ID: 1017502103

View in Genome Browser
Species Human (GRCh38)
Location 6:155035055-155035077
Sequence TTTCACAGTTAAGGAGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 7, 3: 32, 4: 438}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017502099_1017502103 -3 Left 1017502099 6:155035035-155035057 CCTATATGGGTCCACGAAGCTTT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1017502103 6:155035055-155035077 TTTCACAGTTAAGGAGGAAAAGG 0: 1
1: 0
2: 7
3: 32
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017502103 Original CRISPR TTTCACAGTTAAGGAGGAAA AGG Intronic
900668413 1:3832603-3832625 TTTCAGAGTAAATAAGGAAAAGG - Intronic
901104027 1:6741452-6741474 TCTTACAGTTATGGAGGAAATGG + Intergenic
901895229 1:12306234-12306256 TTTCACAGATGAAGAGGCAAAGG + Intronic
902079999 1:13814271-13814293 TGCAAGAGTTAAGGAGGAAACGG - Intronic
902213649 1:14921422-14921444 TTTAAAACTTAAGAAGGAAAGGG - Intronic
902604295 1:17560261-17560283 TTACACAGTTAATGAGAAATGGG + Intronic
902994969 1:20217281-20217303 TTTCACACTTAAAGAAGCAAAGG + Intergenic
903186990 1:21634437-21634459 TTTCAGAGATAAGGAGGCAGAGG + Intronic
903484404 1:23678913-23678935 TCTCCCAGTTAATGGGGAAAAGG + Intergenic
903639124 1:24846028-24846050 TCTAAGACTTAAGGAGGAAATGG + Intergenic
905803201 1:40859024-40859046 TTCCAGAGTTAAGGGGGAAGCGG - Intergenic
906289424 1:44610272-44610294 TTGCACTGATAACGAGGAAATGG - Intronic
906544917 1:46613915-46613937 TTTCACCCTGAAAGAGGAAAGGG + Intronic
907590221 1:55659606-55659628 TTTCACATGCAAGGAGGTAAAGG - Intergenic
907619696 1:55963953-55963975 TTACAAAGATAAGGAGTAAAAGG - Intergenic
907628380 1:56054500-56054522 TTTCAGAGTGAAGGAAGCAAAGG + Intergenic
908178530 1:61580363-61580385 TTTGGCAGTTAAGAAGGAAACGG + Intergenic
908944603 1:69478915-69478937 TTTGACTCTTTAGGAGGAAATGG - Intergenic
909400672 1:75226107-75226129 TTTTGCAGTTAAAAAGGAAAAGG + Intronic
910279473 1:85482898-85482920 TTTCACAGAAAAGGAAGAAGGGG + Intronic
910893972 1:92048112-92048134 TTAAACAGGTAAGGAAGAAAGGG + Intronic
911581473 1:99638505-99638527 ATTCAAACTTAAGGAGAAAAAGG + Intergenic
911699998 1:100941644-100941666 TTTCACAGTTAAGTGGGCACTGG + Intronic
911803431 1:102174545-102174567 TTTGACAGTTAATGAACAAAAGG - Intergenic
912087162 1:106022733-106022755 TTTCACAGTTAAGTTCAAAATGG - Intergenic
912238767 1:107882540-107882562 TTTAACTGGTAAGGAGGAAGAGG + Intronic
913930321 1:124952804-124952826 TTTCACACGTATGGTGGAAAAGG - Intergenic
913970224 1:143409360-143409382 AATCACAGTTAAGTAGGCAAAGG - Intergenic
914064599 1:144234957-144234979 AATCACAGTTAAGTAGGCAAAGG - Intergenic
914114551 1:144731397-144731419 AATCACAGTTAAGTAGGCAAAGG + Intergenic
915529880 1:156497333-156497355 TTTTATAGAGAAGGAGGAAATGG - Intronic
916856130 1:168752388-168752410 TTTCACAGATAAGGAGGAAGTGG - Intergenic
918691516 1:187486255-187486277 TTTCACAGGTAAAGATAAAAGGG - Intergenic
918745257 1:188189854-188189876 TCTCACAGTTCAGGAGGCAAGGG + Intergenic
919135299 1:193500307-193500329 TTTCAAAGATAAAGAGAAAAGGG + Intergenic
919328542 1:196139346-196139368 TTAGACAGTTAGAGAGGAAAAGG - Intergenic
920767499 1:208847502-208847524 TTTCACAGTTAAGGAGACTGAGG + Intergenic
920886579 1:209935425-209935447 TATCATAGTTACAGAGGAAAAGG + Intergenic
921936132 1:220798814-220798836 TTTCCCTGTTATGGAGGAAATGG - Intronic
922037792 1:221866321-221866343 AGGCACAGTTCAGGAGGAAAGGG + Intergenic
922456952 1:225781935-225781957 TGTCTGAGTGAAGGAGGAAAGGG - Intronic
922874303 1:228927818-228927840 TTTCAAAGAGAAGGAAGAAATGG + Intergenic
923083146 1:230679331-230679353 TTTCACAATGAATGAGGACATGG - Intronic
924461964 1:244267550-244267572 TTACACAGTTAAGAAGAATAAGG + Intergenic
1062847101 10:716179-716201 TTGCACAGTTAACGTGGGAAGGG + Intergenic
1063181398 10:3603861-3603883 TTTCTCAGTTAATGTGGAAAAGG + Intergenic
1063586196 10:7354762-7354784 TTTGTCAGTGAAGGAGGACAGGG - Intronic
1064482715 10:15755451-15755473 TACCATAGTTAAGGATGAAAAGG - Intergenic
1065896445 10:30166980-30167002 TTCCAGAGTATAGGAGGAAAAGG - Intergenic
1065965048 10:30764026-30764048 TTTCACAATTACCAAGGAAAAGG + Intergenic
1067609383 10:47697247-47697269 TTTCACAGAAAAGGAGATAAAGG - Intergenic
1067918133 10:50422636-50422658 GTTTACATTTAAGGAGGAATTGG - Intronic
1068337437 10:55653608-55653630 TTTCAATTTAAAGGAGGAAATGG - Intergenic
