ID: 1017502105

View in Genome Browser
Species Human (GRCh38)
Location 6:155035071-155035093
Sequence GAAAAGGTAGAAATATGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 435}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017502100_1017502105 2 Left 1017502100 6:155035046-155035068 CCACGAAGCTTTCACAGTTAAGG 0: 1
1: 0
2: 0
3: 1
4: 86
Right 1017502105 6:155035071-155035093 GAAAAGGTAGAAATATGGTTTGG 0: 1
1: 0
2: 3
3: 46
4: 435
1017502099_1017502105 13 Left 1017502099 6:155035035-155035057 CCTATATGGGTCCACGAAGCTTT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1017502105 6:155035071-155035093 GAAAAGGTAGAAATATGGTTTGG 0: 1
1: 0
2: 3
3: 46
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017502105 Original CRISPR GAAAAGGTAGAAATATGGTT TGG Intronic
902592024 1:17481985-17482007 GAAAGGGTGGTGATATGGTTTGG + Intergenic
903612812 1:24628970-24628992 GAAAAGGTACACACATGGTTGGG - Intergenic
903689569 1:25163056-25163078 GAAAAGGCAAAAATATGGATGGG + Intergenic
904046545 1:27612681-27612703 GAAAAGGAAGAAATAGTGCTTGG + Exonic
904071957 1:27807029-27807051 GCAATGGTAGTGATATGGTTTGG - Intronic
904741059 1:32676183-32676205 GAAAAGAAAGAAGTACGGTTAGG + Intronic
906039267 1:42774934-42774956 GAAAATGTAGACATGTGGATTGG + Intronic
907941318 1:59090430-59090452 CACAAGGTAGAATTATGGTGGGG - Intergenic
908124544 1:61017140-61017162 GAACAGTAAGAAATATGTTTTGG + Intronic
908536984 1:65087523-65087545 GGAAAGGTGGTGATATGGTTTGG + Intergenic
908928183 1:69282720-69282742 GAAAAGGTAGGAATACCTTTGGG + Intergenic
908942327 1:69450585-69450607 GAAAAGTGGGAAATATAGTTAGG - Intergenic
909488293 1:76198393-76198415 CAAAAGGTATAAATCTGGTTAGG - Intronic
910009501 1:82443539-82443561 CAAAAGGAAGAAAAATGCTTTGG + Intergenic
912065649 1:105737936-105737958 GAAAAGGGAAAACTATAGTTGGG - Intergenic
913036690 1:114973112-114973134 GAAAAGATATAAATATGATTTGG + Intronic
915766323 1:158366056-158366078 AAAAAGGAAAAAAAATGGTTGGG + Intergenic
916770156 1:167899889-167899911 GAAAAGGTAAAAATAACTTTGGG - Intronic
917599275 1:176558584-176558606 GAAAGGGGAGAAATAAGGGTTGG + Intronic
917809744 1:178646693-178646715 GAAAGGGAAGAAATACAGTTTGG + Intergenic
918409700 1:184245640-184245662 GAAAAGAAAGTGATATGGTTTGG - Intergenic
918759101 1:188378297-188378319 CAAAAGGTGGTGATATGGTTTGG - Intergenic
918773829 1:188602107-188602129 GAAAAGGTAGAAAATAGGATGGG - Intergenic
918939557 1:190974225-190974247 AAGAAGGTAGAAATGTGGTGTGG - Intergenic
919064078 1:192670869-192670891 GAAATGTTACACATATGGTTTGG + Intergenic
919131515 1:193456710-193456732 GAAAAGGTGAAAATATGAGTAGG + Intergenic
919136390 1:193513012-193513034 GGAAACTTAGAAATATGGTCTGG - Intergenic
919300543 1:195757821-195757843 TAAAAGGTAGAACTATGCATTGG + Intergenic
920085343 1:203411455-203411477 GAAAGGGTGGGAATATGTTTAGG + Intergenic
920739812 1:208569862-208569884 GAAAAGGTAGGAAGAGGGTAAGG - Intergenic
920806308 1:209237171-209237193 GAAAATGTGGAAATAGGGCTGGG - Intergenic
921293378 1:213679320-213679342 AACAAGGTAGAACTGTGGTTTGG - Intergenic
