ID: 1017502104

View in Genome Browser
Species Human (GRCh38)
Location 6:155035066-155035088
Sequence AGGAGGAAAAGGTAGAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1195
Summary {0: 1, 1: 0, 2: 7, 3: 107, 4: 1080}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017502100_1017502104 -3 Left 1017502100 6:155035046-155035068 CCACGAAGCTTTCACAGTTAAGG 0: 1
1: 0
2: 0
3: 1
4: 86
Right 1017502104 6:155035066-155035088 AGGAGGAAAAGGTAGAAATATGG 0: 1
1: 0
2: 7
3: 107
4: 1080
1017502099_1017502104 8 Left 1017502099 6:155035035-155035057 CCTATATGGGTCCACGAAGCTTT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1017502104 6:155035066-155035088 AGGAGGAAAAGGTAGAAATATGG 0: 1
1: 0
2: 7
3: 107
4: 1080

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017502104 Original CRISPR AGGAGGAAAAGGTAGAAATA TGG Intronic
900135338 1:1114888-1114910 AGGATAAAAAGCTACAAATAGGG + Intronic
900310926 1:2032765-2032787 AGGAGGACAAGGCAGAGATGGGG - Intergenic
900995143 1:6118558-6118580 GGGAGGAAGAGGAAGAAATGGGG + Intronic
900996336 1:6125320-6125342 AGGAGGAGAAGGTAGGAAGGGGG + Intronic
901605430 1:10455460-10455482 TGGAGGAAAAGCTAGAATTTTGG + Intergenic
901675317 1:10880022-10880044 AGGAGGAGAGGGCAGAAATCAGG - Intergenic
901920947 1:12537265-12537287 AGGAGGAAAATGAAGGAATTGGG - Intergenic
902090532 1:13899409-13899431 AGGAAGAACAGGAATAAATAGGG - Intergenic
902221882 1:14971563-14971585 AAGAGGAAAAGAGTGAAATAGGG + Intronic
902460586 1:16573156-16573178 ATGAGGAAGAGGAAGAAAAAGGG - Exonic
902770418 1:18642663-18642685 AAGAGGAAAAGGTGGAAATGGGG + Intronic
903000516 1:20262340-20262362 AGGAAGGGAAGGAAGAAATAAGG - Intergenic
903001904 1:20272340-20272362 AGGAGGGAAAGTAAGAAATCAGG - Intergenic
903180836 1:21604055-21604077 AGGAGGCAATGGGAGAGATAGGG + Intronic
903227237 1:21900626-21900648 AGGAGGGAGAGGTACAGATACGG + Intronic
904270313 1:29345412-29345434 AGGAGGAAAAGAAAGACAGAAGG + Intergenic
904327949 1:29739618-29739640 AGTAGGAAAAGAAAGAAATTTGG - Intergenic
904389391 1:30171844-30171866 AGGAGGAAAAGCCATCAATAGGG - Intergenic
904480708 1:30791614-30791636 AGGAGGAAGAGAGAGAAGTAAGG + Intergenic
904692643 1:32305713-32305735 AGGAGGCTGAGGTAGAAAGATGG - Intronic
904741058 1:32676178-32676200 AGGAAGAAAAGAAAGAAGTACGG + Intronic
904848841 1:33441575-33441597 AGGAAGAAAAAGGAGAAAAAAGG - Intergenic
905032129 1:34892418-34892440 AAGAGGAAAAGGAAGAGATAGGG + Intronic
905503825 1:38460544-38460566 AAAAGGAAAAGGAAAAAATACGG + Intergenic
905589219 1:39147495-39147517 AGGAGGAAAAGAAAGAAAGAAGG - Intronic
906558921 1:46739581-46739603 AGGAGGAAAAGGGGGAAGGAGGG - Intergenic
907024080 1:51098034-51098056 AGAAGTAAAAAGTAGAATTAAGG + Intergenic
907172251 1:52479358-52479380 AAGAGGAAAGGGTAGACACAGGG + Intronic
907379759 1:54076696-54076718 AGAAAGAACAGGTAGAAATCAGG + Intronic
907512231 1:54970305-54970327 AAAAGGAAAAGGTATAAAGAAGG - Intergenic
907637678 1:56152597-56152619 AGGGGGAAAAGGTAGAAGCCAGG + Intergenic
908151232 1:61305097-61305119 AGGAGAAAACGGTGGAAATGCGG + Intronic
908290678 1:62664186-62664208 AGAATGAATAAGTAGAAATAGGG + Intronic
908487227 1:64606644-64606666 ACAAGGCAAAGGTAGAAGTAGGG + Intronic
908633180 1:66133116-66133138 AGGAGGAAGAGGAGGAAATTGGG + Intronic
908982279 1:69973281-69973303 AGGGGGAAAGGGTAGGAAAAGGG + Intronic
909517961 1:76533584-76533606 TGGAGGGAATGGAAGAAATATGG - Intronic
909542068 1:76802493-76802515 AAGATGAGAAGGAAGAAATAGGG + Intergenic
909601274 1:77464191-77464213 AGGAAGAAAAGGGGGAAACAGGG + Intronic
909610329 1:77545207-77545229 AGGAGGAAAAGGAGGAAGTGAGG - Intronic
909615967 1:77608061-77608083 AGGAGGCAAAGAAAGACATAGGG + Intronic
909666045 1:78134605-78134627 AGGAAGAAAAGGGAGAGATGTGG - Intronic
909842853 1:80350997-80351019 AGAAGGATGAGGTAGAGATAGGG - Intergenic
910068233 1:83179818-83179840 AGGAGGAAAAAAAACAAATAAGG + Intergenic
910071397 1:83218485-83218507 AGGACCAAAAGGAAGGAATAAGG + Intergenic
910338375 1:86157446-86157468 AGGGAGGAAAGGTAGAAATGAGG - Intergenic
910476490 1:87613168-87613190 AGGGGGAAAAGGTGGCAATTTGG - Intergenic
910536188 1:88300513-88300535 GGCAGGAAAAGGTAGACATGGGG - Intergenic
910578086 1:88789924-88789946 GGGAGGAAAAGGTATTAAAAAGG - Intronic
911432942 1:97815331-97815353 AGGAGAAAATAGTAGAAACAAGG + Intronic
911450669 1:98056347-98056369 AGGATGCAAATGTGGAAATAGGG + Intergenic
911497407 1:98648441-98648463 AGGAGCAAAATGTAAAAATTTGG - Intergenic
911510522 1:98804141-98804163 TGGAGGAAAAGGCAGCAATGAGG + Intergenic
911562855 1:99427827-99427849 AGGAGGAAAAGGCACACACAAGG - Intergenic
911606555 1:99912127-99912149 AGTTGGAAAAGGTAGGAGTAAGG - Intronic
911719894 1:101179321-101179343 AGGAGACAAAGGAAGAAGTAGGG + Intergenic
911738813 1:101365074-101365096 AGGAGGAAAAGGTAGACGTTAGG + Intergenic
911903195 1:103530702-103530724 GGGAGGGAAAGGTAGAAACAGGG + Intronic
912230061 1:107783143-107783165 AGGTGGGAAAGGTAGACAAAGGG + Intronic
912259152 1:108092094-108092116 AGGAGGAAAAGGAAGAAAAAAGG - Intergenic
912305102 1:108559644-108559666 AGGAAGATAAGGTAGGAAAAAGG - Intergenic
912648042 1:111413947-111413969 TTGAGGAAAAGGTATAAAAAAGG - Intergenic
913088921 1:115463107-115463129 AGAAGGAAAAGATGGAAAGAGGG + Intergenic
913575264 1:120166626-120166648 AGTAGGGAAAGGTAGAGAGAAGG + Intronic
913963547 1:143356730-143356752 AGGAAGAAAAGGGAGAGAAAAGG - Intergenic
913966720 1:143382992-143383014 GGGAGGAAAAGGGAGAAGAAAGG - Intergenic
913990237 1:143605157-143605179 AAGAGGAAGAGGAAGAAAAAGGG - Intergenic
914057907 1:144182319-144182341 AGGAAGAAAAGGGAGAGAAAAGG - Intergenic
914061097 1:144208599-144208621 GGGAGGAAAAGGGAGAAGAAAGG - Intergenic
914083710 1:144433787-144433809 ATGAGGAAGAGGAAGAAAAAGGG - Exonic
914118053 1:144757770-144757792 GGGAGGAAAAGGGAGAAGAAAGG + Intergenic
914121239 1:144784046-144784068 AGGAAGAAAAGGGAGAGAAAAGG + Intergenic
914189731 1:145399063-145399085 ATGAGGAAGAGGAAGAAAAAGGG - Exonic
914211579 1:145584770-145584792 ATGAGGAAGAGGAAGAAAAAGGG - Intergenic
914267647 1:146051710-146051732 AGGAGGCAAAGGTTGCAGTAAGG + Intergenic
914276783 1:146132200-146132222 ATGAGGAAGAGGAAGAAAAAGGG - Exonic
914366031 1:146978974-146978996 ATGAGGAAGAGGAAGAAAAAGGG + Exonic
914381003 1:147116282-147116304 ACGAGGAAGAGGAAGAAAAAGGG - Intergenic
914450718 1:147788991-147789013 AGGAGGAAGAGGCAAAAAAAGGG + Intergenic
914486413 1:148114451-148114473 ATGAGGAAGAGGAAGAAAAAGGG - Exonic
914519649 1:148404107-148404129 ATGAGGAAGAGGAAGAAAAAAGG - Intergenic
914537827 1:148583155-148583177 ATGAGGAAGAGGAAGAAAAAGGG - Exonic
914557570 1:148782266-148782288 AGTAGGGAAAGGTAGAGAGAAGG + Intergenic
914586743 1:149069608-149069630 ATGAGGAAGAGGAAGAAAAAGGG - Exonic
914615264 1:149347964-149347986 AGTAGGGAAAGGTAGAGAGAAGG - Intergenic
914628096 1:149482190-149482212 ATGAGGAAGAGGAAGAAAAAGGG + Intergenic
914786905 1:150841539-150841561 AAGAGGAAATAGTAGAAAAAAGG + Intronic
914837632 1:151220818-151220840 GGGAGGTAGAGGTAGAAAAATGG - Intronic
914998049 1:152561834-152561856 AGGAGGGAAAGGTAGGGAAAGGG - Intronic
915149428 1:153818279-153818301 AGGAGGAAAAACCAGAAAAAGGG + Intronic
915494657 1:156273208-156273230 AGAGGGAAAAGGTATAAACAAGG + Intronic
915878516 1:159640505-159640527 AGGAGAAAAAGCTAGAAAGAAGG - Intergenic
915906951 1:159885864-159885886 AGGAGGAAAAGGAAAGAAAAGGG + Intronic
916077359 1:161209604-161209626 GGGAGGAAAGGATAGGAATAGGG + Intronic
916107477 1:161442001-161442023 AGGAGGGAAAAGGAGGAATAGGG - Intergenic
916109062 1:161449419-161449441 AGGAGGGAAAAGGAGGAATAGGG - Intergenic
916110649 1:161456800-161456822 AGGAGGGAAAAGGAGGAATAGGG - Intergenic
916112235 1:161464210-161464232 AGGAGGGAAAAGGAGGAATAGGG - Intergenic
916113822 1:161471591-161471613 AGGAGGGAAAAGGAGGAATAGGG - Intergenic
916123885 1:161552047-161552069 AGGAGGGGAAGGAAGAAAAAGGG - Intergenic
916133769 1:161633409-161633431 AGGAGGGGAAGGAAGAAAAAGGG - Intronic
916986656 1:170199271-170199293 AGGAGGAAAGGGGAGAATCAGGG - Intergenic
917078146 1:171227527-171227549 AGGGGGAAAGGGGAGAAATAAGG + Intergenic
917158945 1:172035626-172035648 AGAAGCAAAAGGTGGAAATCAGG + Intronic
917170088 1:172163341-172163363 AGGAGGCTAAGGCAGAAAAATGG - Intronic
917409132 1:174740077-174740099 AGGGGGAAAAGGTAGAGGAAAGG + Intronic
917508530 1:175650677-175650699 GGTAGGGAAAGGTAGTAATAAGG - Intronic
917519431 1:175735766-175735788 GGGAGGGGAAGGTAGAAAAAAGG + Intronic
917646957 1:177038519-177038541 AGGAAGAGAAGGAAGAAAAAAGG + Intronic
917723793 1:177811311-177811333 ATGAGGATAAGGTGGAGATAAGG + Intergenic
918383203 1:183977874-183977896 AGAAGGAAAAGAAAGAAAGAAGG + Intronic
918620138 1:186594405-186594427 AGGAGAAAAAGTAAGAAATAGGG + Intergenic
918666060 1:187153091-187153113 AGGAGGTAAAGAAAGAGATACGG - Intergenic
918704270 1:187641304-187641326 AGGAAGAAAAGGGGGAAACAGGG - Intergenic
919432440 1:197513111-197513133 AGGAAGAAAGGGAAGCAATAAGG + Intronic
919433715 1:197530928-197530950 AAGAGGGATAGTTAGAAATAAGG - Intronic
919445063 1:197693017-197693039 AGCATGAAAATGTAAAAATAAGG - Intronic
919458656 1:197849915-197849937 AGGAGGAGAAGAAAGAAAAATGG + Intergenic
919641368 1:200048126-200048148 AGGAAGGAAAGGTATAAATAAGG - Intronic
920511183 1:206553393-206553415 AGGAGGCAGAGATAGAAACATGG + Intronic
920739813 1:208569867-208569889 CGGGGGAAAAGGTAGGAAGAGGG - Intergenic
920772875 1:208906277-208906299 AGGAGGAAAAGAGAGGAAAATGG - Intergenic
921453995 1:215344857-215344879 AGGGAGAAGAGGTAGAGATAAGG - Intergenic
921534482 1:216329345-216329367 AAGAGGGAATGGTAGAAAGATGG + Intronic
921638883 1:217528348-217528370 AGGAAGTAAAGGCAAAAATATGG - Intronic
922192229 1:223329448-223329470 AGGAGGGAAAGTTAGAACTTTGG - Intronic
922567636 1:226611279-226611301 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
922568306 1:226616419-226616441 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
923051319 1:230393090-230393112 AGGAGGAAAGGGGAAAAAGAAGG + Intronic
923336274 1:232973011-232973033 AGGAGGAAATGGGAAAAAGAAGG + Intronic
923908513 1:238413154-238413176 AGGAAGAAAAGGGGGAAACAGGG - Intergenic
923993123 1:239461744-239461766 GTGAGGAACAGGTAGAAAAATGG - Intronic
924022396 1:239798155-239798177 AGGAGGGAGAGGAAGAAACAAGG - Intronic
924061770 1:240182416-240182438 AAGAGGATCTGGTAGAAATATGG + Intronic
924087536 1:240468545-240468567 AGGAGGAGAAAGTAAAAAGAGGG - Intronic
924557968 1:245133478-245133500 AGGAGGGAGAGGGAGAAAGAAGG - Intergenic
924807715 1:247374209-247374231 ATGAGGAAGAGGGAGGAATACGG - Intergenic
924931523 1:248736795-248736817 AGGAAAAAAAGGTAGACACACGG + Intronic
1063164692 10:3450556-3450578 AGGGAGAAAAGGAAGAAAGAGGG - Intergenic
1063503939 10:6579917-6579939 AGAAGGAAAAGGGAGAAGAAAGG + Intronic