1069606905 10:69744453-69744475 TTCCCCAGGGAAGGAGGAAAAGG - Intergenic
1070356364 10:75644300-75644322 CATCACAATTAAGGAGGGAAGGG + Intronic
1070528939 10:77319328-77319350 TTTCACAGGTAAGGCAGAAAAGG + Intronic
1072934705 10:99701070-99701092 GTCCACATCTAAGGAGGAAAGGG - Intronic
1073457410 10:103645963-103645985 TTTTACAGTTAAGAAGGCCAAGG - Intronic
1074273810 10:111981886-111981908 ATTCTCAGTTAAGATGGAAAAGG - Intergenic
1075829370 10:125392558-125392580 TCTGACAGTTATGGAGGGAAAGG + Intergenic
1076858932 10:133130614-133130636 TGTCACAGACAAGGAGGAAGAGG - Exonic
1077006314 11:359228-359250 TTTCACAATTAGGGAGGAGGGGG - Intergenic
1077321223 11:1942984-1943006 TTTCAAAGATTAGGAAGAAATGG - Intergenic
1077675094 11:4188112-4188134 TTTCATAGTTAAGGATTAATTGG - Intergenic
1077959354 11:7057489-7057511 TGACAGAGTTAAGGAGGGAAGGG - Intronic
1078111112 11:8393399-8393421 TTCCACAGTAAAGGAAGAAGTGG + Intronic
1078617391 11:12878701-12878723 TTTCACATTTTAGGAAGAAAAGG - Intronic
1079530729 11:21449189-21449211 TGACATAGATAAGGAGGAAATGG - Intronic
1079892634 11:26076484-26076506 CTTCAATGTTAAGGAGGAATAGG + Intergenic
1080227435 11:29976024-29976046 TATAACAGTTATGGAGGCAAAGG - Intergenic
1080257712 11:30310251-30310273 ATTTACAGTTTAGCAGGAAAGGG - Intergenic
1080790498 11:35518430-35518452 TCTCACCATTAAAGAGGAAAGGG - Intronic
1081183081 11:40007951-40007973 TTCCTCTGTTAAGGAGGAAATGG + Intergenic
1081258059 11:40922086-40922108 TTACTCAGTTTAGGGGGAAAAGG + Intronic
1081637871 11:44732797-44732819 TTTCACAGATAAGGAAGCCAAGG - Intronic
1081785122 11:45740893-45740915 TTTCACAGATAAGGGGAAATTGG + Intergenic
1081819059 11:45973511-45973533 TTTCACATTTAAGGAGGCAATGG - Intronic
1082839025 11:57673410-57673432 TTCCAAAATAAAGGAGGAAAGGG - Intronic
1082959231 11:58903037-58903059 TTTTATACTTAAGGAAGAAATGG + Intronic
1085929267 11:81061646-81061668 TTTCATAGTGAAGCAGGAAAAGG + Intergenic
1085959875 11:81449147-81449169 TTTCACAGTTATGAAAGAATTGG + Intergenic
1087481698 11:98709233-98709255 TTTCACAATGAATGAGAAAATGG + Intergenic
1088369003 11:109067973-109067995 TGTGACTGTTCAGGAGGAAATGG + Intergenic
1088437056 11:109825642-109825664 TTTCACTGTTAAGGCACAAATGG + Intergenic
1088634110 11:111802927-111802949 TTTCTCAGTGAAGTAGGAAGTGG - Intronic
1090523704 11:127506133-127506155 TTTTATAGTTAAGGTTGAAACGG + Intergenic
1091837066 12:3593475-3593497 AGTCACAGTTAAGGAGGAGACGG - Exonic
1092733188 12:11553667-11553689 TTTCACATTCAAGAAGGTAATGG + Intergenic
1094323682 12:29213164-29213186 TGTCACTTTGAAGGAGGAAATGG - Intronic
1095148931 12:38766917-38766939 TTTTACAGGTGAGGAGAAAACGG + Intronic
1095371480 12:41472750-41472772 TTTAACTGTTAAAGTGGAAATGG - Intronic
1095652532 12:44629165-44629187 TTTCACACTGAAGCATGAAAGGG + Intronic
1096116397 12:49058004-49058026 TTTCCCAGACAAGGGGGAAATGG + Intronic
1098131403 12:67354323-67354345 TTTCACAGTGAGGGAGGAAGTGG + Intergenic
1098789751 12:74806493-74806515 ATTCAAAGTTAAGCAGGGAAGGG - Intergenic
1099048397 12:77752673-77752695 TTTTACAGTTGAGGAAAAAAAGG - Intergenic
1099172655 12:79383413-79383435 ATTCATAGTTAGGGAGGAAGTGG - Intronic
1099273399 12:80543803-80543825 TTTCACATTTATGGAGTAATAGG - Intronic
1099286409 12:80717902-80717924 TTTCTAACTTAATGAGGAAATGG + Intronic
1099586614 12:84525097-84525119 TTTCAAGTTTAAGGAAGAAAAGG - Intergenic
1100879075 12:98996206-98996228 TTTCCAAGTTGAAGAGGAAAGGG + Intronic
1101168734 12:102065754-102065776 TTGCAGAGTTAAGGAGAAAGTGG - Intergenic
1102283992 12:111640312-111640334 TTTCACAGGGAAGCATGAAAAGG + Intergenic
1102790428 12:115639775-115639797 TGTCACAATTAGGAAGGAAATGG - Intergenic
1103804334 12:123560636-123560658 TGTCAAAGTGAAGGAGGAAAAGG - Intergenic
1104146875 12:126042836-126042858 TTTTACAGTTAAGAAGAGAATGG + Intergenic
1105334239 13:19450075-19450097 ATTCACTGTAAAGGAGGCAAAGG - Exonic
1105415168 13:20205718-20205740 TCTCACAGTTAGTAAGGAAAAGG - Intergenic
1105860683 13:24409283-24409305 ATTCACTGTAAAGGAGGCAAAGG + Intergenic
1106486025 13:30173348-30173370 CTTCACAGTTTAGGAAGCAAGGG + Intergenic
1107297683 13:38929634-38929656 AGTCTCAGTTAAGGAAGAAAAGG + Intergenic
1107488387 13:40854660-40854682 ATTCACTGTAAAGGAGGCAAAGG - Intergenic
1108206210 13:48092995-48093017 TTTCGCAGTTGGGGAGGACAGGG - Intronic