923800244 1:237202032-237202054 GAAATGGGAGAAATAGGGCTGGG + Intronic
924698947 1:246430471-246430493 AAAAAGCTAGAAATATAGTTTGG + Intronic
924704293 1:246487150-246487172 CAAATAGTTGAAATATGGTTGGG + Intronic
1063104854 10:2984188-2984210 ATATAGGTATAAATATGGTTTGG + Intergenic
1063256366 10:4331703-4331725 CAAAAGGTACAAAAATGGTTTGG - Intergenic
1063359405 10:5439066-5439088 GAAAAGGTAGAAATCAATTTTGG - Intronic
1064072581 10:12243394-12243416 AAAAAGGAAAAAATGTGGTTTGG + Intronic
1064450280 10:15435854-15435876 GAAAATTAAGATATATGGTTTGG + Intergenic
1064774348 10:18759045-18759067 GAAAAGGTTGGAAGAGGGTTAGG - Intergenic
1064949376 10:20830756-20830778 GAAAAGGTTAAAATATCCTTGGG + Intronic
1064969881 10:21054190-21054212 GAAACAGTAGAAAGGTGGTTTGG + Intronic
1065350825 10:24794255-24794277 GAAAAGAAAAAAATATGGTGGGG - Intergenic
1066177782 10:32927355-32927377 GAAATGGGAAAAATAAGGTTTGG + Intronic
1067285062 10:44901996-44902018 GAAAAGACAGGGATATGGTTTGG - Intergenic
1068629179 10:59282591-59282613 TAAATGGTAGAAATAGGCTTAGG - Intronic
1069884918 10:71617703-71617725 TAAAAGGTAGAAATAAGGCCAGG + Intronic
1070083872 10:73215515-73215537 AAAAAAGTAGAAAGATGGCTGGG - Intronic
1073693000 10:105832364-105832386 GAGAAGGTACAAATATGAATTGG + Intergenic
1073782419 10:106853159-106853181 GAAAATGTAGAAATCTGAATAGG - Intronic
1073855089 10:107664268-107664290 GATTAGATAGAGATATGGTTTGG - Intergenic
1074222090 10:111447951-111447973 GGAAAGGGGGTAATATGGTTTGG - Intergenic
1075039018 10:119092883-119092905 GAAAAGATAGAAATGGGGTGTGG + Intergenic
1075794823 10:125112406-125112428 AAAAAGGTAGAATGATGGCTGGG - Intronic
1077945220 11:6889981-6890003 GAGAGGGTAGAAATATGCTAAGG - Intergenic
1079524357 11:21366575-21366597 GAAGAGGCAGAAGGATGGTTTGG - Intronic
1079648078 11:22892217-22892239 GAAAATGGAAAAATATGGTTAGG + Intergenic
1079674551 11:23209401-23209423 GAAGAGGTGGAAATATGGTATGG - Intergenic
1079737075 11:24010564-24010586 GAAATGGTTTAAATATGGTGTGG + Intergenic
1079793054 11:24763854-24763876 GAAAAGGTAGAAATAGGTAATGG - Intronic
1079901190 11:26187365-26187387 GATAACATAGAAATATGATTTGG - Intergenic
1080101322 11:28463086-28463108 GAAAAGCTAGACATATATTTAGG + Intergenic
1080721502 11:34853683-34853705 GAAAAGATAGTAAGATAGTTAGG - Intronic
1081359072 11:42150455-42150477 TAAAAGGTACAAATGAGGTTCGG + Intergenic
1082909208 11:58351114-58351136 GAAAGAGTAGAAATGTGTTTTGG - Intergenic
1083534506 11:63455722-63455744 GAAAAGGTGGCAATAAGGTGTGG - Intergenic
1085881194 11:80468349-80468371 AAAAAAGTATAAATATGGCTGGG + Intergenic
1086107878 11:83166679-83166701 CAAAAGATGGAAATCTGGTTGGG + Exonic
1087389698 11:97517215-97517237 GAAAAGGGAAAAATATAATTGGG + Intergenic
1088535621 11:110857694-110857716 GAAAATGTGGAACCATGGTTTGG + Intergenic
1088969891 11:114763881-114763903 GAAAAATTAGAAATATGATTTGG - Intergenic
1089549077 11:119256474-119256496 CAAAATGTACAAATATGGTCAGG - Intronic
1091066283 11:132516231-132516253 GAAATGGAAGAAAAATGCTTGGG + Intronic
1091111986 11:132978215-132978237 TAAAAGGTAGGAAAATCGTTTGG + Intronic