1064361675 10:14671366-14671388 AGGAAGAAAAGGGGGAAACAGGG + Intronic
1064446700 10:15400114-15400136 AGGAGGTAAAGAAAGAGATAGGG + Intergenic
1064491458 10:15861381-15861403 AAGTGCAAAAGGTAGGAATATGG - Intergenic
1064787193 10:18911193-18911215 GGGAGGAAGAGGAAGAAATGCGG - Intergenic
1064850849 10:19707099-19707121 AGGAGGAAAAGGAAGAAGAAGGG - Intronic
1064949907 10:20836751-20836773 AGGAAGAAAAGGGGGAAACAGGG - Intronic
1064960123 10:20954594-20954616 AGGAAGAAAAGGGGGAAACAGGG + Intronic
1065185292 10:23164978-23165000 AAGAGGAAAAGGGAGGAAGAAGG + Intergenic
1065339195 10:24687451-24687473 ATGAGGAAAATGGAGAAATAAGG - Intronic
1065426824 10:25614987-25615009 AGGAGGTAGAGAAAGAAATAGGG - Intergenic
1065446124 10:25802698-25802720 AGGAGTAAAATTTAGAAAGAGGG + Intergenic
1065638329 10:27753366-27753388 AGGAAGAAAAGATGGAAAGAAGG - Intergenic
1065743494 10:28817746-28817768 AAGGGGCAAAGGTAGAAAGATGG + Intergenic
1065784841 10:29203615-29203637 AGGAGGAAAGGAAAGAAAAAAGG + Intergenic
1067068870 10:43118551-43118573 AGTAGGGAAAGGGAGAAAGAGGG - Intronic
1067203140 10:44192312-44192334 AGGAAGGAAAGGCAGAAAGATGG + Intergenic
1067400436 10:45968497-45968519 AGGAGGAAAAGCAAGAGGTAAGG + Intergenic
1067668773 10:48301031-48301053 AGGAGGTAAAGGTGGAGATGGGG + Intergenic
1067676853 10:48388402-48388424 AGGAGGCAAAGGAAGAGATTTGG + Intronic
1067868756 10:49937799-49937821 AGGAGGAAAAGCAAGAGATAAGG + Intronic
1068196490 10:53724128-53724150 GGGAGGCAGAGGTAGAAAAATGG - Intergenic
1068438321 10:57019150-57019172 AGGAAGAAAAGGGAGAAACAGGG + Intergenic
1068699805 10:60007909-60007931 AGGAATAAAAGATAGAAAAATGG - Intergenic
1068843686 10:61646478-61646500 TAGGGGAAAAGGGAGAAATAAGG - Intergenic
1069163025 10:65113274-65113296 ATGAGGAAAGGGTAGAAAGATGG + Intergenic
1069176320 10:65293293-65293315 AGGAGTCAAATATAGAAATACGG - Intergenic
1069255726 10:66329877-66329899 AGGAGGAATAGCTTGTAATATGG - Intronic
1069271417 10:66532798-66532820 ATGAGTACAAGGTACAAATAGGG + Intronic
1069316328 10:67107935-67107957 AGGAAGAAAAGGGGGAAACAGGG - Intronic
1069316685 10:67113182-67113204 AGAAGTAAAAGGTAGAAATGAGG + Intronic
1070051258 10:72892185-72892207 AAAAGGAAAAAATAGAAATAAGG + Intergenic
1070222631 10:74465539-74465561 ATGGGGCAAAGATAGAAATAGGG + Intronic
1070338713 10:75477437-75477459 GACAGGCAAAGGTAGAAATAAGG - Intronic
1070361586 10:75695493-75695515 AAGAGGAAAAGGAAGAACAAAGG - Intronic
1070367186 10:75749072-75749094 AGAAGGAAAAGGAAGAAGTGGGG - Intronic
1070990754 10:80730188-80730210 AGGAGGCAAGGGTGGAAAGAAGG - Intergenic
1071244491 10:83747565-83747587 AGCTGGGAAATGTAGAAATAGGG + Intergenic
1071317670 10:84418480-84418502 TGGAGGCAAAGGTTGAAATGGGG + Intronic
1071353310 10:84767981-84768003 AGGAGGAAAATGAACACATAAGG + Intergenic
1071468421 10:85961539-85961561 AGGAGGAAAGGGAAGAAGGAAGG - Intronic
1072058967 10:91789585-91789607 AGGAGGTAGAGACAGAAATAAGG + Intergenic
1072188926 10:93065162-93065184 GGGAGGGGAAGTTAGAAATAGGG + Intronic
1072222295 10:93336757-93336779 AGGAGGAGAAGGAAGGAAGAAGG + Intronic
1072558030 10:96540315-96540337 AGGAGGGAAAGGAAGAAAGTGGG - Intronic
1072919025 10:99559866-99559888 AGGAAGAAAAAGTAGATTTATGG - Intergenic
1073400636 10:103254315-103254337 AGGAAGGAAAGGAAGAAAGAAGG - Intergenic
1073523423 10:104156144-104156166 AGAAGGAAGAGGTGGAAATTAGG + Intronic
1073886326 10:108044037-108044059 AGGAAGAAAAGGGGGAAACAAGG + Intergenic
1073894307 10:108136866-108136888 TGGAGGAAATAGTAGATATAAGG - Intergenic
1073900884 10:108219398-108219420 AGGGTGAATAGGTAGAAATGGGG + Intergenic
1073903144 10:108246022-108246044 ATGAGGACAAAGGAGAAATAAGG - Intergenic
1073941195 10:108700379-108700401 AGGAGGAGAAGGGAGGAAGAGGG + Intergenic
1074204650 10:111272248-111272270 AGGGGGAGAAGGAAGAAAGAGGG + Intergenic
1074222245 10:111449455-111449477 TGGAGGAAAAGGTGGAAAGGAGG - Intergenic
1074374599 10:112928899-112928921 AGGAGGTAAAGGTAGCAGTGAGG - Intergenic
1074681500 10:115911871-115911893 AGGAGGAACGGGGAGAAACACGG - Intronic
1075139194 10:119816302-119816324 AAGAGGAAAATGTAGGAAGAAGG - Intronic
1075264841 10:120991330-120991352 AGGAGGAAAAAGCAGAAAGAAGG - Intergenic
1075353625 10:121749734-121749756 AGGAGGAAACTGTAGAAGTGAGG - Intronic
1076079340 10:127564544-127564566 AGGAGGAAAAGAAGGAAAGAAGG - Intergenic
1076252359 10:128994633-128994655 AGGAGGGAAAGGAGGAAAAAAGG + Intergenic
1077021143 11:417652-417674 TGGAGGAAAGGGAAGAGATAGGG - Intergenic
1077392524 11:2306791-2306813 AGGAGGAAAAGGAGGGAAAAGGG + Intronic
1077709833 11:4524700-4524722 AGGAGGTAGAGAAAGAAATAGGG + Intergenic
1077795426 11:5486453-5486475 AGGAGGAGAGGGAAGAAATGTGG + Intronic
1078409351 11:11099142-11099164 AGGAGGAAAAAGCAGGGATAAGG - Intergenic
1078653554 11:13217663-13217685 AGGAGGAAGAGGAAAAAAGAAGG - Intergenic
1078837309 11:15043241-15043263 AGGATGAGAAGGAAGAAATGTGG + Intronic
1079121572 11:17688791-17688813 TGCAGGAAGAGGTAGAAAGATGG + Intergenic
1079140893 11:17808781-17808803 GGCAGGAAAGGGTAGAAATATGG - Intronic
1079905369 11:26239648-26239670 AGGAGGACAAGGTGTTAATAAGG - Intergenic
1079929942 11:26545783-26545805 AGGAGGAAGAGGGAGGAAGAGGG - Intronic
1080106584 11:28517649-28517671 AGGAGTGAAATATAGAAATAAGG - Intergenic
1080107810 11:28529524-28529546 AGGGGGAAAAGGGAGAGATCAGG - Intergenic
1081779514 11:45700251-45700273 AGGAAGAAAAGGGGGAAACAAGG + Intergenic
1081829027 11:46090401-46090423 ATAAGGAAAAGGAAGAACTAAGG + Intronic
1082747707 11:56984452-56984474 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
1082922374 11:58509443-58509465 AGGAGGAAAAAGGAGAAAACAGG + Intergenic
1083534507 11:63455727-63455749 TGGGGGAAAAGGTGGCAATAAGG - Intergenic
1083822051 11:65177892-65177914 AGGAAGAAAAGGGAGCAATCTGG - Intronic
1084246631 11:67862109-67862131 AGAAAGAAAAGAAAGAAATAGGG + Intergenic
1084495587 11:69501350-69501372 AGGATGGAAAGATAGAAAAATGG + Intergenic
1084902316 11:72318875-72318897 AGGAGGAAAAAGCAGATCTATGG - Intronic
1084925487 11:72508106-72508128 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
1085566697 11:77520688-77520710 AGGAGGAAAAAGGAAAAAGAAGG + Intronic
1085849269 11:80100571-80100593 AGAAGGAAAGGGCAGAAATCAGG - Intergenic
1085945116 11:81260581-81260603 AAGACTAAAAGGGAGAAATAGGG - Intergenic
1086110131 11:83190434-83190456 AGGAAGAAAAGGAAAAAAAATGG - Intergenic
1086227030 11:84524467-84524489 GAGAGGAAATGGTTGAAATATGG - Intronic
1086314157 11:85572540-85572562 AGGAGGAAAATATAGATATTTGG - Intronic
1086812347 11:91326045-91326067 ATGAGGAAAATGAAGAAAAAGGG - Intergenic
1086827655 11:91519157-91519179 AGGAGGAGAAGAAATAAATAAGG + Intergenic
1087405842 11:97729378-97729400 AGGAGGAATGGGCAAAAATAAGG - Intergenic
1087432366 11:98069973-98069995 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
1087676281 11:101165709-101165731 AGGAGAAAAATGAAGAAAAAAGG - Intergenic
1087693234 11:101346237-101346259 AGGAGGAATGGGGAGAACTATGG + Intergenic
1088507603 11:110541653-110541675 AGTTGGAAAAGTTAGAAAAATGG - Intergenic
1089242850 11:117097497-117097519 ATGAGGAAAATGGGGAAATAAGG - Intronic
1089406963 11:118205580-118205602 CGAAGGAAAAGGGAGAAAGAAGG + Intronic
1090077290 11:123587434-123587456 TGGAGGGAAAAGCAGAAATAGGG + Intronic
1090141834 11:124273772-124273794 ACGAGTAAAAGGGAGAAAGAAGG + Intergenic
1090477168 11:127033873-127033895 TGGAAGAACAGGTAGAAACAAGG + Intergenic
1090518449 11:127453014-127453036 GGGAGGAAGAGGTAGAAGGAGGG + Intergenic
1090810325 11:130234280-130234302 AAGAGGCAAAGGATGAAATATGG + Intronic
1090967445 11:131611176-131611198 GGAGGGAAAAGGTGGAAATATGG + Intronic
1091246625 11:134101708-134101730 TGGAGGAAAAAGAATAAATAAGG - Intronic
1091431735 12:441600-441622 AGAAGGAAAATGTAGAATTAAGG - Intronic
1091795067 12:3293477-3293499 AGTAGGAAAAGGGAGCAACAAGG + Intergenic
1091971220 12:4788534-4788556 AGGAGGAATAGGTTGAAGAAGGG + Intronic
1092225924 12:6748388-6748410 AGAAGGAAAAGGTAGGGAAAGGG + Exonic
1092281508 12:7101238-7101260 AGGAGGAAAAGGGAGAGGGAAGG - Intronic
1092517560 12:9231088-9231110 AAGAGGATAAGCCAGAAATATGG + Intergenic
1092700471 12:11223646-11223668 AGGAGGAAAGGGTAGGAAGGGGG + Intergenic
1092927051 12:13280709-13280731 AGGAGAAAAAGGGAGTAATGAGG - Intergenic
1093146700 12:15575202-15575224 AGGAAGAAAAGGGAGAAACAGGG + Intronic
1093476299 12:19558470-19558492 AGGAGGAAAGGGTGGAAAGCGGG - Intronic
1093682583 12:22019787-22019809 AGGAGGAACAGGAAGAGAAAGGG - Intergenic
1093724961 12:22494544-22494566 ATCAGCAAAAGGGAGAAATAAGG + Intronic
1093778975 12:23112017-23112039 AGGAAGAAAAAGAAGAAAGAAGG - Intergenic
1094045027 12:26158230-26158252 GGGAGGAAAAGAAAGAAAGAAGG - Intronic
1094151655 12:27291234-27291256 AGAAGATGAAGGTAGAAATAAGG - Intronic
1094719508 12:33049018-33049040 AGGAGGAAAAGAAAGAGAAAGGG - Intergenic
1094782533 12:33808420-33808442 TGGAGATAAGGGTAGAAATATGG + Intergenic
1095467533 12:42503775-42503797 AGTTGGAAAAGGTATAAAGAAGG - Intronic
1095536150 12:43250362-43250384 AGAATGAAAAGGTAGACATAAGG - Intergenic
1095656764 12:44679198-44679220 AGGAAGAAAGGGTGGAAGTAAGG + Intronic
1095820160 12:46469697-46469719 AGGTGGAATTGGTAGAAAGATGG - Intergenic
1096067291 12:48751221-48751243 AGGAGGAAAAGGTAGGAAGGAGG - Intergenic
1096458942 12:51811427-51811449 AGGTGAAAAAGGCAGAAGTAAGG - Exonic
1096692914 12:53332155-53332177 AGAAAGAAGAGGTAGAAACATGG + Intronic
1096778869 12:53980544-53980566 ACAAGGAAATGGGAGAAATAAGG + Intergenic
1096875544 12:54627481-54627503 AGGAGGAAAAAGTGGTTATATGG + Intergenic
1096883205 12:54689490-54689512 CAGAGGAAGAGGTAGAAAGAAGG - Intergenic
1096953595 12:55502491-55502513 AGGAGGAAATTGTACAAATGTGG - Intergenic
1096956200 12:55528796-55528818 AGGAGGAAAAGGTGGGAAGGGGG + Intergenic
1097124314 12:56761466-56761488 AGGAGGAAGAGGTTGCAGTAAGG + Intronic
1097170782 12:57111443-57111465 AGGAGGAAGAGGAAGAAAGTGGG + Intronic
1097315162 12:58164073-58164095 TGGAGGCAAAGTTAGAAATGTGG - Intergenic
1097591521 12:61581354-61581376 AGGAGGAAAAGGAAGAAAGGAGG - Intergenic
1097652182 12:62313369-62313391 AGCAGGAAAAGGAATAAGTATGG - Intronic
1097945381 12:65362270-65362292 AAGAGGGAAAGATAGAAAAAGGG + Intronic
1098765998 12:74489637-74489659 AGAGGGAAAAAGTAGAAAGAAGG - Intergenic
1098825896 12:75296835-75296857 AGGTGGAAGAGTTAGAAAAATGG + Intronic
1099536206 12:83848182-83848204 AGGAGGAGAAGACAGAAGTAGGG - Intergenic
1099564713 12:84228979-84229001 AGGAAGAAGAGGAAGAGATAGGG - Intergenic
1099849118 12:88069642-88069664 AGAAGGAAAAGGAAGGAATGTGG + Intronic
1099900717 12:88708392-88708414 AGAAGAAAAAGTTAAAAATATGG - Intergenic
1100225545 12:92552295-92552317 AGGTAGAAAAGGGAGAAATGAGG - Intergenic
1100538328 12:95533158-95533180 AGCATCAAAAGGTAGAAAGATGG - Exonic
