ID: 1017502099

View in Genome Browser
Species Human (GRCh38)
Location 6:155035035-155035057
Sequence AAAGCTTCGTGGACCCATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017502099_1017502102 -9 Left 1017502099 6:155035035-155035057 CCTATATGGGTCCACGAAGCTTT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1017502102 6:155035049-155035071 CGAAGCTTTCACAGTTAAGGAGG No data
1017502099_1017502105 13 Left 1017502099 6:155035035-155035057 CCTATATGGGTCCACGAAGCTTT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1017502105 6:155035071-155035093 GAAAAGGTAGAAATATGGTTTGG 0: 1
1: 0
2: 3
3: 46
4: 435
1017502099_1017502104 8 Left 1017502099 6:155035035-155035057 CCTATATGGGTCCACGAAGCTTT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1017502104 6:155035066-155035088 AGGAGGAAAAGGTAGAAATATGG 0: 1
1: 0
2: 7
3: 107
4: 1080
1017502099_1017502107 17 Left 1017502099 6:155035035-155035057 CCTATATGGGTCCACGAAGCTTT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1017502107 6:155035075-155035097 AGGTAGAAATATGGTTTGGAGGG No data
1017502099_1017502103 -3 Left 1017502099 6:155035035-155035057 CCTATATGGGTCCACGAAGCTTT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1017502103 6:155035055-155035077 TTTCACAGTTAAGGAGGAAAAGG 0: 1
1: 0
2: 7
3: 32
4: 438
1017502099_1017502106 16 Left 1017502099 6:155035035-155035057 CCTATATGGGTCCACGAAGCTTT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1017502106 6:155035074-155035096 AAGGTAGAAATATGGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017502099 Original CRISPR AAAGCTTCGTGGACCCATAT AGG (reversed) Intronic
1066409626 10:35154240-35154262 AAATCTTCTTGGTCCCACATAGG + Intronic
1085919967 11:80942102-80942124 AAAGCTGAGTTGCCCCATATTGG + Intergenic
1098048404 12:66426690-66426712 AAAGCTTGGTGTACCCAAGTAGG + Intronic
1102011019 12:109618430-109618452 AAAGCTTCCAAGACCCAGATTGG - Intergenic
1106641299 13:31587078-31587100 AATGCTTAGTGGAACCATAGGGG + Intergenic
1126206650 15:46053240-46053262 AAAGCTTCTTGGAGGGATATGGG + Intergenic
1130693605 15:86107862-86107884 AAAGCCTGGTGCATCCATATGGG + Intergenic
1203141221 16_KI270728v1_random:1768050-1768072 AAAGCTGCATGGCCCCCTATTGG - Intergenic
1151636113 17:75349426-75349448 AAACCTTCGAGGACACATGTAGG + Intronic
1158659782 18:59376309-59376331 AAGGCTTCATGTACCCATGTGGG - Intergenic
1159813974 18:73050705-73050727 AAAGCCTAGTGAACACATATGGG + Intergenic
1177717537 21:24858724-24858746 AAAGGTTTTTTGACCCATATGGG + Intergenic
966258714 3:177949959-177949981 AAAGCTTCTTGAAACCATGTGGG - Intergenic
966768710 3:183485057-183485079 AAAGCTTCTTTGACCCATACAGG - Intergenic
980600313 4:135015973-135015995 AAGGCTTCATGGGACCATATGGG - Intergenic
988163099 5:27546896-27546918 AAAGCTTGGTGCACCTTTATGGG - Intergenic
992958493 5:81935116-81935138 GAAGCTTCGTTGACTCTTATTGG + Intergenic
994442349 5:99825335-99825357 ACACCTTCCTGGACACATATTGG - Intergenic
998462906 5:142322751-142322773 AAATCTTCATGGACAAATATTGG - Intronic
1011422148 6:87184793-87184815 AAAGCTTCGAGGACCCTGAGGGG + Intronic
1015040836 6:128716842-128716864 AAAGCTTCGTTTTTCCATATTGG + Intergenic
1017502099 6:155035035-155035057 AAAGCTTCGTGGACCCATATAGG - Intronic
1021601905 7:22372695-22372717 GAAGCTTTGTGTACACATATTGG + Intergenic
1024484387 7:49900682-49900704 GAAGCACCGTGGACCCAGATAGG + Intronic
1032831143 7:135627657-135627679 AAAGCTTCCTTGGGCCATATAGG - Intronic
1035270519 7:157717167-157717189 AAAGCCTCGTGGATCGATTTTGG - Intronic
1055299168 9:74865152-74865174 AAATCTTCCTGGAGCCAAATAGG + Intronic
1056778437 9:89531584-89531606 GAAGCTTCCTGGACCCATGAGGG - Intergenic
1189744049 X:44151573-44151595 AAAGCTGCGTGAAGACATATTGG - Intronic
1190616446 X:52238542-52238564 TGAGCTTCTTGGACCCATGTGGG + Intergenic
1193788192 X:85786063-85786085 AAAGATTCGTGCACCCACATTGG + Intergenic