1108242607 13:48482274-48482296 TTTGACAGTAAAGAAAGAAAGGG - Intergenic
1108628203 13:52253744-52253766 ATTCACTGTAAAGGAGGCAAAGG - Intergenic
1108657856 13:52552705-52552727 ATTCACTGTAAAGGAGGCAAAGG + Intergenic
1108768857 13:53670836-53670858 TTTCACAGTTTGGAAAGAAACGG + Intergenic
1108958707 13:56193329-56193351 TCTCATAGTTAAAGAAGAAATGG - Intergenic
1109075288 13:57826331-57826353 TTTCCAACTTAAGGAAGAAAAGG + Intergenic
1109715860 13:66221005-66221027 TATCTCAGTTGGGGAGGAAAGGG + Intergenic
1110257764 13:73451071-73451093 TTTCTCAGTTAAAGGGAAAAGGG + Intergenic
1111307802 13:86438327-86438349 ATCAACAGTTAAAGAGGAAAGGG - Intergenic
1111443921 13:88320193-88320215 TTGCATATATAAGGAGGAAATGG + Intergenic
1112446894 13:99472308-99472330 TTCCACAGCTAAGGAAGTAAAGG + Intergenic
1112977571 13:105339954-105339976 TTTCACAAATAATCAGGAAAGGG - Intergenic
1113223591 13:108133897-108133919 TTTTGCATTGAAGGAGGAAAGGG + Intergenic
1113477804 13:110597553-110597575 TTTCAGACTTAAGGAAGAACCGG - Intergenic
1113823388 13:113231642-113231664 TTTAACAGTTCAGGAAGGAAAGG + Intronic
1114181443 14:20371451-20371473 TTCCCCAGCTCAGGAGGAAATGG + Intronic
1114861378 14:26527581-26527603 CTACACAGTTAAGTAGCAAAGGG + Intronic
1115342223 14:32304765-32304787 TTTGAGAGTGAGGGAGGAAAAGG + Intergenic
1115785065 14:36816449-36816471 TTTAAAAATTAAGGAGAAAAAGG - Intronic
1116551622 14:46247147-46247169 TTTCAAAGTTCAGGTAGAAAGGG + Intergenic
1116573522 14:46546538-46546560 TACCACAGTTATGGAGGCAAGGG - Intergenic
1116687845 14:48064701-48064723 TGTTAAAGTGAAGGAGGAAAAGG + Intergenic
1118051100 14:62029102-62029124 CATCACAGTTAAGAATGAAATGG + Intronic
1118688227 14:68313043-68313065 TTTCAAAGTTTATGGGGAAAGGG + Intronic
1119745194 14:77038889-77038911 TTTCAAAGAGAAGGATGAAAAGG - Intergenic
1120032154 14:79654061-79654083 ATTCTCAGATAAGGAGGAACTGG - Intronic
1121887382 14:97555937-97555959 TTTCAAAGTTATGTAGCAAAGGG - Intergenic
1122164671 14:99813195-99813217 TTTCTCAGTGAGGGAGGAACAGG + Intronic
1122326720 14:100885112-100885134 TCTCACATCTATGGAGGAAAAGG - Intergenic
1122373579 14:101243162-101243184 TAACTCAGGTAAGGAGGAAAGGG - Intergenic
1123724368 15:23087513-23087535 TTTCACATTTTAGGATTAAAAGG + Intergenic
1126402347 15:48285537-48285559 TTTCTCAGTTAAGATGGAAAGGG + Intronic
1127287209 15:57542314-57542336 TTTCATCCTTAAGAAGGAAAAGG + Intronic
1127767607 15:62202752-62202774 TTTCCCATTTATGGAGGAAGAGG + Intergenic
1128202058 15:65817200-65817222 TTTCACAGTTAAGTGGGCACTGG + Intronic
1128434050 15:67628141-67628163 TTTCACAGTTAAGTGGGCACCGG - Intronic
1128605062 15:69030893-69030915 TTGCACAGTTAAGGAGGGGCAGG + Intronic
1128714361 15:69896592-69896614 TTTCACAGTTAAGGAATCAGAGG + Intergenic
1131197586 15:90368022-90368044 TTTTACAGATAAGGAAGTAAGGG - Intronic
1132423042 15:101690475-101690497 TTGCACAGTCATGGAGGAGAGGG - Intronic
1133425819 16:5688542-5688564 TCTCAGAGCTGAGGAGGAAAGGG - Intergenic
1137380088 16:47990217-47990239 GTTCAGAGTTCAGGAGGAAATGG + Intergenic
1137468521 16:48733121-48733143 TTTTACAGCTAAGGAGGCTAAGG - Intergenic
1137949541 16:52770443-52770465 TTTTACAGATAAGGAGGTCAGGG - Intergenic
1138702717 16:58881264-58881286 TTTCACAGTTCAGGGGGCATTGG - Intergenic
1140722158 16:77781695-77781717 TTCTACAATTAATGAGGAAAGGG - Intergenic
1141299105 16:82796468-82796490 TTCAACAGTGAAGGAGGACAGGG + Intronic
1141407981 16:83810354-83810376 TTTCACACATACAGAGGAAAAGG - Intronic
1203098772 16_KI270728v1_random:1287777-1287799 TTTCAGAATAAAGGAGAAAAGGG + Intergenic
1142803728 17:2360891-2360913 TTTTACAGGTGAGGAGGGAAAGG - Intronic
1143586798 17:7854525-7854547 TTTCACACTTAAAAAGAAAAGGG - Exonic
1143957643 17:10685432-10685454 TTTCACAGTGAAGCACCAAAAGG - Intronic
1144220605 17:13096588-13096610 ATTCTCAGTTAAGCATGAAAGGG + Intergenic
1144425714 17:15139977-15139999 TTTTACAGTTAAGGAAAAAGAGG - Intergenic
1144737093 17:17561293-17561315 TTTCACAGTTAAGAACGCCAAGG + Intronic
1145263901 17:21370298-21370320 TGCCACAGTGAATGAGGAAAAGG + Intergenic
1146230228 17:31101118-31101140 TTTCAGAGTTATAAAGGAAATGG - Intronic
1146835295 17:36105830-36105852 TTTCACAGTTAAGGAAACAGAGG + Intergenic
1146849922 17:36213090-36213112 TTTCACAGTTAAGGAAAGAGAGG + Intronic
1146953166 17:36920636-36920658 TCAAACAGTGAAGGAGGAAAAGG - Intergenic
