATGAATGGGTGTGGCTGGG + Intergenic
1187155404 X:16716528-16716550 TAAAAATAAGAGATTAGGCTGGG - Intergenic
1187238990 X:17495619-17495641 GAAGATAAGGATATGAGGCTAGG + Intronic
1187578731 X:20585982-20586004 GTAAGATAAGAGATGAGGCTGGG + Intergenic
1187750320 X:22456435-22456457 GAAAATGTAAGGATGAGGCCGGG + Intergenic
1190080157 X:47350460-47350482 GAAAATGAACAAATAAGGCTGGG + Intergenic
1190157637 X:48006652-48006674 GAAAGTGAAGAGCAGAGGATGGG + Intronic
1190173409 X:48129537-48129559 GAAAGTGAAGAGCAGAGGATGGG + Intergenic
1190271164 X:48864927-48864949 GAAAAAGAAAAAAAGAGGCTGGG - Intergenic
1190478808 X:50854119-50854141 GGAAATGAAGAGATGGGGAAGGG - Intergenic
1190744647 X:53315093-53315115 AAAAATGAAGATAATAGGCTGGG + Intronic
1191699176 X:64021080-64021102 TAAAATGAAGAGATAAGACCAGG - Intergenic
1191785577 X:64914113-64914135 GAAAAAGAAGACAAGGGGCTTGG - Intergenic
1191855512 X:65622393-65622415 GAAAAAGAAGAAATAAGGCAAGG - Intronic
1192295128 X:69839369-69839391 TAAACTGAAGGGAAGAGGCTGGG - Intronic
1192437136 X:71149836-71149858 AAAAATGGTGAGATGTGGCTGGG + Intronic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192492646 X:71589758-71589780 GAAAAGGAAAAAAGGAGGCTGGG - Intronic
1193217927 X:78886481-78886503 GAAAGTGAAGAGCTGAGTGTGGG + Intergenic
1193492546 X:82166966-82166988 AAGAATGAACAGAAGAGGCTGGG + Intergenic
1193987236 X:88258941-88258963 GAATATAAAGAGTTGAGGCTGGG + Intergenic
1194594840 X:95844708-95844730 TAAAATGAAGATAGTAGGCTGGG - Intergenic
1194927938 X:99849219-99849241 TTAGAAGAAGAGATGAGGCTGGG - Intergenic
1195050523 X:101092562-101092584 CAAAATTAAGGAATGAGGCTGGG + Intronic
1195707004 X:107744318-107744340 TAAAATAAAGAGCTCAGGCTGGG + Intronic
1195878586 X:109568906-109568928 GAGAATGAAAATATTAGGCTTGG - Intergenic
1196124274 X:112082654-112082676 GAAAAGGAAGAGCTCAGGGTTGG - Exonic
1196133066 X:112178619-112178641 AAAACAGAAGAGATGAGGATGGG - Intergenic
1196809651 X:119619043-119619065 CAATAAGAAGAGATGAGACTCGG - Intronic
1196929989 X:120672316-120672338 GAGACTGAAGAGATGAGGCAAGG + Intergenic
1197304332 X:124822248-124822270 GAACATGAAGAGATGAATCCTGG + Intronic
1197752592 X:129975742-129975764 AAAATTGTACAGATGAGGCTGGG - Intergenic
1198095424 X:133375665-133375687 GAAAAAGAAAGGAGGAGGCTTGG - Intronic
1198670752 X:139077874-139077896 GAAAAAAAAGTGATGAGGCTAGG + Intronic
1198703400 X:139420977-139420999 GGAGATGAGGAGATGAGGCTAGG - Intergenic
1198875009 X:141215132-141215154 GAAAATGGAGAGATTACACTGGG + Intergenic
1198932596 X:141877571-141877593 GTAAATGAAGGAATGAGGATTGG - Intronic
1198946839 X:142025410-142025432 CAAATTCAAGAGTTGAGGCTTGG + Intergenic
1199284769 X:146043525-146043547 GAAAATGTACATTTGAGGCTGGG - Intergenic
1199300443 X:146207299-146207321 GACAATGAAGATATTAGGTTAGG + Intergenic
1199383558 X:147198419-147198441 GAAAATGGAGAGAGAAGCCTGGG + Intergenic
1199504116 X:148542576-148542598 GAGCATGAAGAACTGAGGCTTGG + Intronic
1199855608 X:151756553-151756575 GAAAGGGAAGAGAAGGGGCTTGG - Intergenic
1200170873 X:154073555-154073577 GAAAATAAAGTCAGGAGGCTGGG + Intronic
1200807953 Y:7451918-7451940 GAAAAAGGAGAAATGAGGTTGGG - Intergenic
1201072301 Y:10158457-10158479 AAAAATGAACAGAGGTGGCTGGG + Intergenic
1201504957 Y:14687968-14687990 GAAACTGAGGAGAAGTGGCTCGG + Intronic
1201706248 Y:16940260-16940282 TCAAAAGAAGAGATGAGGGTCGG + Intergenic
1202174232 Y:22083043-22083065 AAAAATACAGAGATGAGGCAAGG - Intronic
1202217128 Y:22503339-22503361 AAAAATACAGAGATGAGGCAAGG + Intronic
1202326057 Y:23692731-23692753 AAAAATACAGAGATGAGGCAAGG - Intergenic
1202343967 Y:23901620-23901642 AAAAATGAATAGATTAGTCTTGG - Intergenic
1202526801 Y:25768463-25768485 AAAAATGAATAGATTAGTCTTGG + Intergenic
1202544714 Y:25977323-25977345 AAAAATACAGAGATGAGGCAAGG + Intergenic