1100748029 12:97667165-97667187 AGGAGGAAAGGAAAGAAAAAGGG + Intergenic
1100826333 12:98478085-98478107 AGGAGGAAGATGTAGGAAGATGG + Intergenic
1100877270 12:98975304-98975326 AGGAGGAAAAGGAAGAAGGAAGG - Intronic
1101254615 12:102965200-102965222 AGGAGGAACAGGTAGGAGTAGGG + Intergenic
1101494176 12:105237604-105237626 TAGAGGAAAGGGAAGAAATATGG - Intronic
1101518247 12:105457396-105457418 TAGAGGAAAAGTTACAAATATGG + Intergenic
1101925632 12:108969263-108969285 AGGGGGAGAAGGAAGAAAAAAGG - Intronic
1102680518 12:114687470-114687492 GGGAGGAGAAGGGAGAAAGAGGG + Intergenic
1102807436 12:115794308-115794330 AGAAAAAAATGGTAGAAATAAGG + Intergenic
1103022984 12:117551289-117551311 AGGAGGAATAGGAAGAAGGAAGG - Intronic
1103038629 12:117676524-117676546 AGGAGAAAAAGGAAGAGAAAAGG + Intronic
1103068950 12:117924600-117924622 AGAAAGAAAAGAAAGAAATACGG + Intronic
1103139513 12:118536320-118536342 AGGAGGAAAGGGTCGCAGTAAGG - Intergenic
1103219489 12:119231949-119231971 AGGAGGAAGAAGAAGAAAGAAGG - Intergenic
1103870430 12:124087264-124087286 AGGAGGTTAAAGTAGCAATACGG - Intronic
1104073871 12:125372564-125372586 AGTGGAAAGAGGTAGAAATAAGG + Intronic
1104153832 12:126110958-126110980 AGCAGCAAAAGAAAGAAATAGGG - Intergenic
1104404939 12:128509312-128509334 AGGAGGAAAGGAAAGAAAAAGGG + Intronic
1105652952 13:22400742-22400764 AGGAGGAAAGGAAAGAAAGATGG - Intergenic
1106027048 13:25965247-25965269 ATGGGGAAAATGTAGAAAGATGG - Intronic
1106294651 13:28400359-28400381 AAGAAGAAAAGTTAAAAATAAGG + Intronic
1106535570 13:30639484-30639506 AGGAGGAAATGTCAGAAATTTGG - Intronic
1106566301 13:30887627-30887649 AGAACGAAAAGTAAGAAATATGG - Intergenic
1106597161 13:31154888-31154910 AGGAAGAAAAGGAGGAAAAAGGG + Intronic
1106793300 13:33178639-33178661 AGAAGGAAGAGGTGGGAATACGG - Intronic
1106965660 13:35063694-35063716 AGGGAGAAAAGGTGGAAATAGGG + Intronic
1107376209 13:39807427-39807449 AGGAGGAAAAGGTTGGAAGAGGG + Intergenic
1107691314 13:42956429-42956451 AGGAGGAGAAGGTAGGAACAGGG + Intronic
1108304162 13:49114142-49114164 AGGAAGAATAGTTAGAAATTTGG - Intronic
1108614636 13:52119997-52120019 AGGAAGAAAAAGTAGAAATGAGG - Intronic
1108626204 13:52230983-52231005 ATGAGGAAAGGGTGGAAAGATGG + Intergenic
1108659862 13:52575499-52575521 ATGAGGAAAGGGTGGAAAGATGG - Intergenic
1109041224 13:57339773-57339795 ATGAGGAAAAGGCAGAGAAAAGG + Intergenic
1109148024 13:58807280-58807302 AAGAGGAAGAAGAAGAAATAAGG - Intergenic
1109574065 13:64230301-64230323 AAGAGGAAAGTGTAGAGATAGGG - Intergenic
1110170721 13:72497215-72497237 AGGAAGAAAAGATGGAAATTTGG + Intergenic
1110592065 13:77274930-77274952 TGGAGGAAAAGGTAGAGGAAAGG - Intronic
1110757637 13:79194770-79194792 GTGAGGAAAAGGAAGAAATGAGG - Intergenic
1111005152 13:82237776-82237798 AACAGGAAAAGGTTGAAAAAAGG + Intergenic
1111179764 13:84648853-84648875 AGGATGAAAAGGAAGAAAGAGGG + Intergenic
1111498422 13:89084983-89085005 AGGAGGAGAAGGAAGAAGGAGGG + Intergenic
1111530330 13:89527930-89527952 AGGAGTAAGAAGTATAAATATGG - Intergenic
1111624595 13:90768469-90768491 AGGAGGAAAAACCAGAAAGAAGG + Intergenic
1112141000 13:96642478-96642500 AGGAGGAAAGGGCAGCAAAAAGG - Intronic
1112899230 13:104339092-104339114 AGAAGGAAAAGACAGAAATAAGG - Intergenic
1112993237 13:105540009-105540031 AGGAGGAGTAGGAAGAAAGAGGG + Intergenic
1113177645 13:107583868-107583890 ATGAGGAAAAGAGAGAAACAGGG - Intronic
1113217832 13:108063171-108063193 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
1113355614 13:109577216-109577238 AGGAGGAAGAGGTAGATAAAAGG - Intergenic
1114074260 14:19146513-19146535 AGGGAGAAAAGGTGGAAATAGGG + Intergenic
1114088008 14:19253462-19253484 AGGGAGAAAAGGTGGAAATAGGG - Intergenic
1114142610 14:19932324-19932346 AGGAGGAGGAGGAAGAAAAAAGG - Intergenic
1114368036 14:22051005-22051027 AGAAGGAAAGGGGAAAAATAAGG + Intergenic
1114387151 14:22267341-22267363 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
1114549490 14:23524818-23524840 AGGAGGAAGAGGCAGAGAGAGGG - Exonic
1114553771 14:23549925-23549947 AAGAAGAAAAGGTAGGAAGAGGG + Intronic
1114945119 14:27671757-27671779 AGTAGGAATAGGAGGAAATAGGG - Intergenic
1115162885 14:30415424-30415446 TAGAGGAAAAGGCAGAAAAAAGG - Intergenic
1115324053 14:32116638-32116660 AGGAAGAAAATGGAAAAATAAGG + Intronic
1115601507 14:34960070-34960092 AGGGGGAAATGCTAAAAATAAGG + Intergenic
1116390730 14:44386019-44386041 TGGATGAAAAGGAAGAAAAAGGG + Intergenic
1116898784 14:50341873-50341895 AGCAAGAAATGGTAGAAATCAGG + Intronic
1116970171 14:51055638-51055660 AGGTGGAAAAGGCAGGAAAATGG + Intronic
1117010069 14:51462082-51462104 AGGAAGAAAAGAAAGAAAGAAGG + Intergenic
1117168135 14:53060394-53060416 AGCAGGAATAGCTAGAAATAAGG - Intronic
1117558775 14:56913512-56913534 CAGAAGAAAAGGTAGAAATGTGG - Intergenic
1117757024 14:58985744-58985766 AAGAGGAAGAGGAAGAAAAAGGG + Intergenic
1118554657 14:67003583-67003605 AGGAGGAAACTCTAGAAATTGGG + Intronic
1118587957 14:67373939-67373961 AGAAGGAAAAGGAAGAAATAGGG + Intronic
1118923359 14:70169805-70169827 AGGAGAAAAAGGAGCAAATATGG - Intronic
1118924742 14:70181845-70181867 AAGAGGAAAAGGTTGAAGTTGGG + Intronic
1118952284 14:70445835-70445857 AGGAGGAAAAAGGAAAAATACGG + Intergenic
1118993178 14:70813870-70813892 AGGAGGGAAGGGAAGAAAGAGGG + Intergenic
1119067416 14:71542681-71542703 AGGAGGAGAAGGGAGAAGGAAGG - Intronic
1119075670 14:71635326-71635348 AGAAGGAAAGAGTAAAAATATGG + Intronic
1119335850 14:73833051-73833073 AGGAAGAAAAGGGAGAAAGAAGG + Intergenic
1119521281 14:75287712-75287734 AGGAGAAGCAGGTAGAAATAGGG + Intergenic
1119577478 14:75739496-75739518 AAAAGGAAAAGGCAGAAAAAGGG - Intronic
1119922208 14:78456962-78456984 AGGAGGAGAAGGAAGAAGGAAGG - Intronic
1120145590 14:80975381-80975403 GGGAGGAAAAAGTCAAAATAGGG - Intronic
1120510023 14:85401961-85401983 AGGAGGAAAAAGAATAAAGAGGG + Intergenic
1120576328 14:86185947-86185969 AGAAGGAAAAGAAAGAAAGAAGG - Intergenic
1120612051 14:86654071-86654093 AGGAGGATGAGGGAGAAAGATGG - Intergenic
1120756016 14:88245309-88245331 GGGAGGACAAGGGAGAAAGAGGG - Intronic
1121420236 14:93808051-93808073 AGAAGGAAAAGGAAGAAGTGGGG + Intergenic
1121497557 14:94404968-94404990 AGGAGGTAAAGGAAGACAAAGGG + Intergenic
1121531238 14:94655184-94655206 AGGAGGAGCAGGAAGAAAAAAGG + Intergenic
1121990608 14:98553314-98553336 AGGAAGGAAAGGCAGAAAAAAGG - Intergenic
1122415742 14:101548716-101548738 GGGAGGAAAGGGAAGAAAGAAGG + Intergenic
1122523161 14:102361153-102361175 ATGATGAAAAGCCAGAAATAGGG + Intronic
1123794632 15:23759303-23759325 AGGAGGAAAATGCTGAAGTATGG + Intergenic
1123968037 15:25478427-25478449 AGGTGGAGAAGGTGGAAATTAGG - Intergenic
1124440899 15:29685656-29685678 AGGAGGAAAAGTTGGAAGAAGGG + Intergenic
1124643026 15:31409524-31409546 AGGAAGAAAAGGGAGGAAGAAGG + Intronic
1125260390 15:37817741-37817763 AGGAGGAAAGGGGAGAACAAAGG + Intergenic
1125531726 15:40417994-40418016 AGCAGCAAAAGGTAGCAAGAGGG - Intronic
1125704665 15:41723139-41723161 AGCAGGAAAAGGTGGAATTAAGG - Intronic
1125892173 15:43274928-43274950 AGCAGGAAAAGGGAGGAAAAGGG + Intergenic
1128095696 15:64953132-64953154 AGGAGAAAAAGGAAGAAAAAAGG - Intronic
1128534697 15:68481654-68481676 AGGAAGAAAAGGGGGAAACAAGG - Intergenic
1128826119 15:70719040-70719062 AGGAAGGAAGGGTAGAAAGAAGG + Intronic
1128838039 15:70827209-70827231 GGAAGGGAAAGGTACAAATATGG + Intergenic
1129135887 15:73550826-73550848 CGGAGGAAGAGGTATAGATAAGG - Intronic
1129328163 15:74812879-74812901 AGGAGGAGAAGGCAGAATAAGGG - Exonic
1129340874 15:74885806-74885828 AGGAGGCAGAGGTAGAAGGATGG - Intergenic
1129556066 15:76511097-76511119 AGGGGGAAAGGGTAGGAAGAGGG + Intronic
1129556869 15:76519383-76519405 AGCAGGGAAAGGGAGAAGTAGGG + Intronic
1129900104 15:79140929-79140951 AGGAGAAAAAGGCACAAAGAAGG + Intergenic
1130670004 15:85903332-85903354 AGAAGCAAAAGCAAGAAATAAGG + Intergenic
1130721067 15:86386179-86386201 AGGAGGAAGAGGGAGGAAGAGGG - Intronic
1131172607 15:90189200-90189222 AGGAAGAAAAGGTAGGAAGGAGG + Intronic
1131572851 15:93556602-93556624 AGGAGGGAAGGGCAGAAAAAGGG - Intergenic
1131755887 15:95561560-95561582 AGGAGGAAAAAGATGAGATATGG - Intergenic
1131852126 15:96554646-96554668 AGGAGGAAAAAGGAGTAAAAAGG - Intergenic
1131852140 15:96554721-96554743 AGGAGGAGGAGGGAGAAAGAAGG - Intergenic
1133808049 16:9140171-9140193 AGGCGGAAAGAGGAGAAATAGGG - Intergenic
1135138568 16:19902861-19902883 TGGAGGAACAGGAAGAAAGACGG + Intergenic
1135171138 16:20184844-20184866 TGGGGGAAAAGGAAGAAATGTGG - Intergenic
1135282371 16:21163712-21163734 AGGAGGCAAATTTACAAATATGG + Intronic
1135637915 16:24094846-24094868 AGGAAGGAAAGGAAGAAAAAGGG + Intronic
1135934831 16:26770929-26770951 AGGAGGAAAAGCTAGAAGAGAGG - Intergenic
1136010791 16:27362476-27362498 AGGAGGTAGAGGAAGAAAAAGGG + Exonic
1136459209 16:30399220-30399242 AGGAAGAATAGATAGAAATAGGG + Exonic
1137927260 16:52552240-52552262 AGGAGACAAAGGTAGTAATGGGG + Intergenic
1138097905 16:54227035-54227057 TGGGGGAAAAGGAAGAAAGAAGG + Intergenic
1138374507 16:56553557-56553579 AGGAGGAAATGGTGGAAATCTGG + Intergenic
1138469062 16:57217480-57217502 AGGAGGAAAAGAGAAAAATCAGG - Intronic
1139089337 16:63625638-63625660 AGGAGGAAAAGGTAGCAATGTGG + Intergenic
1139289975 16:65849192-65849214 ATGAGGAAAAGGTAAAGAAAAGG - Intergenic
1139601270 16:67988919-67988941 AAGAAGAAAAGGAAGAAAGAAGG + Intronic
1139734203 16:68973243-68973265 AGAAGGAATAAGTAGAAATAGGG - Intronic
1139920519 16:70457064-70457086 AGCAGGAAGAGGTAGAGATGGGG + Intronic
1140132160 16:72172582-72172604 AGGAGGTAAAGGAAGAAGTTAGG - Intronic
1140766272 16:78161367-78161389 AGAAAGAAAGGATAGAAATAAGG - Intronic
1140925404 16:79577877-79577899 AAGAGGAAAATGTAGAAAAAGGG - Intergenic
1140984366 16:80143617-80143639 TGGTGGAAAAGGAAGAAAAAAGG + Intergenic
1141002824 16:80324195-80324217 AGAAGGAAAAGGCAGAAAGCGGG + Intergenic
1141283098 16:82646580-82646602 AGGAGGCCAAGGTTGTAATATGG + Intronic
1142291482 16:89195388-89195410 AGGAGGCAAAGGTGGGACTAGGG - Exonic
1142567012 17:846844-846866 AGGAGAAAAAAGGAGAAAAATGG + Intronic
1143242899 17:5459093-5459115 AGGAGGCAAAGGTAGGAGGACGG + Intronic
1143311288 17:5991616-5991638 AGGATGAGAGGGTAGAAATGGGG + Intronic
1143384213 17:6517452-6517474 AGGAAGAGAAGGAAGAAAAAAGG + Intronic
1143391432 17:6561297-6561319 AGGAGGAAGAGGCAGAAGAAGGG - Intergenic
1143604539 17:7974752-7974774 AGGAGGCAAGGGTGGAAATGAGG + Intergenic
1144047626 17:11468138-11468160 AGGAGGAAAGGGCAGCAATTGGG - Intronic
1144314191 17:14043745-14043767 AGGGGGAAAAGGGGGACATAGGG - Intergenic
1145278985 17:21454936-21454958 AGGAGGAAGAAGAAGAAAGAAGG - Intergenic
1146427793 17:32759909-32759931 AGGAGAAAAAGGAGGAAAAAGGG + Intronic
1146518212 17:33506083-33506105 AGGAGTAAAAGATAGAAATGAGG + Intronic