1148611654 17:48968725-48968747 TAGCACAGTTCAGGTGGAAAGGG - Intergenic
1148803736 17:50252357-50252379 TTTCACAGCTAGAGAGGAGAAGG - Intergenic
1148936138 17:51165973-51165995 TTTCAGAGGTAGGGAGGATAAGG + Intronic
1150106332 17:62465082-62465104 TCTCTGAGTTAGGGAGGAAATGG + Intronic
1153264528 18:3256934-3256956 TTTCACAGTTAATCAGGGAGTGG + Intergenic
1153291920 18:3510083-3510105 TTTATTAGTTAAAGAGGAAAAGG - Intronic
1153484396 18:5582033-5582055 TTTCACACAAAAGGATGAAAAGG + Intronic
1154041129 18:10857312-10857334 TTTCACAGATCAGGAAAAAAGGG + Intronic
1154578781 18:16071506-16071528 TTTCAGGGCTAAGGTGGAAAAGG + Intergenic
1154600302 18:16366049-16366071 TTTCACGGCTAAGGTGAAAAAGG + Intergenic
1154622733 18:16674041-16674063 TTTCAGAGCTAAGGTGAAAAAGG + Intergenic
1154686190 18:17543704-17543726 TTTCAGGGTTAAGGTGAAAAAGG + Intergenic
1154699587 18:17727254-17727276 TTTCAGGGCTAAGGTGGAAAAGG + Intergenic
1154706181 18:17817687-17817709 TTTCAGGGCTAAGGTGGAAAAGG + Intergenic
1154714266 18:17929119-17929141 TTTCAGAGCTAAGGTGAAAAAGG + Intergenic
1154732488 18:18178585-18178607 TTTCAGGGCTAAGGTGGAAAAGG + Intergenic
1154843992 18:19710980-19711002 TTTCAGGGTTAAGGTGAAAAAGG + Intergenic
1156168163 18:34449216-34449238 GTTCACAGTTTAGATGGAAATGG + Intergenic
1156415563 18:36885551-36885573 TTTCAGAGTAAGTGAGGAAAAGG + Exonic
1156589000 18:38464872-38464894 TTTAAGAGGTAAGTAGGAAAAGG + Intergenic
1157221084 18:45828914-45828936 TGTCACAGCCCAGGAGGAAATGG + Intronic
1157675320 18:49564189-49564211 TCTCAGAGTTAAGAAGCAAAAGG - Intronic
1158040804 18:53090857-53090879 TTCCACCTTAAAGGAGGAAATGG + Intronic
1158077302 18:53545496-53545518 TTTCATTTTTAATGAGGAAATGG + Intergenic
1158884557 18:61814549-61814571 TTTGACAGTTTATGAGGAACTGG + Exonic
1159251936 18:65890743-65890765 TTTCACAGTTAGGTAGTAAAGGG + Intergenic
1159274727 18:66202800-66202822 TTTCAGAGTTAAGACAGAAATGG + Intergenic
1159712118 18:71773822-71773844 TTTAATATTTAAAGAGGAAAGGG - Intronic
1159847320 18:73478432-73478454 TTTCAGATTTACTGAGGAAATGG + Intergenic
1163294550 19:16403962-16403984 ATTCACAGTGCAGGATGAAATGG + Intronic
1164915570 19:32049498-32049520 TTACACAGTTAAGCAGGTCATGG - Intergenic
1168550926 19:57292899-57292921 TTTTACATTTAAGGAGATAAAGG + Exonic
925702908 2:6656944-6656966 AGTAACAGTTAAGCAGGAAAAGG - Intergenic
925930592 2:8704394-8704416 TTTGACTCTTAAGGAAGAAATGG - Intergenic
929104927 2:38355473-38355495 TTTCAAAGTAAAAGGGGAAAAGG + Intronic
930326003 2:49918805-49918827 TTTCCCACTTAAGCACGAAATGG + Intronic
930366436 2:50445734-50445756 TTTCACAGCAAATGAGCAAACGG + Intronic
930492681 2:52095300-52095322 TGTCACAGATATGAAGGAAAAGG - Intergenic
931185032 2:59941499-59941521 TTACACAGTAATGGAGGAATCGG + Intergenic
931322146 2:61181678-61181700 TTTCACAGATGAGGAGGCTAAGG - Intronic
931361546 2:61582180-61582202 TTTCACACTTAAAGTGGCAAGGG - Intergenic
932225377 2:70035362-70035384 TTTTATAGTGAGGGAGGAAATGG - Intergenic
932302889 2:70679428-70679450 TTTCACAGTCAAGGAAGGGAGGG - Intronic
932819006 2:74883601-74883623 TCTCTCAGATAAGGAGGAGAAGG - Intronic
932966291 2:76479124-76479146 ATCCACAGTAAAGAAGGAAATGG - Intergenic
934174918 2:89570272-89570294 AATCACAGTTAAGTAGGCAAAGG - Intergenic
934285234 2:91644624-91644646 AATCACAGTTAAGTAGGCAAAGG - Intergenic
935064061 2:99632938-99632960 GTTGAGAGTGAAGGAGGAAACGG + Intronic
935077330 2:99757815-99757837 CTTCATAGCAAAGGAGGAAATGG - Intronic
935565830 2:104606386-104606408 ATTCACAGGAAAGCAGGAAAAGG + Intergenic
935626171 2:105173990-105174012 TTCCACAGTAAAGGAAGAAAGGG + Intergenic
937242162 2:120468894-120468916 TTTCCCAGTCAAAGAGGGAAAGG + Intergenic
938171655 2:129082838-129082860 TGTCAAAGATATGGAGGAAATGG - Intergenic
938741422 2:134236034-134236056 TTTCTCAGTTAAGTTGAAAATGG + Intronic
938837120 2:135116465-135116487 ATTCAGATTTAAGGAGAAAATGG + Intronic
940375409 2:152952526-152952548 TATCATAGTTAATAAGGAAATGG + Intergenic
940466467 2:154034919-154034941 TAGCAAAGATAAGGAGGAAATGG + Intronic
941036254 2:160572082-160572104 TATCACAGTAAAGGAGGAAAGGG - Intergenic
942539969 2:177005901-177005923 TTTCGCAGCTAAAGAGGAGAAGG + Intergenic
942695133 2:178633651-178633673 TTTCACAGTGAAGTAGGGATCGG + Exonic
943070903 2:183139542-183139564 TTAAAGAGTTAAGGAGGGAAGGG + Intronic
