ID: 1017502102

View in Genome Browser
Species Human (GRCh38)
Location 6:155035049-155035071
Sequence CGAAGCTTTCACAGTTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017502099_1017502102 -9 Left 1017502099 6:155035035-155035057 CCTATATGGGTCCACGAAGCTTT No data
Right 1017502102 6:155035049-155035071 CGAAGCTTTCACAGTTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017502102 Original CRISPR CGAAGCTTTCACAGTTAAGG AGG Intronic