1146933052 17:36791595-36791617 AGGAGAAAAAGGGAGAGAGATGG + Intergenic
1147725577 17:42564415-42564437 AAGAGGAAAGGGTAAAAAGAGGG - Intronic
1148472223 17:47902022-47902044 ATGAGGATAAGGTAAAAAAAGGG + Intronic
1148526165 17:48338064-48338086 AGGAAGAAAAGAAAGAAAGAAGG - Intronic
1149145062 17:53480397-53480419 AGGAGGAAAAGGTGAGAATGAGG - Intergenic
1149221020 17:54415256-54415278 AGGAGGAAAAGAAAGAGATCAGG - Intergenic
1149267954 17:54948201-54948223 GGGAGGCAAAGGTTGAAACAGGG - Intronic
1149387521 17:56156629-56156651 AGGTGGAAAAGGAAGGAGTAAGG + Intronic
1149628999 17:58104773-58104795 AGGCAGAAAAGGTGGAAAGAGGG - Intergenic
1149881408 17:60295828-60295850 AGGAAGAAACGGTATATATAGGG + Intronic
1150696877 17:67412948-67412970 AGGAGGAAAAAACAGTAATAAGG - Intronic
1151101589 17:71562165-71562187 AGGAGACAAAGGCAGAAATCAGG - Intergenic
1151118857 17:71769823-71769845 AAGAAGAAAAAGTGGAAATATGG - Intergenic
1151429805 17:74054853-74054875 AAGAGGGAAAGGGAGAAAGAGGG - Intergenic
1151771822 17:76168095-76168117 ACGAGGAAAGGGAAGAAGTAAGG - Intronic
1152881552 17:82819197-82819219 AGGAGGAAGAAGTAAAACTAGGG + Intronic
1203166919 17_GL000205v2_random:105968-105990 AGGAGGGATATGTATAAATATGG + Intergenic
1153080192 18:1214113-1214135 AGGAGGAAAAGGAGGGCATAGGG + Intergenic
1153341505 18:3979515-3979537 AGAAAGAAAAAGTAGAAATTTGG + Intronic
1153417369 18:4862213-4862235 AGGATTAGAAGGTAAAAATAAGG - Intergenic
1154103019 18:11493941-11493963 ATAAGGACAAGGTAGAAATAAGG + Intergenic
1155282971 18:24259527-24259549 AGGAGGAAGGGGCAGAAAAAGGG - Intronic
1155327087 18:24675520-24675542 GGGAGCAAAAGGTAGATGTAGGG + Intergenic
1155340037 18:24804442-24804464 AGGAAGAAAAAGTAAAAAGAAGG + Intergenic
1155773080 18:29724854-29724876 AGGAGGAAAAAGTAGCTTTATGG - Intergenic
1155777597 18:29787357-29787379 AGGAGGAAGAGGAGGAAAGAAGG - Intergenic
1155784434 18:29879665-29879687 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
1156160911 18:34357002-34357024 AGGAGGACAAGGAAAAAAAAAGG + Intergenic
1156272532 18:35549545-35549567 AGGAGGCTAAGGCAGAAAAATGG - Intergenic
1157293464 18:46425755-46425777 AGGAGGACAGTGCAGAAATAGGG - Intronic
1157407583 18:47436061-47436083 AGGATGACAAGGCAGAAAAATGG - Intergenic
1158088298 18:53680541-53680563 AGGAGGAAAAGGAGGAAAAGGGG + Intergenic
1158191577 18:54834535-54834557 AGGAAGAAAAGGAAAAAAGAAGG - Intronic
1158304064 18:56085193-56085215 AGGATGTAAAGGTACAAGTAAGG - Intergenic
1159212180 18:65338530-65338552 AGGAAGGGAAGGAAGAAATAAGG - Intergenic
1159456752 18:68669092-68669114 AGGAGGAAAAGGTAACTATTGGG + Intergenic
1159556517 18:69951411-69951433 AGGAGATAAAGATAGAAACAAGG - Intronic
1159779719 18:72646775-72646797 AGGAGGAAGAGAGGGAAATATGG + Intergenic
1160266823 18:77345469-77345491 AGGGGTAAAATGGAGAAATATGG + Intergenic
1160406246 18:78648387-78648409 AGGAGGAAGAGCCAGAAATGTGG + Intergenic
1160448655 18:78947051-78947073 AGGAGGAAAAGGGAGGAGGATGG + Intergenic
1162266702 19:9581542-9581564 AGGAGAAAAAAGGAGAAAAAGGG + Intronic
1162878915 19:13642655-13642677 AAGAGGAAAAGGCAGACAAATGG + Intergenic
1163207183 19:15812391-15812413 AGGAGGAAAAGAAAGAAAAAAGG + Intergenic
1163610098 19:18296158-18296180 AGGAGAACAAGGAAGAGATAGGG - Intergenic
1163802488 19:19374910-19374932 AGGAAGAAAAGGCAAAAAGAGGG + Intergenic
1163908427 19:20167915-20167937 AAAAGGAAAAGGGAGAAAAAGGG - Intronic
1164147903 19:22523714-22523736 AGGAGGAAGAGGTAGCTTTAGGG + Intronic
1164571816 19:29380201-29380223 AGGAGGAAAAGGTCACTATAAGG - Intergenic
1164659541 19:29950560-29950582 AGGGGGAAAAGGGAAAAAAAAGG - Intronic
1164660983 19:29967499-29967521 AGGAGGCATTGGAAGAAATAAGG + Intronic
1164724388 19:30456208-30456230 TGGAGGAAATGCTAGAAAGATGG + Intronic
1165400392 19:35596062-35596084 AGAAGGAAAAGGAAGAAAAGAGG + Intergenic
1165974202 19:39660192-39660214 AAGAGGAAACATTAGAAATAAGG + Intronic
1166792489 19:45406176-45406198 AGCGGGAAAATGGAGAAATAGGG - Intronic
1166795794 19:45424742-45424764 AGGAGGAAATGTTTGCAATATGG - Intronic
1166938906 19:46351182-46351204 AGCAGGTAAAGGAAGACATAGGG - Intronic
1167702098 19:51054911-51054933 AAGAGGAAGAGGTAGAAGAAAGG - Intergenic
1167709262 19:51099954-51099976 AGGCAGAAAAGGGAGAGATAGGG + Intronic
1167803993 19:51766513-51766535 AGGAAGAAAAGGAGGAAATAAGG + Intronic
1202677020 1_KI270711v1_random:16885-16907 ATGAGGAAGAGGAAGAAAAAGGG - Intergenic
1202697390 1_KI270712v1_random:134987-135009 AGGAAGAAAAGGGAGAGAAAAGG - Intergenic
1202700504 1_KI270712v1_random:160487-160509 GGGAGGAAAAGGGAGAAGAAAGG - Intergenic
925232044 2:2242030-2242052 AAGAGGAAAAGGAAGAGAAAAGG + Intronic
925242524 2:2344642-2344664 AAGAGAAAAACTTAGAAATATGG + Intergenic
925279645 2:2674194-2674216 ACAAGGAAAGGGTTGAAATATGG + Intergenic
926091012 2:10049597-10049619 AAGAGGGAAGGGTGGAAATATGG - Intronic
926918511 2:17916339-17916361 AGGAGGAAGAGGGAGAAAGAAGG + Intronic
926926959 2:17996606-17996628 AGGAGGAAAAAGGAAAAAGAGGG - Intronic
927420368 2:22924620-22924642 AGGATGAGAAAGTAGAAACATGG + Intergenic
927749971 2:25659186-25659208 TGGGGGAAAAGGTAGTGATAAGG + Intronic
927829610 2:26338211-26338233 ATGAAAAAAAGATAGAAATATGG + Intronic
928442740 2:31305561-31305583 AGGGGGGAAAGGTAGAAAGGCGG - Intergenic
928538991 2:32266665-32266687 AAAGGGAAAATGTAGAAATATGG + Intergenic
928754852 2:34511683-34511705 AGAAGCAAAATTTAGAAATAAGG - Intergenic
929278758 2:40054735-40054757 AGGGGGAAGAAGTAGAAATGAGG + Intergenic
929623668 2:43384176-43384198 AGGAGGAAAAGCTAGGACAAGGG + Intronic
929993680 2:46811753-46811775 AGGAGAAAAAGGAGGAAAAAGGG - Intergenic
930166184 2:48205835-48205857 AGGAGGAGAAGGGAGACAAAAGG + Intergenic
930372832 2:50525812-50525834 GGGGGGAAATGGTAGCAATAAGG + Intronic
930527677 2:52550076-52550098 AGGAGGTAGAGAAAGAAATAGGG + Intergenic
930590634 2:53322623-53322645 AGGAGGCAAAGGTGGAAGCAAGG - Intergenic
930759860 2:55022291-55022313 AGGAGGGAACAGTAGAAAGAAGG - Intronic
930923691 2:56790154-56790176 AGGGGATAAGGGTAGAAATAGGG + Intergenic
930980901 2:57524533-57524555 AGGAAGAAAAGGGTGAAACAGGG - Intergenic
931039423 2:58280544-58280566 AGGAAGAAAAGAAGGAAATAAGG + Intergenic
931854988 2:66293735-66293757 AAGAGGAAAAGAAAGAAAGAAGG + Intergenic
931856482 2:66307263-66307285 AGGAGGAAAAAGAAGAGAAAGGG + Intergenic
932531856 2:72542910-72542932 AGGGAAAAAATGTAGAAATAGGG + Intronic
933498807 2:83086196-83086218 AGGAGAAAGAGGTAGAAGGAAGG - Intergenic
933982944 2:87568447-87568469 GGAAGGAAAAGGGAGAAATGAGG - Intergenic
934171432 2:89543960-89543982 GGGAGGAAAAGGGAGAAGAAAGG - Intergenic
934278558 2:91592012-91592034 AGGAAGAAAAGGGAGAGAAAAGG - Intergenic
934281741 2:91618278-91618300 GGGAGGAAAAGGGAGAAGAAAGG - Intergenic
934535338 2:95128697-95128719 AGGAGGAAGAAGGAGAAAGAAGG + Intronic
935033872 2:99348859-99348881 ATTAGGAATAGGAAGAAATATGG + Intronic
935482436 2:103609342-103609364 AGAAGTAAAAATTAGAAATAAGG + Intergenic
936256119 2:110914187-110914209 AGGAGGAAAAAAAAGAAATCAGG + Intronic
936310897 2:111382348-111382370 GGAAGGAAAAGGGAGAAATGAGG + Intergenic
936395552 2:112125587-112125609 AGAAGGAGAAGGGAGAAAGAGGG + Intergenic
936729852 2:115368270-115368292 AGAAGGAAAGGAGAGAAATATGG - Intronic
936748683 2:115613825-115613847 AGGAAGAAAAGGTACAATAAAGG + Intronic
937037164 2:118791747-118791769 AGGAGGAAGAGTTGGTAATAGGG + Intergenic
937330519 2:121025025-121025047 AGGAGGTAAATTTACAAATATGG - Intergenic
937722239 2:125114843-125114865 AGGAGAAAAAGAAAAAAATATGG + Intergenic
938173790 2:129105693-129105715 AGAAGGAGAAGGAAGAAAGAAGG + Intergenic
938488589 2:131743008-131743030 AGGGAGAAAAGGTGGAAATAGGG + Intronic
938607277 2:132908263-132908285 TGTAGGAAAAGATAGAAATCAGG - Intronic
938617492 2:133014218-133014240 AGGAAGAACAGGGAGACATAAGG - Intronic
938640530 2:133273534-133273556 AGGAGGAAAGGGGAAAACTAGGG + Intronic
939733802 2:145819124-145819146 AGGAGGGAGAGGAAGAAAGAAGG - Intergenic
939755560 2:146105015-146105037 AAGAGGGAAGGGAAGAAATAGGG - Intergenic
939798338 2:146676724-146676746 TGAAGGAAAAGGTGGAAAAATGG - Intergenic
940010059 2:149043095-149043117 AGCAGGGAAAGGAAGAAATACGG + Intronic
940439140 2:153693642-153693664 AGGAGGATAAGGGGGAAAAAGGG + Intergenic
940786185 2:157983845-157983867 AGGAGGTAAAGAAAGAGATAGGG - Intronic
941191499 2:162389473-162389495 AGCAGGAAAAGGTATAGAGAAGG + Intronic
941285111 2:163601893-163601915 AGAAGGAAAAGATAGAAAGGTGG - Intronic
941888573 2:170554332-170554354 AGGATGAAAAGGAAGAACAAGGG + Intronic
942109236 2:172663765-172663787 AGGAAGAAAAGGGGGAAACAGGG - Intergenic
942434429 2:175956338-175956360 AGGAGTAAATGATTGAAATAGGG - Intronic
942466705 2:176215630-176215652 AGGAGGAAAATGTCTAAAAAAGG + Intergenic
942487182 2:176452052-176452074 AGGAGCAACAGAGAGAAATAAGG - Intergenic
942540404 2:177009510-177009532 AGGAGGAAATAGTAGCAATAGGG - Intergenic
942619920 2:177835348-177835370 AGGAGGAAAAAGGAAAAAGAAGG - Intronic
942964882 2:181880043-181880065 AGGAGAATAAGGTAGAAGAAGGG - Intergenic
943053243 2:182942734-182942756 AGAAGGAAGAGATATAAATAAGG + Intronic
943107119 2:183559506-183559528 AGGAAGCAAAGGTAGAAGCAGGG + Intergenic
943599834 2:189902804-189902826 AATAGGAAAGAGTAGAAATAAGG + Intronic
943789503 2:191916550-191916572 AGGAGGTAGAGGTGGAGATATGG + Intergenic
943935160 2:193905641-193905663 AGGAGGAAAAGTGAGGGATATGG - Intergenic
944105525 2:196075629-196075651 AGGAGGCAAAATTAGAAAGATGG + Intergenic
945029230 2:205648401-205648423 GGGAAGAAAAGGGAGAAAAAAGG - Intergenic
945569046 2:211441155-211441177 AGAATGCAAAGGTAGAAACAAGG - Intronic
946121372 2:217518026-217518048 AGGAGGAAAAGTTAAAGATGGGG + Intronic
946167635 2:217874965-217874987 AGGATGAGAAGCTGGAAATAAGG - Intronic
946444243 2:219724569-219724591 AGGGGGAAAAGGCAGAGAGATGG - Intergenic
946536696 2:220637922-220637944 AGGAGGACAAGGATGAAATCAGG + Intergenic
946713295 2:222527831-222527853 AGTAGGATAAGGTAGAATTATGG + Intronic
947684703 2:232072649-232072671 AGGAGGCAAGGGTAGAAGCAGGG + Intronic
947944198 2:234086159-234086181 AGGAAGAAGAGGGAGAAATTAGG + Intergenic
948263397 2:236620904-236620926 AGGTGGGAAAGGTAGAAAAAGGG + Intergenic
1168786741 20:545850-545872 GGGAAGAAGAGGAAGAAATATGG + Intergenic
1168847546 20:955719-955741 AAGAGGAATTGGTAGAAAAATGG + Intergenic
1168880556 20:1202932-1202954 AGAAGGAAAAGGGAGAAAGTAGG + Intergenic
1169009807 20:2241185-2241207 AGGAGGAAAAGAAAGAAGAAAGG - Intergenic
1169241610 20:3986229-3986251 AGGAGGAAAAGGAAGGAAGGAGG - Intronic
1169405826 20:5320339-5320361 AGGAGGCCAAGGTGGAAAGATGG + Intergenic
1170072535 20:12383967-12383989 AGCCGGAAGAGGTAGAAATTTGG + Intergenic
1170201856 20:13752836-13752858 AGGAGGAAAAAGCAGAACAAAGG + Intronic