943334181 2:186593722-186593744 TCTTACAGATGAGGAGGAAATGG + Intronic
943862623 2:192888479-192888501 CTTCACAGGGCAGGAGGAAATGG + Intergenic
944020765 2:195100851-195100873 TTTCACTGTAAACGAGGTAAAGG - Intergenic
944184696 2:196934418-196934440 TTTAACTGTTTAGGGGGAAAGGG + Intergenic
944632833 2:201643874-201643896 TTTTACAGTTAAGAAAGAAATGG + Intergenic
946576304 2:221079425-221079447 TTTAAGTGTTAAGGAGTAAAGGG + Intergenic
947148479 2:227089953-227089975 TATCACTGTCAAGGAGGTAAGGG + Exonic
947859935 2:233351708-233351730 TTTTAGAGTCAAGGAGGCAAGGG - Intergenic
948208575 2:236176500-236176522 TTTTATAGTTAATGAGGGAATGG + Intergenic
1169024491 20:2357476-2357498 TTTCAGAGGTGAGGAGCAAAAGG - Intergenic
1169556046 20:6751493-6751515 TTTTTAAGTTAATGAGGAAAAGG + Intergenic
1169675188 20:8145114-8145136 TCTCACAGTTTGGGAGGAAGTGG + Intronic
1169904662 20:10590193-10590215 TTTCATAATTAATTAGGAAAAGG - Intronic
1170434787 20:16315265-16315287 GTTCAGATTTTAGGAGGAAAAGG + Intronic
1170715254 20:18825366-18825388 TTTAAAAGTTAATGAAGAAAAGG + Intronic
1171507169 20:25646932-25646954 TTTCTCAGTTGAAGGGGAAAGGG + Intergenic
1172453616 20:35048118-35048140 TTTCACAGACAAGAAAGAAATGG - Intronic
1173021678 20:39272680-39272702 TTTCACAGTTCAGAGGGCAAAGG + Intergenic
1173693154 20:44981701-44981723 ATTCATAGTTAAGGATAAAATGG - Intronic
1173878243 20:46390340-46390362 TTTCACATTTTAGGATTAAAAGG - Intronic
1175848187 20:62070179-62070201 TTTCAAAGCTCAGGAGTAAACGG + Intergenic
1176760455 21:10778931-10778953 TTTGAGAGCTAAGGTGGAAAAGG + Intergenic
1177782103 21:25632696-25632718 TTTCACAGTTAAGGAAAATGAGG - Intergenic
1178266568 21:31148091-31148113 TTGGAAAGTAAAGGAGGAAAAGG - Intronic
1179421553 21:41240526-41240548 TTTCACAGGGAAGGAAGCAAAGG + Intronic
1180100817 21:45584223-45584245 CTACACAGTTAGGGTGGAAATGG - Intergenic
1180174652 21:46081749-46081771 TTTCACAGCTGAGGAGGAGAGGG + Intergenic
1180871972 22:19151252-19151274 TTTCAAAGGTCAAGAGGAAAGGG - Intergenic
1181167000 22:20989200-20989222 TTTCTAAAATAAGGAGGAAAAGG - Intronic
1181615595 22:24052107-24052129 TGTTACAGTGAAGGAGGAAAAGG + Intronic
1182946031 22:34322877-34322899 TTTCTCAGTGAAGGAGGAAGAGG - Intergenic
1183686565 22:39364346-39364368 TTTCACAGTCAGGGAGGCTAAGG - Intronic
951225060 3:20111248-20111270 TTTTACAGGTAAGGAAGGAAAGG + Intronic
951710407 3:25580875-25580897 TTTCACAGATAAGGAGCCAGAGG - Intronic
951835579 3:26979940-26979962 TTTCGAAGTTAAGCAGAAAAGGG + Intergenic
952832633 3:37577718-37577740 TTTCACAGTAGATGTGGAAATGG - Intronic
953790734 3:45945984-45946006 TTTCACAATTTATTAGGAAATGG + Exonic
954895311 3:53970193-53970215 TTTCAAGTTTAATGAGGAAAGGG - Intergenic
955209379 3:56926627-56926649 TTTCACATTACAGGAGGGAATGG - Intronic
955281961 3:57602283-57602305 TTACAAAGGTTAGGAGGAAATGG - Intergenic
955653535 3:61220261-61220283 TTTCACCGATATGCAGGAAAAGG - Intronic
956065128 3:65389863-65389885 TTTCTCCCTTGAGGAGGAAAAGG + Intronic
956847916 3:73200825-73200847 TTTGGTAGTTAAGGAGGTAATGG - Intergenic
957303952 3:78431775-78431797 TTACACAGAAAAGTAGGAAAAGG + Intergenic
957653616 3:83040546-83040568 TTTAAAAGTTGAGGAGGAAAGGG - Intergenic
958258514 3:91352274-91352296 TTTCACAGTGAGGGAGGAAAAGG - Intergenic
958567678 3:95835667-95835689 TTCCATATTTAAAGAGGAAAGGG + Intergenic
958796313 3:98710033-98710055 TTTTACAGTTAAGGAGGTAGGGG + Intergenic
959629695 3:108493931-108493953 TTTCACTGATAAGGAAGAAAGGG - Intronic
959759887 3:109948487-109948509 CTTTACAGTCAAGGAGGCAATGG + Intergenic
960170183 3:114451838-114451860 ATTCACAGTCGAGGAGAAAAGGG - Intronic
960670618 3:120152384-120152406 TTATATAGTTAAGCAGGAAAAGG - Intergenic
960754601 3:120997424-120997446 TGGCACAGTTATGGAGAAAAGGG - Intronic
961933575 3:130559520-130559542 TTGCACAATTAAGCAGGACATGG + Intergenic
961933602 3:130559842-130559864 TGTTTCAGTTAGGGAGGAAAAGG + Intergenic
962594794 3:136930214-136930236 TTTGAAAGTTGAGAAGGAAAAGG + Intronic
962764319 3:138547394-138547416 GTGCACAGTTAAGATGGAAAAGG - Intronic
962852904 3:139320956-139320978 TTTCACTGTTAAGAAACAAAAGG + Intronic
963118492 3:141754677-141754699 TTTCACAGTAAAGGAAGAAAAGG + Intergenic
964037152 3:152213329-152213351 GATCACAATTAAGGAAGAAATGG + Intergenic
964271402 3:154960031-154960053 TTTCACAGCTGATGAGGAGATGG - Intergenic