1093456628 12:19371300-19371322 GAAAAGGAAGAAAAAAGGCTGGG - Intronic
1093631154 12:21411416-21411438 AAACAGGTCGAAATATGTTTGGG - Intronic
1094017429 12:25880088-25880110 GAAAAAGGAGAAATTTGTTTGGG - Intergenic
1094649450 12:32361258-32361280 TAAAAGGAAGAAATGGGGTTGGG + Intronic
1094657310 12:32432614-32432636 AAAAAGGTAGTAATAGGGGTTGG + Intronic
1095467532 12:42503770-42503792 GAAAAGGTATAAAGAAGGTGAGG - Intronic
1095514908 12:42994938-42994960 GGAAAAGGAGAAATATGGTCAGG + Intergenic
1095811941 12:46381388-46381410 AAAAATTTAGAAATATGGCTGGG + Intergenic
1096922940 12:55109147-55109169 TAAAAGGTACTGATATGGTTTGG + Intergenic
1097767111 12:63538488-63538510 CACAAGGTACAAATAAGGTTAGG - Intergenic
1097783459 12:63733433-63733455 CACAAGGTACAAATAAGGTTAGG - Intergenic
1100055442 12:90503442-90503464 GAAAAGGGAGTGATATGGTTTGG - Intergenic
1100703963 12:97180131-97180153 GAAAAATAAAAAATATGGTTGGG + Intergenic
1102427246 12:112853531-112853553 TATAAGGTGAAAATATGGTTGGG + Intronic
1102663343 12:114548694-114548716 TAAAAGGCAGAAATAGGGTGGGG - Intergenic
1103043297 12:117713977-117713999 GAAAAGGATGAAATATAATTTGG - Intronic
1104280169 12:127369513-127369535 GAAAAGGTAGAATGAGGCTTGGG + Intergenic
1105665040 13:22544821-22544843 GAAAAGGAAGAAACCTGGCTGGG - Intergenic
1107784557 13:43941982-43942004 GAAAGGATAGAAATAGGATTAGG - Intergenic
1107930855 13:45306124-45306146 TAAAAAGTAAAAATCTGGTTTGG - Intergenic
1108614635 13:52119992-52120014 GAAAAAGTAGAAATGAGGTGTGG - Intronic
1108910828 13:55549796-55549818 GAAAAGGTATTGATATGGTTTGG + Intergenic
1108979212 13:56489510-56489532 GAAAAAATAAAAATATGATTGGG - Intergenic
1109827246 13:67738263-67738285 GAAAAGTTAGAAATATATTAAGG - Intergenic
1109880218 13:68463611-68463633 GAAAATGTATTGATATGGTTTGG + Intergenic
1110409797 13:75191715-75191737 GAAAGGTTAGAGATAGGGTTGGG + Intergenic
1110681847 13:78323102-78323124 GAAAAGGGAGAAATATAGTTGGG + Intergenic
1110889763 13:80684466-80684488 GAAAAGGGGGAAAAATGATTTGG - Intergenic
1111205520 13:85004301-85004323 GAAAAGACATTAATATGGTTTGG - Intergenic
1111309237 13:86459512-86459534 GTAGAGGTAGATTTATGGTTTGG - Intergenic
1111556462 13:89887475-89887497 AAAAAGGTAGAATTAAGGTGGGG - Intergenic
1112082300 13:95985923-95985945 GAAAGGGTAAGAATATGATTTGG + Intronic
1112397775 13:99049041-99049063 GAATAGTTAAAAATATGTTTTGG + Intronic
1112979638 13:105367092-105367114 GAAAAGATTGAAAAATGGTTTGG - Intergenic
1114732990 14:25014197-25014219 AAAAAGTTAAAAATATGGCTGGG + Intronic
1115162884 14:30415419-30415441 GAAAAGGCAGAAAAAAGGTCAGG - Intergenic
1116041322 14:39689686-39689708 GAAAAGATAACATTATGGTTTGG - Intergenic
1116349172 14:43836931-43836953 GAATAGGTGGTGATATGGTTAGG - Intergenic
1116419344 14:44714668-44714690 GAAAAGCTAAAAATATAGATAGG - Intergenic
1118678316 14:68212608-68212630 GAAATGATAGCAATAGGGTTTGG + Intronic
1118680690 14:68238598-68238620 AAAAAGCAATAAATATGGTTGGG - Intronic
1119025534 14:71149336-71149358 GAAATGGCAGTGATATGGTTTGG + Intergenic
1120023325 14:79554246-79554268 GAAAAGGCAGGAATCTGGGTGGG + Intronic