1170260277 20:14397912-14397934 AGAAGGAAAGAGTAGAATTATGG - Intronic
1170634394 20:18092250-18092272 AGGAGGAAGGGGTAGAGAGAGGG - Intergenic
1171358243 20:24567176-24567198 AGGAAGAAAAGGAGGAAACAGGG + Intronic
1171426551 20:25052134-25052156 AGGATGAAAAGGTAGAAAGGAGG + Intronic
1171960918 20:31493570-31493592 AGGATGACAAGGCAGAAAGATGG + Intergenic
1172508755 20:35484559-35484581 AGGGGGAAAAGGCAAAAAGAAGG - Intronic
1172659143 20:36555461-36555483 AGGAGGACAAGGAAGAGATGGGG + Intergenic
1172861281 20:38054332-38054354 AGGAGGAAACTGGAAAAATAGGG + Intronic
1172909527 20:38396525-38396547 TGGAAAAAAAGTTAGAAATAAGG - Intergenic
1173364020 20:42369032-42369054 AGGAGGGAAGGGGAGAAAGAAGG - Intronic
1173563559 20:44023089-44023111 GGGAGGAAAGGGAAGAAAGAAGG + Intronic
1173890804 20:46508501-46508523 AGGAGCAAACAGTAGAAACACGG + Intronic
1174890174 20:54383389-54383411 AGGAGGAAATGGAAGAAGAAAGG - Intergenic
1174983075 20:55419480-55419502 AGGAGGAAGAGGTACATGTAAGG - Intergenic
1174986542 20:55460555-55460577 TAGAGGAAAAGGGAAAAATAAGG - Intergenic
1175073549 20:56355034-56355056 AGGAGGAAAAGGAAGAGGAAAGG - Intergenic
1175140034 20:56854133-56854155 AGGAAGAAAAGAAAGAAAGAGGG - Intergenic
1175439721 20:58981798-58981820 ATGAGGAAAAAGTAGAACTTAGG + Intronic
1175469877 20:59219944-59219966 TGAAGGAGAAGGTTGAAATATGG + Intronic
1175817829 20:61892888-61892910 GGGATGGAAAGGTAGAAAGAGGG + Intronic
1176003653 20:62847362-62847384 AGAAGGAAATAATAGAAATAAGG + Intronic
1176404836 21:6353129-6353151 AGGAGGGATATGTATAAATATGG - Intergenic
1176432321 21:6635975-6635997 AGGAGGGATATGTATAAATATGG + Intergenic
1176693775 21:9949315-9949337 AGGAGGAAAAAGGAGAAAGGAGG + Intergenic
1176892483 21:14334954-14334976 AGGAGGAAAAGGATAAAAGATGG - Intergenic
1176911729 21:14573579-14573601 AGGTAAAAAATGTAGAAATACGG + Intronic
1177146523 21:17412693-17412715 AGAAGGAAAAGGTGGAAAGCTGG + Intergenic
1177177127 21:17712295-17712317 AGGAGGAGAAGGGAGAAGGAAGG - Intergenic
1177330476 21:19654056-19654078 AGGAGGAAAAGGTAACAAACAGG + Intergenic
1177649204 21:23938931-23938953 AGGAGGAAAAGGAGGCAGTATGG - Intergenic
1178044312 21:28676738-28676760 AGGGGGAAAAAGGGGAAATAGGG - Intergenic
1178140716 21:29680465-29680487 CAGAGGCAAAGGTAGAAATATGG - Intronic
1178147278 21:29754772-29754794 AGGATGTAAAGGTAGAACTGAGG + Intronic
1178360445 21:31944656-31944678 GGGAGGTTAAGGGAGAAATATGG + Intronic
1178590701 21:33907260-33907282 AGGAAGAAAAGGGAAAAACAGGG - Intronic
1179001660 21:37466544-37466566 AGAAGGTAAAGGTAAAAAGATGG + Intronic
1179775116 21:43657441-43657463 AGGAGGAAAAGGAAGTCATCTGG + Intronic
1180289905 22:10839453-10839475 AGGGAGAAAAGGTGGAAATAGGG + Intergenic
1180492702 22:15868875-15868897 AGGGAGAAAAGGTGGAAATAGGG + Intergenic
1181832425 22:25571772-25571794 AGGAGGAAAACTGAGAAATCTGG - Intronic
1182126074 22:27816775-27816797 AGGAGGAAAGGAAAGAAAAAAGG - Intergenic
1182570221 22:31231698-31231720 AGGAGGCAGAGGTAGAAAAATGG + Intronic
1182755894 22:32678604-32678626 AGGAAGAAGAGGAAGAAAGAAGG - Intronic
1182962749 22:34490949-34490971 AGGAGGAATAGGTAGGCACATGG - Intergenic
1183148266 22:36015851-36015873 AGAAGGAAAAGAAAGAAAAAGGG + Intronic
1183601140 22:38841294-38841316 AAGAGGAAAAGGTATACATGGGG + Intronic
1184014814 22:41778014-41778036 AGGAGGAGAAGGAAGAAAGGAGG - Intronic
1185268040 22:49914966-49914988 AGGAGGCCAAGGTAGGAAGATGG - Intronic
949507938 3:4744305-4744327 AGAAGGAAGAGAAAGAAATAAGG - Intronic
949688090 3:6600881-6600903 ATGAGGAAAAGGTAGAAGGGAGG + Intergenic
949862323 3:8517107-8517129 AGAAGGAAAAGGAAGAGCTATGG - Intronic
950277460 3:11674826-11674848 AGGAGGAGAAGAAAGTAATAAGG + Intronic
950357668 3:12425483-12425505 GGGAGGGAAAGGAAGAGATAAGG - Intronic
950582097 3:13869240-13869262 AGGAAGAAAAGAAAGAAAGAGGG + Intronic
951156950 3:19367036-19367058 TGGAGAAAAGGATAGAAATAAGG - Intronic
951254955 3:20438048-20438070 AGGAGAAGAAGGAAGACATATGG + Intergenic
951755331 3:26085145-26085167 AGGAGAAGAAAGGAGAAATACGG - Intergenic
951829319 3:26906875-26906897 AGAGGAAAAAGGTAGAAAAAAGG - Intergenic
951887695 3:27540013-27540035 AGGAGGAAAAGGGAGAATGAGGG + Intergenic
951947519 3:28156992-28157014 AGGAGGCAAAGGCAGAAGGATGG + Intergenic
952006218 3:28845250-28845272 AGGAGGAACAAGAAGAAAGAGGG - Intergenic
952101140 3:30014593-30014615 AGGAGGCAATGGTAGAACCAAGG + Intergenic
952108041 3:30091923-30091945 AGGAGGAAAAAGTACAAAGAAGG + Intergenic
952192911 3:31042865-31042887 AGGAAGAAAAGGAGGAAACAGGG - Intergenic
952222146 3:31333649-31333671 AGGAGGTAAAGAAAGAGATAAGG + Intergenic
952324731 3:32310798-32310820 TGGAGGAAAACATAGAAATTTGG + Intronic
952522919 3:34180196-34180218 AGGAGGAAGAGGAAGAAAGTGGG - Intergenic
952650812 3:35724762-35724784 AAGAGGAAGTGGTAGAAACATGG - Intronic
953473959 3:43190344-43190366 GGCAGGAAAAGGTAGGAACAGGG - Intergenic
953859548 3:46531393-46531415 AGGAGGAAAAGGTAGAAGAAGGG + Intronic
954034074 3:47841088-47841110 AGGAGGAAGAGCTAGAAGAAGGG + Exonic
954487866 3:50871613-50871635 AGGAGGTAGAGAAAGAAATAGGG - Intronic
954814267 3:53268216-53268238 ATGAGGAAGAGGGAAAAATAGGG - Intergenic
954991529 3:54844531-54844553 AAGAGAAAAAGGTGGAAGTAGGG - Intronic
955645527 3:61133455-61133477 AAGAGGAAAAGGGGAAAATAGGG + Intronic
955741285 3:62093952-62093974 AGGAGGAAAAGGAAGAGAGAAGG - Intronic
955764414 3:62326247-62326269 AGAAGGAAAAAGGAGAGATAGGG - Intronic
955978887 3:64504688-64504710 AAAAGGAAAAAGAAGAAATATGG - Intergenic
956212616 3:66817221-66817243 AGGAAAAAATGGTACAAATAAGG + Intergenic
956373795 3:68592376-68592398 AGGGGAAAAAAGGAGAAATATGG - Intergenic
956514028 3:70026368-70026390 CAGAGGAAAAAGTAGAAAGAAGG - Intergenic
956524724 3:70145041-70145063 AGGAGGTAAGGGGAGAAAGATGG - Intergenic
956665418 3:71637553-71637575 AGGGGGAAAAGGGAGAAGGAAGG + Intergenic
956922037 3:73940211-73940233 AAGAGGAAAAGGTAGAATCCAGG - Intergenic
957158438 3:76576959-76576981 AGGAGGAAAGGAGAGGAATAGGG + Intronic
957167115 3:76689744-76689766 AGGAGGAAAAGGTGGAGAAAAGG - Intronic
957284992 3:78206764-78206786 AGGAGGCAAACGTAGCAGTAGGG - Intergenic
957987844 3:87594301-87594323 AGAATGAAAAGGCAGAAAAAGGG - Intergenic
958592053 3:96170769-96170791 AGGAGGAAAAAGGAAAAAGAAGG - Intergenic
958717980 3:97809793-97809815 AGAAGGAAAAGGAAGAAGGATGG + Intergenic
958956180 3:100467676-100467698 AGGAGGAAAAAGGAAAAAGAAGG - Intergenic
959049385 3:101510485-101510507 AGGAAGAAGAGGTAGAAGGAAGG - Intronic
959336537 3:105072694-105072716 AGGAAGAAAAAGTAGAAAATTGG + Intergenic
959534424 3:107469314-107469336 AGGAGGAATAGAGGGAAATATGG + Intergenic
959623400 3:108423071-108423093 AGGAAGAAAAGGGGGAAACAGGG + Intronic
959631352 3:108510611-108510633 AGAAGAAAAAAGTGGAAATAAGG + Intronic
959800202 3:110485095-110485117 AAATGGAAAAAGTAGAAATATGG + Intergenic
960164988 3:114391086-114391108 AGGTAGCAAAGGGAGAAATAGGG - Intronic
960202874 3:114859239-114859261 AGGAGGAAAAGAAAGAAGAAAGG - Intronic
960243500 3:115373442-115373464 AGGAAGAAAAGGAAGAAATCGGG - Intergenic
960312210 3:116130843-116130865 AGGAGGAAAAGAGAGGAAAAGGG - Intronic
960386129 3:117023857-117023879 AGGAAGTAAAGGAAGAAATAAGG - Intronic
960525350 3:118703768-118703790 AGGTGGAAAAGGAAGAGATGGGG - Intergenic
961030137 3:123595613-123595635 AGGTGGAAGAGGAAGCAATAAGG - Intergenic
962033209 3:131623138-131623160 TGTAGCAAAAGGTAGAAATGGGG - Intronic
962912719 3:139869049-139869071 AGGAGAAAAAGGAAAGAATAAGG + Intergenic
963277026 3:143342067-143342089 AGGAGGCAAAGGTGGAAACGTGG + Intronic
963364224 3:144314113-144314135 AGGAGTAATGAGTAGAAATAAGG - Intergenic
963641795 3:147869514-147869536 AGGAGAAAAATTTGGAAATAGGG + Intergenic
963939110 3:151083115-151083137 AGGAGGAAAAGGTGAGAATGAGG + Intergenic
964059064 3:152499327-152499349 AGTAAGAAAAGGTAGAAAGTTGG + Intergenic
964236477 3:154536142-154536164 AGGAGGAAGAGGAAGAGAAAAGG - Intergenic
964591027 3:158361806-158361828 AGGGGGAAAAGGAAGAAAGAAGG - Intronic
964608734 3:158587495-158587517 AGAAGGAAAAGGAACAATTAAGG + Intronic
964980480 3:162671195-162671217 AGCAGGGAAAGGTAAAACTATGG - Intergenic
965028206 3:163329177-163329199 AGGAAGAAAAGGGGGAAACAGGG - Intergenic
965543684 3:169894419-169894441 AGTAGGAAAAGCTAGTGATAAGG + Intergenic
965700846 3:171458557-171458579 TGGAGGAAAAGGTTTAATTAAGG + Intronic
965962476 3:174444547-174444569 AAGGGGAAAAGGAGGAAATAAGG + Intronic
966298855 3:178456036-178456058 AGGAAGAAAAGGGGGAAACAGGG + Intronic
966523868 3:180900344-180900366 AGGAAGAAAAGGGGGAAACAGGG - Intronic
966675409 3:182581423-182581445 AGGAGAGAGAGGTAGAAATAGGG + Intergenic
966967330 3:185007166-185007188 AGGAGGAAGAGGGGGAGATAAGG - Intronic
966991579 3:185236632-185236654 ATGAGGAACAGGTAGCAAAAAGG - Intronic
967012415 3:185448607-185448629 AATAGGAAAAAGTAGAAATGTGG + Intronic
967596786 3:191334678-191334700 AGGAGGAAAAGGAAAAGAGAAGG - Intronic
967636778 3:191810375-191810397 AGGAGGTAGAGTGAGAAATAAGG + Intergenic
967940831 3:194765171-194765193 AGGAGGAAAAGTTGGAAGAAAGG + Intergenic
967952231 3:194850318-194850340 AGGAATAAAAGGAAAAAATAAGG + Intergenic
968275816 3:197439585-197439607 AGAAGGAAAAGAGAGAAATAGGG + Intergenic
968533875 4:1112228-1112250 GGGAGAAAAAGGAAGAAAGATGG + Intronic
969252951 4:5981973-5981995 AGGAGGAGAAGGAAGAATTCAGG + Intronic
969986185 4:11213385-11213407 AGGAAGAAACAGTATAAATAGGG + Intergenic
970029134 4:11656619-11656641 TGGGGGAAAAGGCAGCAATAAGG + Intergenic
970176360 4:13343398-13343420 AGGAGGGAAATTTAGAAATCTGG - Intergenic
970306556 4:14738501-14738523 AGGAGGAAAGAGTAGGAAAAGGG - Intergenic
970726362 4:19049771-19049793 AGGATGAAAAGGCAGAATGAGGG - Intergenic
970905638 4:21213006-21213028 AGGAGGACAAGGATGAAAAAAGG + Intronic
970914893 4:21321590-21321612 AGGAGGAAGAGGGAGAAGAAGGG + Intronic
971089283 4:23321582-23321604 AGGAGAAAAAGAGAAAAATAGGG - Intergenic
971276398 4:25201748-25201770 AGGGGGAAAGGGTAGAAAGGGGG + Intronic
971617104 4:28805499-28805521 AGAAAGAAAAAGTAGAGATAAGG + Intergenic
971792153 4:31183694-31183716 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
971793695 4:31199852-31199874 AGGAGGAAAAAGTGGTAATGTGG - Intergenic
972825196 4:42750233-42750255 AGGGGGAAAAGGGAGAAGTGAGG - Intergenic
973210196 4:47606736-47606758 AGGAAGAGAAGGAAGAAATAAGG - Intronic
973220357 4:47719236-47719258 AAGAGCAAAAGGTAGAAGGAAGG - Intronic
973687933 4:53393031-53393053 CGTAGGAAATGGTGGAAATAGGG + Intronic
973717295 4:53689857-53689879 AGGAGGAAAAGGAGAACATAGGG - Intronic
974012633 4:56621122-56621144 AGGAGAAAATGGTATGAATAAGG + Intergenic
974133598 4:57787388-57787410 AGGAGGCAAAGGTGGAAACAGGG + Intergenic
974142564 4:57905951-57905973 AGGAAGAATAGGAAGCAATAGGG + Intergenic
974202773 4:58662808-58662830 AGAAGGAAAATGTAGAATTGGGG - Intergenic