964900008 3:161647239-161647261 CTTCAAATTTAAAGAGGAAAGGG + Intergenic
966135422 3:176692784-176692806 TGTCCCAGTTAAAGAGAAAATGG + Intergenic
966284103 3:178272840-178272862 TTTTACAGTTCAGCTGGAAAAGG + Intergenic
966678414 3:182614193-182614215 TTTCCCAGTTAAGCAGGTGATGG - Intergenic
966837938 3:184063910-184063932 TTTCACAGTTTGGGAGGGAGTGG + Intergenic
967258561 3:187619059-187619081 AGTCACAGTTAAAAAGGAAAGGG - Intergenic
969234969 4:5859307-5859329 CTTCACAGGTGAGGAGGATAAGG + Intronic
969299027 4:6286555-6286577 ATTCACTCTTAAGAAGGAAAAGG + Intronic
969828773 4:9779217-9779239 AATCACAGTTAAGTAGGCAAAGG - Intronic
970310555 4:14778013-14778035 TTTCATGGTGAAGAAGGAAAAGG - Intergenic
970997829 4:22288106-22288128 TATCACACATAAGGAGGAAATGG + Intergenic
971711667 4:30120622-30120644 TTTCAGAGGTATGGAGAAAATGG - Intergenic
972815316 4:42638603-42638625 TTTTCCAGTTAAGCATGAAATGG - Intronic
973230394 4:47834437-47834459 TTTCCCAGAGGAGGAGGAAATGG + Intronic
974160167 4:58128619-58128641 TTTTCCAGTTAATGAGCAAAAGG - Intergenic
974342318 4:60630080-60630102 TGTCAAGGTTATGGAGGAAAGGG - Intergenic
974507287 4:62792119-62792141 TTTCACTCTTATGGAGGAGATGG - Intergenic
974984108 4:68997921-68997943 TTTTCCAGTTTAGGAAGAAAAGG - Intergenic
974996368 4:69164718-69164740 TTTCACAGTTGTGGAGGTTAGGG - Intronic
975009350 4:69329648-69329670 TTTCACAGTTGTGGAGGTCAGGG - Intronic
976837040 4:89386432-89386454 CTTTACAGTCTAGGAGGAAAGGG - Intergenic
978813944 4:112881834-112881856 TTTCACAGTTAAGTGGGCACCGG + Intronic
979410974 4:120379343-120379365 TTTAATAGTTAGGCAGGAAAAGG - Intergenic
979541075 4:121883142-121883164 TTTCACATTTAAGATGCAAATGG - Intronic
979676346 4:123414026-123414048 TTTAGCAGTTAAAGAGAAAAAGG - Intergenic
980725456 4:136754010-136754032 TATCAGATTTAAGTAGGAAATGG - Intergenic
982030061 4:151291887-151291909 TGTTACAGTTGAGGAGTAAAGGG - Intronic
982527362 4:156495979-156496001 TCCCACAGTTGAGAAGGAAAAGG - Intergenic
983067299 4:163226222-163226244 TTTCACATGATAGGAGGAAAAGG - Intergenic
983177967 4:164614136-164614158 ATTCACAATTAATGAAGAAAGGG - Intergenic
983938291 4:173518166-173518188 TTCCACAGTTAAAGAGGACCGGG + Intergenic
983993373 4:174150490-174150512 TTGCACGGTGAGGGAGGAAATGG - Intergenic
984694430 4:182765467-182765489 TTGGGCAGTTAAGGAGCAAAAGG - Intronic
984895489 4:184535904-184535926 TTACACAGCTAAGGGGTAAAGGG + Intergenic
985042044 4:185900527-185900549 TTTCACAATTAATGAGAAATGGG - Intronic
986231468 5:5868058-5868080 TTTATTATTTAAGGAGGAAAGGG - Intergenic
989271397 5:39537684-39537706 TTTGAAAGATGAGGAGGAAATGG + Intergenic
989863135 5:46408727-46408749 TTTGAAAGTTATGGTGGAAAAGG + Intergenic
990609944 5:57446925-57446947 TTTTACAGATAAGGAAGCAAAGG - Intergenic
991015474 5:61927418-61927440 TTCCAAAGATCAGGAGGAAATGG + Intergenic
991278501 5:64881836-64881858 TTTGAGAGTTGAAGAGGAAATGG - Intronic
992071262 5:73151307-73151329 TTGCACAGGAAGGGAGGAAATGG + Intergenic
992904429 5:81332232-81332254 TTTTACATTTACGTAGGAAAAGG + Intronic
993235041 5:85293723-85293745 TTGTACAGTTAAGGTGTAAAGGG + Intergenic
993583726 5:89697122-89697144 TTTCACATTCAAGGAGTAAAAGG - Intergenic
994775751 5:104034229-104034251 TATAACAGTTATGGAGGCAAGGG - Intergenic
994980254 5:106865609-106865631 TTTCAGATTGTAGGAGGAAAGGG - Intergenic
994989617 5:106980992-106981014 TATAACAGTTATGGAGGCAAGGG - Intergenic
995984099 5:118147207-118147229 TTTCTGAATTCAGGAGGAAAAGG - Intergenic
997822405 5:137077946-137077968 TTTTACAGATGAGAAGGAAAAGG + Intronic
998052048 5:139043915-139043937 TTTCAGAGGTGAGGAGGAAGGGG + Intronic
998261486 5:140635101-140635123 TTTCTCAATTAAAGAGGAAGTGG - Intergenic
999226002 5:150025261-150025283 TTAAGCATTTAAGGAGGAAAAGG - Intronic
999617689 5:153442290-153442312 TTTCATTGTTAAGGATGCAAGGG - Intergenic
999813866 5:155155816-155155838 TTTCACAGTTGAGAAATAAAGGG + Intergenic
1000186698 5:158865387-158865409 TTTTACAGATAAGGAGGCAGAGG - Intronic
1000782853 5:165505404-165505426 TTTCAGACTTAAGTAGCAAATGG - Intergenic
1000937705 5:167322620-167322642 TTTCACCTTTAAGGAAGAATGGG - Intronic
1001118724 5:168961122-168961144 TTTAGCAGTGAAGGGGGAAAGGG - Intronic
1001857138 5:175022792-175022814 GTTCAAGGTTAAGGAGAAAATGG + Intergenic
1002074379 5:176699424-176699446 GTACACAGTGAAGGAGGGAAGGG - Intergenic