1120187053 14:81404496-81404518 AAAAAGGAAGAAATATAGTGTGG - Intronic
1121591925 14:95121487-95121509 GAAAAGTTGGAAAAATGGTACGG - Intronic
1122394483 14:101413642-101413664 GAAAAGCTAATGATATGGTTTGG - Intergenic
1123102123 14:105811353-105811375 CAAAAGGGAGTGATATGGTTTGG - Intergenic
1202915535 14_GL000194v1_random:168217-168239 GAAAAGACAGACATGTGGTTAGG - Intergenic
1202877211 14_KI270722v1_random:14822-14844 GAAAAGACAGACATGTGGTTAGG + Intergenic
1123952555 15:25296145-25296167 CATAAGGTTGAATTATGGTTTGG - Intergenic
1124081687 15:26504747-26504769 TAAAAGGTAGAAATATATTTAGG - Intergenic
1124697541 15:31877602-31877624 GAAAAGTGAGAATTATGGTTTGG - Intergenic
1124948974 15:34298577-34298599 GAAAAAGTAGAAAAATGGGTGGG + Intronic
1125061661 15:35433227-35433249 GAAAAGGTAGAAAAATGGATTGG + Intronic
1125281167 15:38043841-38043863 GAGAAGGCAGAAATATGATGAGG + Intergenic
1126551933 15:49941060-49941082 GAAAAGAAAGAATTATGGTGGGG + Intronic
1126601351 15:50431226-50431248 AAAATGGTAGAAACATGCTTTGG - Intronic
1127012614 15:54646218-54646240 GAAAAGGTAGAAAAAGAGATGGG + Intergenic
1127059377 15:55166363-55166385 GGAAAGGAAGCAATATGGTTTGG - Intergenic
1127951918 15:63816086-63816108 GAAATGTTAGGTATATGGTTTGG - Intronic
1129382287 15:75175783-75175805 GAAAAGGTGGTGAAATGGTTTGG - Intergenic
1130123122 15:81069415-81069437 ATAAAGGCAGAGATATGGTTAGG + Intronic
1130941616 15:88514395-88514417 CAAAAGGTATAAATATCTTTAGG - Intronic
1134435262 16:14250946-14250968 GAAAAAGGAGAAAAATCGTTTGG + Intronic
1136036158 16:27542208-27542230 GAAAAGGCAGTACTATGGTTTGG + Intronic
1136185929 16:28589066-28589088 GAGAAGGGAGAAAGAGGGTTTGG - Intronic
1136459210 16:30399225-30399247 GAATAGATAGAAATAGGGATTGG + Exonic
1137434119 16:48441607-48441629 GAAAAGAAAGAAATTTGGCTGGG - Intronic
1138129879 16:54470622-54470644 GAAAGGGTGGTGATATGGTTTGG + Intergenic
1139695500 16:68671446-68671468 GAAGAGGAAGAAGTTTGGTTTGG - Intronic
1140971693 16:80019769-80019791 GCATAGGGAGTAATATGGTTTGG - Intergenic
1142942237 17:3390208-3390230 AAAAAGAAAGAAATAGGGTTGGG + Intergenic
1143276623 17:5716079-5716101 TAAAAGTTTCAAATATGGTTTGG - Intergenic
1144142682 17:12364856-12364878 GCAAAGTTTGAAATATGTTTAGG - Intergenic
1146104224 17:30016634-30016656 CAAAAGGTAGAAATATGACATGG + Intronic
1146209040 17:30927630-30927652 TAAAAGATAGAAATATGTCTAGG + Intronic
1147204252 17:38825240-38825262 GAAAACGTAGAGAAATAGTTCGG + Exonic
1147401895 17:40185382-40185404 TAAAAGGTAGTAAAATGGCTGGG + Intronic
1147881176 17:43654523-43654545 GAAAAATTAAAAATATGGTCAGG + Intronic
1148253846 17:46110778-46110800 GAAAGGAGAGAAATAAGGTTGGG + Intronic
1149881409 17:60295833-60295855 GAAACGGTATATATAGGGTTTGG + Intronic
1149972777 17:61235735-61235757 GACAAGGGAAAAAAATGGTTAGG + Intronic
1150030886 17:61734095-61734117 GATAAGGTACAAATATATTTAGG - Intronic
1152980618 18:272837-272859 GAAAAGGAAGGAATGTGGATTGG + Intergenic
1155090943 18:22510379-22510401 GAAAAGTCAGTGATATGGTTTGG - Intergenic
1155401979 18:25448872-25448894 GATAAGGTGGAAATAAGGGTCGG + Intergenic