974358470 4:60843639-60843661 AGTAGGAAAATTTATAAATATGG + Intergenic
974629887 4:64474290-64474312 AGGAGGTAAAGAAAGAGATAGGG - Intergenic
974674791 4:65076153-65076175 AGGAAGAAAAGGGGGAAACAGGG - Intergenic
974850741 4:67402709-67402731 AGGGGGAAAAGGTAGGAAGGAGG + Intergenic
975293008 4:72699220-72699242 ATCAGGAAAATGCAGAAATAAGG + Intergenic
975328561 4:73087865-73087887 AGGGGGAAAAGGAGGAAAGAAGG + Intronic
975604469 4:76140195-76140217 AAGAGGAAAAGGTGGATAGAGGG + Intronic
975614644 4:76234448-76234470 AGGAAGAAAAGGAAGAAACAGGG + Intronic
975817753 4:78236718-78236740 ATGAGGAAAGGTGAGAAATAGGG + Intronic
975986933 4:80208700-80208722 AGGAGGAAAAGGGAGTGAGAAGG - Intergenic
975996630 4:80322683-80322705 AGTAGGAAAAGGTAGGAATAGGG + Intronic
976823625 4:89234957-89234979 GGGAGGAAGAGGAAGAAAGAGGG + Intergenic
976883809 4:89962379-89962401 AGGAGGAAAAGGAAGAGAAAGGG + Intergenic
976958775 4:90940311-90940333 AGGAGGAGAAGGGAGGGATAAGG - Intronic
977732287 4:100368232-100368254 AGCATGAAAAGGTAGCAAGAAGG + Intergenic
977892614 4:102329182-102329204 TGAAGGAAAAAGTAGAAATAAGG + Intronic
977922093 4:102656918-102656940 AGGAGGGATAGGGAAAAATAGGG + Intronic
977982226 4:103337767-103337789 AGAAGAAAAAGGGGGAAATAGGG + Intergenic
978330377 4:107606471-107606493 AGGGGGAAAAAGCAGAAAAATGG - Intronic
978650839 4:111002702-111002724 AGGATGAAAAGGCAGAAGTGTGG - Intergenic
978776798 4:112513810-112513832 TGGAGGAAAAGGGAAAAATCAGG - Exonic
979002611 4:115243768-115243790 AGGAGGAAAAGGAGGAAAGGAGG - Intergenic
979100680 4:116608995-116609017 AGGAGAAAAAAGTGGAAAGAAGG + Intergenic
979162823 4:117485324-117485346 AGGGAGGAAAGGTAGAAGTATGG + Intergenic
979269771 4:118746180-118746202 AGGAAGAAAAGGAGGAAAGAAGG + Intronic
979557329 4:122063861-122063883 AGTCAGAAAAGGTAGAAAAAAGG + Intergenic
979584296 4:122396681-122396703 AGTAAGAAAAGATTGAAATATGG + Intronic
979661655 4:123262620-123262642 AAGAGAAAAAGGTATAAAAATGG - Intronic
979875675 4:125887917-125887939 TGAAGGAAAAGGGAGAATTAAGG - Intergenic
980366388 4:131809511-131809533 AGGAGGAAAAAGGAGAAAGAAGG + Intergenic
980413622 4:132457026-132457048 AGGTGGAAAAAGAAGAAATTGGG + Intergenic
980479549 4:133370105-133370127 GGGAGGATAAGGCAGAAAAATGG - Intergenic
980613269 4:135185204-135185226 ATCAGGAAAATGTAGAAACATGG + Intergenic
981035616 4:140165488-140165510 ATAAGGAAAATGTAGAAAAATGG - Intergenic
981203608 4:142013793-142013815 AGGAGGTAGAGATAGACATAAGG - Intergenic
981291526 4:143082182-143082204 AGGAGGGAAAGGAAGAGAAAGGG + Intergenic
981360783 4:143843337-143843359 GGGAGGAAAAGGTAGAGGAAGGG + Intergenic
981360791 4:143843369-143843391 GGGAGGAAAAGGTAGAGGAAGGG + Intergenic
981360799 4:143843401-143843423 GGGAGGAAAAGGTAGAGGAAGGG + Intergenic
981380624 4:144067601-144067623 GGGAGGAAAAGGTAGAGGAAGGG + Intergenic
981829904 4:148987378-148987400 AGGAGAGAATGGTAGACATAAGG - Intergenic
981832570 4:149019412-149019434 AGGAAGAAAAGGAAGATATCAGG - Intergenic
981909909 4:149967098-149967120 GGGAAGCAAAGGTAGAAATTGGG + Intergenic
982187377 4:152816324-152816346 AGGAGGAAATGGCAGAGAGATGG - Intronic
982216498 4:153086907-153086929 GGGAGAAAAAGGGAGAAACAGGG + Intergenic
982283984 4:153715465-153715487 AGGAGGAGAAGGAGGAAAGAAGG + Intronic
982578856 4:157152932-157152954 AGATGGAAAAGGTGGAAATGTGG + Exonic
982584548 4:157220988-157221010 AGGAGGAAAAGGAAAAAAAAAGG + Exonic
982886346 4:160787758-160787780 AGGAGGAAAAGGTAGTTGTGTGG + Intergenic
982890079 4:160836095-160836117 AGGAAGAAAAGGGAGAAAGTGGG - Intergenic
983238031 4:165201959-165201981 ACAAGGAAAATGAAGAAATATGG + Intronic
983306240 4:165992101-165992123 AATAGGAAACGGTAGGAATAAGG - Intronic
984178604 4:176452466-176452488 AGGAGTAACAAGTAGACATAAGG - Intergenic
984213297 4:176877119-176877141 GAGAGGAAAAAGTAGAATTAAGG + Intergenic
984523323 4:180826428-180826450 AGGAGGAAAAGATGGAAGGAAGG + Intergenic
985254338 4:188054971-188054993 AGGAAAGAAAAGTAGAAATATGG - Intergenic
985997251 5:3603757-3603779 ATCAGGAAAGGGTGGAAATAGGG - Intergenic
986102619 5:4627856-4627878 AGGAGGAAGAGGAAGAAGAAAGG + Intergenic
986538892 5:8822624-8822646 AGGAGCAAGAGAAAGAAATAGGG - Intergenic
986838979 5:11674187-11674209 AGGAGGAAAAGCTGTAGATATGG - Intronic
986898541 5:12402142-12402164 AGGAGCAAAAGGGAAAAATTGGG - Intergenic
987455141 5:18134931-18134953 AGGAGGAAAAGGAAGAAGAGGGG - Intergenic
988273529 5:29049645-29049667 AGGAGAACAAGGAAGAATTAAGG - Intergenic
988623626 5:32848385-32848407 AGGAAGAAAAGATGGAAAGAAGG - Intergenic
988702216 5:33686481-33686503 AGGGATAAAAGGTAGAAAAAGGG - Intronic
988702818 5:33692255-33692277 AGGAGGAAAAGGAAGAGAAGGGG - Intronic
988994164 5:36698314-36698336 AGGATGAAAAGGTGGAAAATGGG - Intergenic
989141911 5:38209927-38209949 AGGAGGGAGAGGGAGAAAGAGGG - Intergenic
989340524 5:40369044-40369066 ATGAAGAGAATGTAGAAATATGG - Intergenic
989419806 5:41224396-41224418 AGGAGGGATAGGGAAAAATAGGG - Intronic
989756223 5:44958807-44958829 AGGAGGAGGAGGAAGAAAAACGG - Intergenic
990279322 5:54232574-54232596 AGAACCAACAGGTAGAAATATGG + Intronic
990356118 5:54967769-54967791 AGGAGGAAAAGGAAGCAACATGG + Intergenic
991178173 5:63715548-63715570 AACAGGAATAGGTAGAAATATGG - Intergenic
991411627 5:66351864-66351886 ATGAGGCAAAACTAGAAATAGGG - Intergenic
991472915 5:66988296-66988318 GGAAGGAAAAGGTAGAATTAAGG + Intronic
992339572 5:75808772-75808794 AGGAGGAAAGGGTGGAAAGGGGG - Intergenic
992442713 5:76810967-76810989 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
992813165 5:80408976-80408998 AGGAAAAAAAGGAAGAAATTAGG - Intronic
992869983 5:80996062-80996084 AGGAGGAGGAGGAAGAGATAAGG - Intronic
993045202 5:82858543-82858565 GGGAGGAAAAGAAAGGAATAGGG + Intergenic
993133026 5:83923312-83923334 AGGAGGAGAAGATAGATATTAGG - Intergenic
993616571 5:90119490-90119512 AGGAGCAACAGGTCCAAATAAGG + Intergenic
993664226 5:90675330-90675352 AGGAGGAAGATGGAGAAATCAGG + Exonic
993865791 5:93193476-93193498 ATAAGGAAAAGGGAGAAAAAAGG + Intergenic
993930793 5:93936726-93936748 AGAAGGCATAGGTAGAATTATGG - Intronic
994620223 5:102154354-102154376 AGGAGGAAAGGGGGGAAAAAAGG + Intergenic
994756035 5:103794398-103794420 AGGAGGATAAGGCAGGAAAAGGG - Intergenic
994839140 5:104898835-104898857 AAGATGGAAAGGTAGAAATAGGG - Intergenic
994893405 5:105669058-105669080 AGGAGGTAGAGAAAGAAATAGGG - Intergenic
994978581 5:106843170-106843192 AGGAGTAAGAGATAGAGATAGGG + Intergenic
995071129 5:107923141-107923163 AGGAGGAGAAGGAAAAAACAAGG + Intronic
995304495 5:110629601-110629623 AGGAGGTAAAGGTCGAATGAAGG - Intronic
995411364 5:111860661-111860683 AGGAAATAAAGTTAGAAATATGG - Intronic
995534951 5:113125925-113125947 AAGAGGAAAATGTAAAAACATGG + Intronic
995733425 5:115271252-115271274 AGGCAGAAAAGGCAGAAAAAAGG - Exonic
996397945 5:123032131-123032153 AGGAGGAGCAGGAAGAAAGAGGG + Intronic
996553847 5:124757849-124757871 AGGAAGAAAAGGGGGAAACAAGG - Intergenic
996610363 5:125371920-125371942 GGGAGAAAAAGGAAGAAAAAAGG - Intergenic
996968818 5:129338489-129338511 GGGAGGCAAAAATAGAAATAGGG - Intergenic
997169841 5:131706080-131706102 AGGAAGAAAAGGGAGAAATGAGG + Intronic
997276945 5:132601383-132601405 TGTAGGAAAATGTAAAAATAGGG + Intronic
997309907 5:132871149-132871171 AGGATGAAATGGGAGAAAGAGGG - Intergenic
998042607 5:138962026-138962048 AGGAGGTTAAGGAAGCAATAAGG - Intronic
998081821 5:139281826-139281848 AAGAGGAAAAACTAAAAATAAGG + Intronic
998121766 5:139584152-139584174 AGGAAAAAAAGGTAAAAAAATGG - Intronic
998350754 5:141499023-141499045 AGGAAGAAAAGAAAGAAAAAGGG + Intronic
998405100 5:141869739-141869761 AGGAGGAAAAGAAGGAAAGAGGG - Intronic
998633198 5:143923999-143924021 AAGGGAGAAAGGTAGAAATAAGG - Intergenic
998653508 5:144148171-144148193 AGAAAGAAAAGAGAGAAATAAGG + Intergenic
998707593 5:144781305-144781327 AGGAAGCAAAGGTAGAAGCAGGG + Intergenic
998975089 5:147636492-147636514 AACTGGAAAAGGTAGAAATAGGG - Intronic
999355534 5:150927182-150927204 AGAAGGAGAATGTAGAAAAAAGG - Intergenic
999390622 5:151186903-151186925 TGGAGGAAAAAGGAAAAATATGG - Intronic
999467355 5:151820514-151820536 AGGAGGAAAAGTTTAAAAGAGGG - Intergenic
999513133 5:152273584-152273606 AGGAGGAAAAGAGAGAGAGACGG - Intergenic
999553632 5:152717665-152717687 AGGAAGAAAAGGAGGAAACAGGG - Intergenic
1000005473 5:157179494-157179516 AGGAGGAAAAGGGAAAGAAAAGG + Intronic
1000116319 5:158157116-158157138 AGGAGGAACAACCAGAAATAAGG - Intergenic
1000126068 5:158245242-158245264 AGGAGAGAAAGAAAGAAATATGG - Intergenic
1000128961 5:158276297-158276319 AGGAGGAACAAGTAGAGGTATGG - Intergenic
1000159691 5:158585397-158585419 AGGAGGTAGAGAAAGAAATAAGG - Intergenic
1000604396 5:163312720-163312742 AGGAAGTCAAGCTAGAAATAGGG - Intergenic
1000741301 5:164973436-164973458 AGGAGGAAAAAGGAGAAAGAAGG + Intergenic
1000763400 5:165254741-165254763 GGGAGGAAAAGAAAGAAAAAAGG - Intergenic
1000982493 5:167831121-167831143 AGGAGGAGAAGGAAGAGAGAAGG - Intronic
1000992120 5:167922185-167922207 ATGAGGAAAAGGAAGAACCAAGG - Intronic
1001341005 5:170845407-170845429 AGGAAGAAAAAGTAGGAAAATGG - Intergenic
1001418620 5:171568951-171568973 AGGTGGAAAAGAGAGAAAAAAGG - Intergenic
1001477467 5:172060781-172060803 ATGAGATAAAGGTAGAAAAATGG + Intronic
1001701388 5:173709069-173709091 AAGAGGAACAGGGAGAAACATGG - Intergenic
1002041115 5:176515044-176515066 AGGAGGAACAGGCAAAACTATGG - Intergenic
1003005594 6:2378157-2378179 AGGAGGAAAAGAAGGAAAGAAGG + Intergenic
1003047054 6:2743607-2743629 AGTAGGAGAAGGAAGAGATACGG + Intronic
1003633456 6:7809520-7809542 AGGCGGAAAAGGATGAAATGCGG + Intronic
1003711461 6:8596506-8596528 GGGAAGAAAAGGAAGAAAAAAGG - Intergenic
1004442812 6:15670175-15670197 AAGAAGAAAAGGTAGAAGCAGGG - Intergenic
1004483025 6:16039086-16039108 AGGGGGAAAGGGAAGAAAAAAGG - Intergenic
1004542325 6:16562808-16562830 AGGAGAACAAGGTCAAAATAAGG + Intronic
1005280694 6:24270675-24270697 AGGAGGAAGATGTAGCCATAGGG - Intronic
1006017205 6:31091327-31091349 AGGAAGAAAACGGAGAAACAGGG - Intergenic
1006347372 6:33493797-33493819 AGAAGGAAAAGAAAGAAAGAAGG + Intergenic
1006371026 6:33643616-33643638 AGGAGGAAAAGAAGGAAAAAGGG - Intronic
1006506896 6:34495093-34495115 AGGAGGAGAGGGTAGGAATTAGG - Intronic
1006520117 6:34566414-34566436 AGGAGGAAAGGAAAGAAAGAAGG + Intergenic
1006697718 6:35945565-35945587 AGGAGGACAAGGTAGGCAAAGGG - Intronic
1006774653 6:36582735-36582757 AGGAGGCTAAGGCAGGAATATGG + Intergenic
1006810971 6:36820254-36820276 AGGAGGCAGAGGTAGCAATGTGG + Intronic
1007255364 6:40524526-40524548 AGATGGAAAAGGTACAAAAATGG - Intronic
1007376633 6:41461370-41461392 AGGAGAAGAAGGATGAAATAGGG + Intergenic
1007865603 6:44966134-44966156 CAGAGGAGAAGGTAGAATTAGGG - Intronic