1003147874 6:3524087-3524109 TTTTATGGTTAAGGAGGCAAAGG + Intergenic
1004342277 6:14818187-14818209 TCTCACAATGCAGGAGGAAAGGG + Intergenic
1004507927 6:16262082-16262104 TATAACAGTTATGGAGGCAAGGG + Intronic
1004967048 6:20864181-20864203 TTTCAAAATTAATGGGGAAAGGG - Intronic
1006258550 6:32850220-32850242 TTTCCCAGTAAAGGAGGAGTGGG + Intronic
1006571828 6:35011947-35011969 TTTCAGAGCTGAGGAAGAAAAGG + Intronic
1006804539 6:36779604-36779626 TTTCACAGCTAAGAAGCCAAAGG + Intronic
1008753744 6:54768692-54768714 CTTCACATTTATGGGGGAAAAGG - Intergenic
1008996749 6:57668413-57668435 TTTCACAGTGAGGGAGGAAAAGG + Intergenic
1009185264 6:60567749-60567771 TTTCACAGTGAGGGAGGAAAAGG + Intergenic
1009315343 6:62212381-62212403 TATGAGAGATAAGGAGGAAAGGG + Intronic
1009684809 6:66943544-66943566 TCTCACAGTTCTGGAGGGAATGG + Intergenic
1010871821 6:81052058-81052080 ATTCACAGTCACGGAGGAAGGGG + Intergenic
1012351612 6:98258041-98258063 TTTTCCTGTTCAGGAGGAAAGGG + Intergenic
1012733093 6:102906387-102906409 TTCCACATTTAAAGAGGAAGAGG - Intergenic
1012849443 6:104429286-104429308 TCTCACAGTTCTGGAGGAACTGG - Intergenic
1013283330 6:108659296-108659318 TTTCACATTTAAGAAAGAATAGG - Intronic
1013572589 6:111444577-111444599 TTCCACAGAAAAGGAAGAAAAGG + Intronic
1013643872 6:112116293-112116315 TTTCACAAGTGAGGAGGACAGGG + Intronic
1014867772 6:126552731-126552753 TTTTAGAGTCAAGTAGGAAAAGG + Intergenic
1014894079 6:126879554-126879576 TTTTACAGTTAATGAGTACATGG - Intergenic
1015473375 6:133632046-133632068 TTGCAAAGTTAAGGAGGAGCTGG + Intergenic
1015477111 6:133666390-133666412 TTGCAAAGTTAAGGACAAAAGGG + Intergenic
1015484917 6:133758459-133758481 CTTCATTGTTAAAGAGGAAAAGG - Intergenic
1015745257 6:136503201-136503223 TTTCAGAATAAAGGAGGGAAAGG - Intronic
1016679635 6:146813812-146813834 TGTCTGAGTTAGGGAGGAAATGG - Intronic
1017502103 6:155035055-155035077 TTTCACAGTTAAGGAGGAAAAGG + Intronic
1017688602 6:156940292-156940314 TTTCCTATTTAAGGAAGAAAGGG - Intronic
1017741747 6:157412644-157412666 CTTCACAATTCAGGTGGAAATGG + Intronic
1018146778 6:160898946-160898968 TTTCATATTTAAGGAAGAAATGG + Intergenic
1020367387 7:7394908-7394930 GTTCACTCTTAAGGAGAAAAAGG + Intronic
1020473148 7:8562466-8562488 ATTCAGAGTTATAGAGGAAAAGG - Intronic
1021218075 7:17940970-17940992 TGTCAAAGTTTAGGAGAAAAGGG - Intergenic
1021267139 7:18538865-18538887 TCTTACAGTTCAGGAGGATAGGG + Intronic
1021456726 7:20837214-20837236 TTTCCCAGTTGAAGAGAAAAAGG - Intergenic
1022033201 7:26511067-26511089 TTTCACTGCTGAGTAGGAAAAGG - Intergenic
1022283723 7:28935370-28935392 CTTCACAGTTATGGAGATAATGG + Intergenic
1022648586 7:32254468-32254490 TTTTAAAGTTATGGAGGAAAAGG - Intronic
1022660332 7:32361014-32361036 TTTTACAGGCATGGAGGAAAGGG + Intergenic
1022799798 7:33765455-33765477 TTTAACAGTTTAGTAAGAAAGGG + Intergenic
1023148322 7:37174970-37174992 TTTCTCAATAAAAGAGGAAAGGG + Intronic
1023245221 7:38195944-38195966 TTTCTCAGTTAACAAGGAGAAGG - Intronic
1023300990 7:38770710-38770732 TGTCACAGTTAACAAGGAAAGGG + Intronic
1023337896 7:39189049-39189071 TTTCTCAGTTAAAGAGTACAAGG - Intronic
1023567041 7:41533579-41533601 TTTGACAGATATGTAGGAAAGGG + Intergenic
1023922158 7:44638073-44638095 TGTCACTGATAAGGGGGAAAAGG - Intronic
1026190823 7:68124944-68124966 TTTCACAGGGCTGGAGGAAAGGG + Intergenic
1026626606 7:71998358-71998380 TTACACAATTTAGAAGGAAAAGG - Intronic
1027380663 7:77605912-77605934 TTTTAGAGTACAGGAGGAAATGG - Intronic
1028248131 7:88507677-88507699 TTTCACACTTGAGGAGAATAGGG + Intergenic
1028454764 7:91027001-91027023 CTCCACAGTTACGCAGGAAAGGG - Intronic
1028559197 7:92154935-92154957 GTGCTCAGTTAAGAAGGAAAAGG - Intronic
1028939404 7:96504031-96504053 CTTAAAAGTTCAGGAGGAAAGGG + Intronic
1028963262 7:96773809-96773831 TTACACAGTAAAGAAGAAAAAGG + Intergenic
1029680336 7:102104157-102104179 TTTAACATTTAGGGAGTAAAAGG + Intronic
1030889711 7:114984275-114984297 ATTCACAGTCTAGTAGGAAAAGG - Intronic
1032035395 7:128517670-128517692 TCTCTGAGTTAGGGAGGAAATGG + Intergenic
1032542492 7:132714941-132714963 TTTCACATTGAAGGAGGGATAGG - Intronic
1032808188 7:135379478-135379500 GTTAACAGTTTAGAAGGAAAAGG + Intronic
1033269136 7:139914779-139914801 ATTTACAGTGAAGGAGGATATGG + Intronic
1033345016 7:140519778-140519800 TTTCTCTGGTAGGGAGGAAATGG - Intronic
1033496005 7:141897023-141897045 TTTTAAAGTTATGGGGGAAAAGG - Intergenic
1034084003 7:148307082-148307104 TCTCACAGCTAAGAAGGAAGAGG + Intronic
1034471451 7:151256756-151256778 TTTCTCAGTGAAGGGGAAAACGG - Intronic
1034524978 7:151653050-151653072 GTTCAGAGAAAAGGAGGAAAGGG - Intronic
1035441376 7:158904182-158904204 TTTCACAGTTAAGGAAAATGAGG - Intronic
1036529844 8:9574827-9574849 TTTTATAATTAAGGAAGAAATGG - Intronic
1036782558 8:11659536-11659558 ATTCTCAGGAAAGGAGGAAAAGG - Intergenic
1037032337 8:14124299-14124321 TTTCACAGTAAAGGTAAAAAGGG - Intronic
1037336380 8:17796494-17796516 TTACACAATCAAGGAAGAAAGGG - Intronic
1038245533 8:25851279-25851301 TTTTACATTTAATGAGGAAGTGG - Intronic
1038468639 8:27790946-27790968 TTTTACAGAGAAGGATGAAAGGG - Intronic
1038843977 8:31211935-31211957 TTCCACAGTTAATGAGTGAATGG + Intergenic
1040008555 8:42641729-42641751 TTTCTCTGTGAAAGAGGAAAGGG - Intergenic
1040980233 8:53239448-53239470 ATTCAGAGTCAATGAGGAAATGG + Intronic
1041741760 8:61164297-61164319 TTAGACAGATAGGGAGGAAAAGG + Intronic
1043004768 8:74805492-74805514 CATCACAGTTAAAAAGGAAATGG - Intronic
1043071866 8:75646489-75646511 TTTCACAAGAAATGAGGAAAAGG + Intergenic
1044382837 8:91554455-91554477 ATGTATAGTTAAGGAGGAAACGG + Intergenic
1045104931 8:98883224-98883246 TTCCACAGCTAAGGGGGAGAGGG + Intronic
1045448474 8:102292968-102292990 TTTTCCAGAAAAGGAGGAAAAGG + Intronic
1046311376 8:112441723-112441745 GTTCAGAGTGAAGGGGGAAAAGG + Intronic
1046907979 8:119594673-119594695 TTGCACAGCTAAAGATGAAAGGG - Intronic
1047861213 8:128969399-128969421 TTTCACAGCTGAGGAGGTGAAGG - Intergenic
1048155596 8:131946235-131946257 TCACATAGTTAAGGAGAAAATGG + Intronic
1048299071 8:133238455-133238477 CTCCTCAGTTAAAGAGGAAACGG + Exonic
1048509072 8:135045983-135046005 TTTCAGAGAAGAGGAGGAAAAGG + Intergenic
1048685198 8:136897133-136897155 TTTCACAGTTAGAAGGGAAAGGG + Intergenic
1050768868 9:9171418-9171440 TTTCACAGGGAAATAGGAAAAGG + Intronic
1051445353 9:17134692-17134714 TTTCACAGTTAAGGATCATTTGG + Intergenic
1052030144 9:23619285-23619307 TATGACAGATAAGGAGAAAATGG + Intergenic
1052051350 9:23851855-23851877 CATCACAGTTAAGTTGGAAACGG - Intergenic
1052870351 9:33500075-33500097 TTTAGCATTTAAAGAGGAAAGGG + Intergenic
1053587267 9:39472178-39472200 TAACAGAGTTAAAGAGGAAAAGG + Intergenic
1054579038 9:66893055-66893077 TAACAGAGTTAAAGAGGAAAAGG - Intronic
1055079339 9:72253275-72253297 ATTCTCAGATAAGGAGGAACTGG + Intronic
1055893116 9:81144418-81144440 TTTCACAGATGAGGAGGCTAAGG + Intergenic
1060783762 9:126433133-126433155 TTTTACAGGTAAGGAGACAAAGG - Intronic
1061307258 9:129739279-129739301 TTTCACTGTTAGGGAGGGAGAGG + Exonic
1186888970 X:13941497-13941519 TTTAACTGTTAAGGAGTTAAGGG - Intergenic
1186911766 X:14174687-14174709 TGTGACAGTCAAGGAGGATAAGG - Intergenic
1187613752 X:20971211-20971233 TTTCACAGTTGAGGAATCAAAGG + Intergenic
1188552080 X:31375444-31375466 TTTCACAGATTAGGAATAAAAGG - Intronic
1188682208 X:33024839-33024861 TTTCACAGTTAAAGACGCTAAGG - Intronic
1189052567 X:37662015-37662037 TTTCACAGATAAAGAGACAAAGG - Intronic
1189672048 X:43421959-43421981 TTTCAGAGTAATGGAAGAAATGG - Intergenic
1191007401 X:55724289-55724311 TTTCACAGTTAACAAACAAAGGG - Intronic
1191189366 X:57650146-57650168 TTTCAAATTTAAAGGGGAAAGGG + Intergenic
1191630925 X:63321381-63321403 TGTCAAAGTTATGGAGAAAAAGG + Intergenic
1195559073 X:106262740-106262762 TTGCACAGAGAAAGAGGAAAGGG + Intergenic
1195766987 X:108306497-108306519 TTTCCTAATTAAGGAGAAAATGG + Intronic
1196324273 X:114383891-114383913 TTTCACAGGTTAGAAGGATAAGG - Intergenic
1196614672 X:117754336-117754358 GTTAACAGTTAAGTAGGAAAGGG - Intergenic
1197163881 X:123354379-123354401 TTTCAAACTAAAGCAGGAAAAGG + Intronic
1197912754 X:131502531-131502553 TTTCTTACTTAAGGAGGAATGGG - Intergenic
1198218039 X:134574651-134574673 TATCACAGGGATGGAGGAAAAGG - Intronic
1198912165 X:141626941-141626963 TTCCACAGTAAAAGAGGAAAAGG + Intronic
1199066827 X:143429187-143429209 TTTTACAGATAAGGAGGATGAGG - Intergenic
1199513887 X:148654278-148654300 TTTGGCAGTTAAGGAGTAATTGG + Intronic
1201493552 Y:14568901-14568923 TTTCAAAGATATGGAGGATATGG + Intronic
1202064016 Y:20918234-20918256 TTCCACAGTTAAGAAGGTAAGGG - Intergenic
1202597557 Y:26558114-26558136 ATTCACTGTAAAGGAGGAAAAGG + Intergenic