1008113906 6:47524715-47524737 AGAAGGCAAAAGTAGAAATGGGG - Intronic
1008687145 6:53938238-53938260 AGGAGGTAAAGGTAGTAGGATGG - Intronic
1008699684 6:54084120-54084142 AAGAGGAAAAAGTAGAACTGTGG - Intronic
1008839146 6:55878397-55878419 AAGAGGAAAGGGTGGAGATAAGG + Intergenic
1009320261 6:62279410-62279432 AGGAGAAAAAGGAAGATATGAGG + Intronic
1009371358 6:62906993-62907015 AGGAGGAAGAGAAAGAAATAAGG + Intergenic
1009434688 6:63604201-63604223 AGGAAGGAAAGGTAGAAAGATGG - Intergenic
1009841520 6:69082464-69082486 AGGGGAAAAAAGTAGAACTATGG - Intronic
1009908350 6:69895513-69895535 AGGAAGGAAAGGCAGAAACAGGG + Intronic
1010163897 6:72892953-72892975 AGTAGGAAAAAATAGACATATGG + Intronic
1010453161 6:76026155-76026177 AGGAAGAAAAGGGGAAAATAGGG - Intronic
1010643240 6:78356310-78356332 AGGAGAAAAGGGGAGAAAGAGGG - Intergenic
1010669716 6:78673896-78673918 AGGAAGAAAAGGGGGAAAAAGGG + Intergenic
1010794671 6:80105645-80105667 GGGAGGAGAGGGTAGAAATGGGG - Intergenic
1011524760 6:88252448-88252470 AGGATGAAAAGATAGACAGATGG + Intergenic
1011604225 6:89086706-89086728 AAAAAGAAAACGTAGAAATATGG + Intergenic
1011701355 6:89958077-89958099 AGGAGTAAAACTTACAAATAGGG - Intronic
1011816083 6:91192560-91192582 GGGGAGAAAAGTTAGAAATAGGG + Intergenic
1011958886 6:93061095-93061117 AAGATGAGAAGGTAGAAATGTGG + Intergenic
1012111348 6:95239093-95239115 AGGGGCAAATGGTAGAAAGATGG - Intergenic
1012182312 6:96169744-96169766 AGGAGCAAAAGAGAGAAATTTGG - Intronic
1012270902 6:97209128-97209150 AGTAGGAGAAGGAAGAAAAAGGG - Intronic
1012466841 6:99524776-99524798 AGGCTGAAAAGGTAAAAATCAGG + Intergenic
1012595346 6:101032041-101032063 AGGAGGAAAAGGAAAAAAGAAGG - Intergenic
1012669554 6:102025418-102025440 CGGAGGATAAGGTATATATATGG + Intronic
1012717620 6:102697518-102697540 AGGAGGTAGAGGGAGAGATATGG - Intergenic
1012798684 6:103796655-103796677 AGGAGGTTAAGGTAGAATTTAGG + Intergenic
1013308319 6:108870575-108870597 AGGAGGAAAGGAAAGAAAAAAGG + Intronic
1013410113 6:109876387-109876409 AGGAAGAAAAGGGGGAAACAGGG - Intergenic
1013754854 6:113449116-113449138 ATGAGGAAGAGTTAGTAATAAGG + Intergenic
1013800500 6:113936677-113936699 ATGAGGTAAAGGTAGATAGATGG - Exonic
1014428639 6:121340273-121340295 AGTAGGAAAAGGTATGACTAGGG - Intergenic
1014431633 6:121377548-121377570 AGGAAGAGATGATAGAAATAAGG - Intergenic
1014528975 6:122536972-122536994 TGCAAGAAAAGTTAGAAATATGG - Intronic
1014749339 6:125237273-125237295 AGAAGGATAAGGTGGAAGTATGG + Intronic
1015112448 6:129609021-129609043 GGGAGGAAAAGATAGAAAAAGGG + Intronic
1015230307 6:130907627-130907649 AAGAGGAAATGGGAAAAATAAGG + Intronic
1015787682 6:136934521-136934543 GGGAGGAAGAAGAAGAAATAGGG - Intergenic
1016686109 6:146884131-146884153 AGGAGAAAAAGAGGGAAATAAGG - Intergenic
1017432655 6:154386134-154386156 AGGAGGGAGAAATAGAAATACGG - Intronic
1017502104 6:155035066-155035088 AGGAGGAAAAGGTAGAAATATGG + Intronic
1017700753 6:157067803-157067825 AGGAAGAAAAGGCGGAAAAAAGG - Intronic
1017831392 6:158133315-158133337 AAAAGGAATAGGTAGAAAAATGG + Intronic
1018063774 6:160111276-160111298 AGGTGGAAGAGGTAGAAGAAGGG - Intronic
1018153117 6:160959192-160959214 ATGAGCTACAGGTAGAAATAAGG - Intergenic
1018239644 6:161760595-161760617 AGGAAGAAAAGGGGGAAACAGGG - Intronic
1018248878 6:161848169-161848191 AAGAGGAAAAGAAAGAAATAAGG - Intronic
1018300999 6:162403069-162403091 AGGCGGAAAAGATATAAATCTGG - Intronic
1018346894 6:162909054-162909076 AGCAGGAAAAGGAAGAAGTTAGG - Intronic
1018451323 6:163910847-163910869 AGGAAGAAGAGGAAGAAAGAAGG - Intergenic
1018457171 6:163962806-163962828 AGGAGGAAATGGTGTAATTAAGG - Intergenic
1018623878 6:165758665-165758687 AGGAGGAAGAGGAAGAAAGAAGG + Intronic
1018965214 6:168479890-168479912 AGGAGGAAAAAGTAAAATAAAGG - Intronic
1019076514 6:169392813-169392835 AGGAGGAAAAAAGAAAAATAAGG + Intergenic
1019221462 6:170476545-170476567 AAGAGGAACAGGTAGAATAAAGG - Intergenic
1019228901 6:170540803-170540825 AGGATGAAAAGCTAAAATTAAGG + Intronic
1019535372 7:1526482-1526504 AGGAGGAAGAGGAAGAAGGAGGG + Intergenic
1019839481 7:3425905-3425927 AGGATGGAAAGCTAGAAATCAGG + Intronic
1019869095 7:3742165-3742187 GGGAGGAAAGGGAAGAAAGAAGG - Intronic
1020050324 7:5077024-5077046 AGGAAGAAAAGGAAGGAAGAAGG - Intergenic
1020060678 7:5149487-5149509 AGGAGGAAGAGAGAGAAAGACGG - Intergenic
1020167662 7:5820764-5820786 AGGAGGAAGAGAGAGAAAGACGG + Intergenic
1020527313 7:9278537-9278559 AGGAGGAGTATGTAGAAATTAGG + Intergenic
1020555340 7:9663694-9663716 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
1021253608 7:18361914-18361936 AGGAGAGAAGGGAAGAAATAAGG - Intronic
1021536132 7:21706857-21706879 AGGAGCAAAAGGGAGAGTTAGGG + Intronic
1022045664 7:26620438-26620460 AGGATGAAAAGAAAGAAACATGG + Intergenic
1022090236 7:27103358-27103380 AGGAGGAAAAGGGAAAGAAAAGG - Intergenic
1022129867 7:27395278-27395300 AGGAAGAAAGGGTGGAAAGAAGG - Intergenic
1022188057 7:27988337-27988359 AGGGGGAAAATGTAGAGATGTGG - Intronic
1023160297 7:37290822-37290844 AGGAGTAAAAGGCAGAAGCAGGG + Intronic
1023355619 7:39364411-39364433 AGGAGGAAAGGGTGGAAAAGGGG - Intronic
1024018374 7:45340459-45340481 AGCAAGAAAAGATAGAAAAAAGG + Intergenic
1024037360 7:45519098-45519120 AGGAGGAAAAGGGAAACAGAAGG + Intergenic
1024277758 7:47692750-47692772 AGGAGGGAAAGATAGAAGTTGGG + Intergenic
1024398323 7:48894325-48894347 AGGAGGAAAAAGAAAAAAGAGGG - Intergenic
1025057858 7:55779616-55779638 AGGAGGAGGAGGCAGAAAGAAGG - Intergenic
1026001102 7:66559140-66559162 AGGAAGAAAAGGGGGAAAGAAGG + Intergenic
1026162683 7:67883386-67883408 AGGAAGAAAATGAAGAAGTAAGG - Intergenic
1026590130 7:71687135-71687157 AGGAGGAAAATGTATTAACAGGG - Intronic
1027626953 7:80557843-80557865 AAGGGCAAAAGGTAGCAATAAGG - Intronic
1027660385 7:80981471-80981493 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
1027921476 7:84400678-84400700 AAGAAGTAAAGGTAGAAATAGGG + Intronic
1028126677 7:87120725-87120747 AGGAGGAAGAGGTGGAAGTTAGG + Intergenic
1028582045 7:92418625-92418647 GGGAGGAAAAGGTAGAAGTATGG + Intergenic
1028700673 7:93775260-93775282 AGGAGGAGAAGGGAGAGAAATGG - Intronic
1028850524 7:95532493-95532515 AGGAGGAAAAGGTAACACGAGGG + Intronic
1028874229 7:95802449-95802471 TGGAGCAAAAACTAGAAATAAGG - Intronic
1029462124 7:100701307-100701329 AGGAAGGAAAGGAAGAAAAAGGG - Intergenic
1030139703 7:106292048-106292070 AGGAAGAAAAGGGGGAAACAGGG - Intergenic
1030282637 7:107792564-107792586 AGGAGGTAAAGAGAGCAATAAGG + Intronic
1030292884 7:107889718-107889740 AGGAGGAATGTGGAGAAATATGG + Intergenic
1030586423 7:111425213-111425235 AGGGGGAAAAGTGAGAAATGTGG + Intronic
1030834207 7:114263380-114263402 AAAAGGAAAAGGAAGAAAGAGGG - Intronic
1031197726 7:118638036-118638058 ATGAGGGAAAGGCAGAACTAAGG + Intergenic
1031282717 7:119824212-119824234 ATGAGGAAGAGGGAGAAATATGG + Intergenic
1031327985 7:120426490-120426512 AGGAAGAAAATGTGGAAATGTGG - Intronic
1031436370 7:121737133-121737155 AGGAGGTAATTGTAGAAATATGG + Intergenic
1031479952 7:122266503-122266525 AGGAGGAAAACCAAGAAATTAGG - Intergenic
1031835208 7:126673196-126673218 AGGAAGAAAAGGGAGAAACAGGG - Intronic
1031904216 7:127443025-127443047 AGGAGGAAAAGAAAAAAAGAAGG - Intergenic
1032479669 7:132236259-132236281 AGAAGGAAAAGGCAGAGAGAGGG - Intronic
1032482268 7:132256547-132256569 AGGAGGGAAAGGCAGGAATTTGG + Intronic
1032867160 7:135937731-135937753 AGGAGGAAGAGGTGGAAGGAGGG - Intronic
1032897936 7:136272856-136272878 AGGAGGATATGGTAGAAACCTGG - Intergenic
1033041714 7:137925207-137925229 AGGAGGCAGAGGGAGAAAAAAGG + Intronic
1033563592 7:142557764-142557786 AGGAGGAAAACGGGAAAATAAGG - Intergenic
1033897723 7:146095274-146095296 AAGTGGAAAAGGTAGATAGAGGG - Intergenic
1033925311 7:146451779-146451801 AGAAGGAATAAGAAGAAATAAGG + Intronic
1034924833 7:155112960-155112982 AGGAAGAAATGGTAGCAATGAGG + Intergenic
1035146977 7:156828865-156828887 AGGAGGAAAAGGGAAAATTTGGG - Intronic
1035878841 8:3221665-3221687 AGCTGGCAGAGGTAGAAATAAGG - Intronic
1035932138 8:3792058-3792080 AGGAGGAAAACATAGAGATTTGG - Intronic
1036084551 8:5599493-5599515 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
1036089127 8:5646110-5646132 CGGAGGAAAGGGTAGAAGTCAGG + Intergenic
1036371086 8:8163445-8163467 AGAAAGAAAAGAAAGAAATAGGG - Intergenic
1036397547 8:8381930-8381952 AGGAGAAAAAGGTAAAGATTAGG + Intronic
1036670585 8:10783025-10783047 AAGAGGAACAGAAAGAAATATGG + Intronic
1036879811 8:12502191-12502213 AGAAAGAAAAGAAAGAAATAGGG + Intergenic
1036914538 8:12792757-12792779 AGGAGGAAGAGAGAGAGATAGGG + Intergenic
1037253628 8:16926060-16926082 AGTAGGAGAAGGTAGTAAAAAGG - Intergenic
1037268341 8:17094910-17094932 AGCATGAAAAGATAAAAATACGG - Intronic
1037277725 8:17199718-17199740 AGAAGGAAAAAGAAGAAAGAAGG - Intronic
1037319901 8:17632294-17632316 AGAAAGAAAAGGTGGACATAGGG - Intronic
1037735008 8:21558721-21558743 AGGAGGCAAGGTTAGAAACAGGG + Intergenic
1038027483 8:23605052-23605074 AGGGGGAAATGGTAGGAAGAGGG + Intergenic
1038120400 8:24608016-24608038 AAGAGGAAAGGGAAGAAATGGGG + Intergenic
1038237809 8:25777902-25777924 AGAAGCACAAAGTAGAAATATGG - Intergenic
1038432112 8:27508658-27508680 AGGAGGAAGAGGAAGATAGAAGG + Intronic
1038936967 8:32262921-32262943 AGGAGGAAGAGTTAGATAAAGGG - Intronic
1039298026 8:36179588-36179610 AGCAGGAAAAAGTAGAATGATGG - Intergenic
1039613795 8:38938974-38938996 AGGAGGCAAAGGTTGAAGTGAGG - Intronic
1039648687 8:39316322-39316344 AGGAAGAAAAGGTAAAGAAAGGG - Intergenic
1039986415 8:42451810-42451832 AGGAGGAGAAGGAAGAGATGAGG + Intronic
1040984913 8:53283202-53283224 AGGAGTTAAAGGTATAACTAAGG - Intergenic
1041158163 8:55009354-55009376 AGGATTAAAAGGTAGAGAGAGGG + Intergenic
1041209916 8:55538886-55538908 AGGAGTTACAGGTGGAAATAAGG - Exonic
1041854480 8:62435058-62435080 AGGAGAAGAGGGTGGAAATAAGG + Intronic
1041932960 8:63307501-63307523 AATAGGAAATGGCAGAAATAAGG + Intergenic
1041980700 8:63855797-63855819 AGGTGCAAAAGGAAGAAAAATGG + Intergenic
1042414960 8:68508869-68508891 AGGAAGAAAAGGGGGAAACAGGG + Intronic
1042415585 8:68514144-68514166 AGGAGTAAAAGGTGGAAACAGGG + Intronic
1042563757 8:70092948-70092970 CGGTGGACAAGGTAGAAATGGGG - Intergenic
1042621176 8:70706074-70706096 AGAAGGAACAGGTTGAAACAGGG + Intronic
1042804561 8:72757424-72757446 TGGAGGAAAAGGCAGAATTCAGG + Intronic
1043015793 8:74939325-74939347 AGGAGGTAGAGAGAGAAATAGGG - Intergenic
1043123208 8:76358018-76358040 AGGAAGAAAAGAGAGAAAAATGG - Intergenic
1043300919 8:78730693-78730715 AAGGGGAAAAGCTAGACATATGG - Intronic
1043808365 8:84702620-84702642 AGGAAGAAAAGGAAGAAAGAGGG - Intronic
1044000256 8:86870852-86870874 AGGAGTAAAAGGTGGGAAAAAGG + Intronic
1044165528 8:88978287-88978309 AGAAGGAAAGGAAAGAAATAGGG - Intergenic
1044910558 8:97054005-97054027 AGGGGGAAAAGGGGGAGATAAGG + Intronic
1045085405 8:98677535-98677557 AGGAGGAAGAGGAAGGAAGAAGG + Intronic
1045400436 8:101811263-101811285 AGAAGAAGAAGGTAGAAATAGGG + Intronic
1045471724 8:102518617-102518639 AGGAGGAAAGGGTGGGAATGTGG + Intergenic
1046067152 8:109210969-109210991 AGCAAGAAAAGGGAGAAACAGGG - Intergenic
1046092714 8:109522001-109522023 GGGAGGAAAAGGAAGAACTCAGG - Intronic
1046150146 8:110212821-110212843 AGGAGGAAGAGAAAGAGATAGGG + Intergenic
1046482415 8:114839606-114839628 AGGAGGCAGAGGTAAAAAAATGG - Intergenic
1046556344 8:115777858-115777880 GAGAGGAAAGGTTAGAAATAAGG - Intronic
1046730520 8:117720692-117720714 TGGAGAAAAAGGTAGAAAGATGG - Intergenic
1046779275 8:118197738-118197760 AGAAGAAAAAGGGGGAAATATGG + Intronic
1046854050 8:119008930-119008952 AGGAAAAAAAGGAAGAAAGAAGG - Intronic
1046888448 8:119395176-119395198 TGCTGGAAAAGGTAGGAATAAGG + Intergenic
1047216402 8:122879681-122879703 TGGTGGCAGAGGTAGAAATAGGG - Intronic
1047526416 8:125638096-125638118 AGGAGGAGGAGGGAGAAAGAAGG + Intergenic
1047607862 8:126492471-126492493 AGGAGGAAAAAGAAGAAAATAGG + Intergenic
1048121925 8:131591228-131591250 TGGAACAAAAGGTAAAAATAGGG - Intergenic
1048403758 8:134097266-134097288 AAGAAGAAAAAGGAGAAATAGGG + Intergenic
1048440870 8:134458241-134458263 AGGAGGAATGGGGAGAATTAGGG + Intergenic
1048537833 8:135314107-135314129 AGGACAGAAAGGTAGAAAGAAGG - Intergenic
1048600955 8:135918220-135918242 AGGAGGGAAAGTTAGACAGATGG + Intergenic
1048984377 8:139726457-139726479 TGGAGGAAAAGATAAAAAAATGG - Intergenic
1049125137 8:140779715-140779737 TGGAGGAACAGGTATGAATAGGG + Intronic
1049218797 8:141419524-141419546 AGGAGGTAAAGGTGGAGACAAGG - Intronic
1049479444 8:142814081-142814103 AGAAGGAGAAGATAGCAATAAGG + Intergenic
1049809715 8:144560520-144560542 AGAACAAAAAGCTAGAAATATGG + Intronic
1050069236 9:1792974-1792996 AGGAAGAAAAGAGAGAAAAAGGG - Intergenic
1050260443 9:3836046-3836068 AGAATGAAAAGGAACAAATAAGG + Intronic
1050266069 9:3891112-3891134 AGGAGGAAAAGGTAGGTAATTGG + Intronic
1050421308 9:5468024-5468046 AGGAGGAGAATGAAGAAAGATGG + Exonic
1050510066 9:6384814-6384836 AGGAAGAAAAGGAGGAAACAGGG + Intergenic
1050626291 9:7507421-7507443 AGGGGGAATAGGGGGAAATAAGG - Intergenic
1051109593 9:13620707-13620729 AGAAGGAAAAAGAAGAAATGAGG - Intergenic
1051129255 9:13841282-13841304 AGAAGGAAAAGACAGAAACAAGG + Intergenic
1051143363 9:14002118-14002140 AGGAGGCTAAGGTAGAAAGCAGG - Intergenic
1051157944 9:14171584-14171606 TGGAGGATAAGGAAGAAAAAGGG + Intronic
1051185323 9:14454259-14454281 ATGAGGAAAATGTATTAATAAGG + Intergenic
1051308365 9:15740959-15740981 ATGAGGAAAAGTTTTAAATATGG - Intronic
1051719296 9:20019180-20019202 AGAAGGAAAAGAAAGAAAGAAGG + Intergenic
1051795783 9:20868312-20868334 AGGAATGAAAGGTAAAAATAAGG - Intronic
1051816490 9:21113105-21113127 AGGAGGAAAAGAGAGAGAAAAGG + Intergenic
1051954081 9:22668846-22668868 AGGAGGAAAAGACAGCAAAATGG - Intergenic
1052530816 9:29682191-29682213 AGGAGGAAAAAGTAGTTTTAGGG + Intergenic
1053124822 9:35572136-35572158 AGCAGGAAAAGGTACTAAGAAGG + Intergenic
1053180311 9:35962569-35962591 AAGAGGAAAAAGAAGAAAGAGGG - Intergenic
1053607692 9:39678124-39678146 AGGACGAAAAGGTTAAAAAAAGG + Intergenic
1053630740 9:39935409-39935431 AGGAGGAAAAAGGAGAAAGGAGG + Intergenic
1053775026 9:41528096-41528118 AGGAGGAAAAAGGAGAAAGGAGG - Intergenic
1053865539 9:42434491-42434513 AGGACGAAAAGGTTAAAAAAAGG + Intergenic
1054213147 9:62315289-62315311 AGGAGGAAAAAGGAGAAAGGAGG - Intergenic
1054245842 9:62664282-62664304 AGGACGAAAAGGTTAAAAAAAGG - Intergenic
1054559968 9:66698816-66698838 AGGACGAAAAGGTTAAAAAAAGG - Intergenic
1055177336 9:73336259-73336281 AGGGGGAAAAGGAAGGAAGATGG - Intergenic
1055360906 9:75489245-75489267 AGGAAAGAAAGGTAAAAATAAGG - Intergenic
1055399551 9:75908521-75908543 AGGAGGAAAGAGAAGAAAAAGGG - Intronic
1055818563 9:80235461-80235483 AGCAGGAAAACTGAGAAATATGG + Intergenic
1056075167 9:83030897-83030919 AGGTGGAAAAGGGAGAAAGAAGG - Intronic
1056120116 9:83479381-83479403 AGGAGAAAAAGGAAGAAAGGAGG + Intronic
1056145154 9:83721882-83721904 AGGAGGAAAGGGGAAAGATAAGG + Intergenic
1056288048 9:85111293-85111315 AGGAGGGTAAGGAAGAAACAAGG + Intergenic
1056614358 9:88150887-88150909 AGGGGGAAAAGAAAGAAAAAAGG + Intergenic
1056725547 9:89111632-89111654 AGGAGGAAGAGGTATTATTATGG + Intronic
1056894556 9:90531072-90531094 AGGAGGTAAAGATTGAAATTTGG - Intergenic
1056954286 9:91070049-91070071 AGGAGGAAAAGAGAGAGAGAAGG + Intergenic
1057031767 9:91781442-91781464 AGGAAGAAAAGTTAAAAATTGGG + Intronic
1057390510 9:94638727-94638749 AGGAGGACAAAGAAGAAATGGGG + Intronic
1057590438 9:96368604-96368626 GGGAGGCAAAGGTGGAAAGATGG - Intronic
1057596665 9:96420206-96420228 AGGAGGAAAAGGCTGAAAAATGG + Intergenic
1057598044 9:96433389-96433411 AGGAAGAAAAGGTGGAAAATGGG + Intergenic
1057824410 9:98361039-98361061 AGGAGAAAAAAGTAGAATAATGG - Intronic
1057942906 9:99300345-99300367 AGGTGGAAGAGGTAAAAAGATGG - Intergenic
1058136427 9:101312987-101313009 AGGGGGAAAAGGTAAAAAGAGGG - Intronic
1058705277 9:107632755-107632777 AGGAGGAAAAGGGAGGAAAAGGG - Intergenic
1059037183 9:110767233-110767255 GGGAGGAGAAAGCAGAAATATGG - Intronic
1059359773 9:113733007-113733029 TCTAGGAAAACGTAGAAATAAGG + Intergenic
1059437054 9:114283320-114283342 AGGAGGAAAATGTAGTAAAATGG + Intronic
1059575985 9:115489009-115489031 AGAAAGAAAAGGTAGAGAAAGGG + Intergenic
1059650991 9:116315719-116315741 AGGAGTAAGAGGAAGAAAGATGG + Intronic
1059684915 9:116625793-116625815 AGGAGGAAGAAGTGGAAAAAGGG - Intronic
1060122534 9:121007849-121007871 AGAAGACAAGGGTAGAAATAAGG + Intronic
1060128319 9:121072143-121072165 AGGAGGAAAAGGGGGCAACATGG + Intergenic
1060491735 9:124090202-124090224 AGGAAGAAAAGAAAGAAAGAAGG - Intergenic
1061970851 9:134044494-134044516 TGGAGGAAAGGGGAGAATTATGG - Intronic
1062090774 9:134677715-134677737 AGGAGGAACAGGGAGTAAGATGG - Intronic
1203439217 Un_GL000195v1:172737-172759 AGGAGGGATATGTATAAATATGG - Intergenic
1185701204 X:2231761-2231783 AGGAGGATAAGGCAGAAAGGAGG - Intronic
1185707263 X:2277045-2277067 AGGAGGAGAGGGAGGAAATAGGG + Intronic
1185707281 X:2277135-2277157 AGAAGGAAGAGGAGGAAATAGGG + Intronic
1185708299 X:2281822-2281844 AGGAGGAGAGGGAGGAAATAGGG + Intronic
1185999158 X:4989082-4989104 AGGAGGAAAGGAATGAAATAAGG - Intergenic
1186047109 X:5548565-5548587 AGGAGGAGAAGATAGAGAAAGGG - Intergenic
1186232693 X:7472902-7472924 AGGAGGAAAAGGGAGGTGTAAGG + Intergenic
1187025677 X:15433620-15433642 AGGAGGAGAAAGGAGAAAGAAGG + Intronic
1187493442 X:19774196-19774218 AGGAGGAAAAGGATAAAATCAGG - Intronic
1187845159 X:23527533-23527555 AGGAGGAAAAGAAAGAAGGAAGG + Intergenic
1188323860 X:28775069-28775091 AGGAAGAAAAGATATTAATAAGG - Intronic
1188383358 X:29525772-29525794 TGGAGGAAAGGGTTGAAATAAGG + Intronic
1188390010 X:29608472-29608494 AGGAGGAAAAGTAGGAAAGATGG + Intronic
1188403282 X:29774526-29774548 ACTAGGGAAAGGTAGAAGTAGGG - Intronic
1188451882 X:30316164-30316186 AGGAGGAAAAGCCAGTATTAAGG + Intergenic
1188683716 X:33043900-33043922 AGGAGCAAAAGGTATATATTAGG + Intronic
1189098502 X:38164495-38164517 TGAAGGAAAAAGGAGAAATAAGG - Intronic
1189518440 X:41740281-41740303 AGGAAGAAAAGAGACAAATATGG - Intronic
1189605457 X:42672825-42672847 AGGAGGAAAAGAGAGAAAGTTGG + Intergenic
1190490607 X:50979225-50979247 AGGAAGAAAAGGAGGAAAAAGGG - Intergenic
1190825675 X:54016001-54016023 AGGAGGAAAAGGTCAAAGAAGGG + Intronic
1190855208 X:54287495-54287517 AGGAGGAAAAGGAGGAAAGTGGG - Intronic
1191887175 X:65900697-65900719 AGGAGGCAAAGGGGGAAACAAGG - Intergenic
1192155669 X:68744734-68744756 AGCAGGAAAAGATAGAAAGGAGG - Intergenic
1192273098 X:69602343-69602365 AGGAGGGAAAGGGAGAAAAAGGG - Intergenic
1192543214 X:71992489-71992511 AGCAGGAAAGGGCAGAAACAGGG - Intergenic
1192858325 X:75038496-75038518 AGGAAGTAGAGATAGAAATAGGG - Intergenic
1193021050 X:76793714-76793736 AGAAGGAACAGCTAGAACTATGG + Intergenic
1193716479 X:84940184-84940206 AAAAGGAAAAGGTACAATTAAGG - Intergenic
1193815891 X:86104111-86104133 AGGAGGTAGAGAAAGAAATAGGG + Intergenic
1193944982 X:87723967-87723989 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
1194023679 X:88725021-88725043 AGGAGGTAGAGATAGAGATAGGG + Intergenic
1194066880 X:89271622-89271644 AGGAAGAAAAGGGGGAAATAGGG + Intergenic
1194393481 X:93349646-93349668 TGAAGGAAAAAGTAGAAACATGG + Intergenic
1194526801 X:94987077-94987099 AGGAGGTAGAGATAGAGATAGGG + Intergenic
1195173118 X:102288335-102288357 CGGAGGGAAAGGTGGAAAGAGGG - Intergenic
1195185748 X:102398760-102398782 CGGAGGGAAAGGTGGAAAGAGGG + Intronic
1195700498 X:107701996-107702018 AGGAGGAAGGGGAAGAAAGATGG - Intergenic
1196184696 X:112733503-112733525 AAGAAGAAGAGGGAGAAATAAGG - Intergenic
1196265885 X:113646107-113646129 AGGAGGGAAAGATAGGAATAGGG + Intergenic
1196398560 X:115290725-115290747 AGAAGGAAACTGTAGAAATGGGG + Intronic
1196578956 X:117357511-117357533 AGGAGGTAGAGGAAGAAATAGGG - Intergenic
1196630236 X:117930203-117930225 AGGATGAAAAGGAAGAAGGAAGG + Intronic
1197201019 X:123748591-123748613 AGGAGGAAGAAGCAGAAATTAGG + Intergenic
1197287038 X:124607765-124607787 AGGGGGAAAAGATGGAAACAGGG + Intronic
1197425663 X:126294881-126294903 AGGAAGAAAAGGGGGAAACAGGG + Intergenic
1197509236 X:127350473-127350495 AGGAGGAAAAGAGAGAAATAGGG - Intergenic
1197692424 X:129516277-129516299 AGGAAGAAAAGGTAGGAGAAAGG + Intronic
1198186524 X:134258784-134258806 AGGAGGAAAAAGAAGAATCATGG + Intergenic
1198191555 X:134311918-134311940 AGGAGATACAGGCAGAAATAAGG + Intergenic
1198257468 X:134936916-134936938 AGGAGGAAAAGAAAGAAGAAAGG - Intergenic
1198529396 X:137535901-137535923 AGGAGGAAAATGGACAAGTATGG - Intergenic
1199255740 X:145716522-145716544 AGGAAGAAAAGGGGGAAACAGGG - Intergenic
1199316585 X:146385596-146385618 AGAAAGAAAAGGGAGAAAGAGGG + Intergenic
1199576870 X:149320783-149320805 AGGAGGAAAATGTCCTAATAAGG + Intergenic
1199912469 X:152302120-152302142 AGGGGGAAAAGATAAATATAAGG + Intronic
1200721045 Y:6605781-6605803 AGGAAGAAAAGGGGGAAATCGGG + Intergenic
1200893575 Y:8350054-8350076 AAGAGGAAAAGAAAGAAAGAAGG - Intergenic
1200940517 Y:8775525-8775547 TGGAGAAGAAGGAAGAAATATGG - Intergenic
1200943967 Y:8813387-8813409 AAGAGCAAAAGGTAGAATTGAGG - Intergenic
1200954870 Y:8933296-8933318 AGGAGGAAGAGGAAGAAAGAAGG + Intergenic
1201015980 Y:9602089-9602111 ATGAGGAAAGGGTAGAACTTAGG - Intergenic
1201061576 Y:10051215-10051237 TGGAGGAAAAGGTGGCAATGAGG + Intergenic
1201321101 Y:12699373-12699395 AGGAGGAAAAAGGAAAAAGAAGG + Intergenic
1201461698 Y:14232778-14232800 AGGAGGAAGAGGAAGAAAGAGGG - Intergenic
1202042861 Y:20703228-20703250 AGGAGGTACAGAAAGAAATAGGG + Intergenic