1155424270 18:25689863-25689885 CAATAGGTAGTGATATGGTTTGG - Intergenic
1155732355 18:29176842-29176864 CAAAAGGTAGGAATGTGCTTAGG + Intergenic
1157952090 18:52050564-52050586 GAAAAGGTAGAAATACTAATGGG + Intergenic
1158899811 18:61952160-61952182 GACAAGGTAGAAAAAGGATTTGG - Intergenic
1159137077 18:64348898-64348920 TAAAAGGGAGTGATATGGTTTGG - Intergenic
1159436871 18:68429460-68429482 GTAAAAGTAGTGATATGGTTTGG - Intergenic
1159547105 18:69853069-69853091 GAAAAGATAGTAACATGTTTTGG + Intronic
1159614276 18:70562417-70562439 GAAAAGCCAGTGATATGGTTTGG + Intergenic
1160101252 18:75921886-75921908 GAAAAGGTAGTGATATTTTTGGG + Intergenic
1160139562 18:76309532-76309554 GAAAAGGGAAAAATAAGGTTTGG + Intergenic
1160423210 18:78763117-78763139 GAAATGGTAAAAATATTGCTTGG + Intergenic
1161890249 19:7030886-7030908 GAAAGGGAAGAAGTATGATTTGG + Intronic
1161891199 19:7039847-7039869 GAAAGGGAAGAAGTATGATTTGG - Intronic
1161893284 19:7058308-7058330 GAAAGGGAAGAAGTATGATTTGG - Intronic
1162105328 19:8366625-8366647 GAGAAGGTAGAAATGGGGTTCGG + Intronic
1162894923 19:13759466-13759488 GAAACAGTAGAAATTTGGCTGGG + Intronic
1163487392 19:17596245-17596267 GAAAAGGTGGCAATGTGGTGTGG - Intergenic
1163701329 19:18788195-18788217 GAAAAGGTAGATCTACGGCTCGG - Exonic
1163844937 19:19633351-19633373 GAAAAGGTAGAGTAATGGCTGGG - Intronic
1163908425 19:20167910-20167932 GAAAAGGGAGAAAAAGGGGTAGG - Intronic
1164795085 19:31019950-31019972 GAAATGATAGTAATATGGTTTGG - Intergenic
1165567753 19:36746223-36746245 GAGAAAGTTGAAATATTGTTGGG - Exonic
1167433761 19:49467375-49467397 AGAAAGAAAGAAATATGGTTTGG - Intronic
1167601270 19:50456208-50456230 GAATAGATGGAAATATGGATGGG - Intronic
1168589352 19:57619604-57619626 AAAAAGGTAGAAATAAGTTAGGG - Intronic
1168629077 19:57943198-57943220 GAAAAGGCAGTAATGAGGTTTGG + Intronic
1202673468 1_KI270710v1_random:18109-18131 GAAAAGACAGACATGTGGTTAGG - Intergenic
925115499 2:1375022-1375044 GAAAAGGTATATCTATGGTCGGG - Intronic
925415125 2:3664722-3664744 AAAAAAGTAAAAATATGGTTTGG + Intronic
925947426 2:8878733-8878755 GAAAAGTTAGAAAAGTAGTTTGG - Intronic
926229124 2:10989598-10989620 GAACAGGCAGGGATATGGTTTGG + Intergenic
926657995 2:15430730-15430752 GGAATGGTGGAAAAATGGTTGGG - Intronic
927107794 2:19842658-19842680 GAAAAGGCAGAAAGAAGGGTGGG + Intergenic
927219940 2:20697380-20697402 GAAAAGGATGAAATATGAGTTGG - Intronic
927238754 2:20901711-20901733 GAAAATATATAACTATGGTTGGG - Intergenic
927365228 2:22287254-22287276 GAAGAGGAAGAAACATGGATTGG - Intergenic
927829611 2:26338216-26338238 AAAAAGATAGAAATATGGCCAGG + Intronic
929511825 2:42570713-42570735 TAAAAAGTAAAAATATGGCTGGG + Intronic
931207438 2:60161639-60161661 GTCAAGGTTGAAATATGATTTGG + Intergenic
931654692 2:64500360-64500382 GAATAGGTAGTGATATAGTTTGG - Intergenic
931967282 2:67547595-67547617 GAAAACATACTAATATGGTTTGG - Intergenic
932976754 2:76611438-76611460 GAAAAGGTATGAATATTGTCAGG - Intergenic
933094077 2:78156303-78156325 GAAACAGTATATATATGGTTTGG + Intergenic
935063214 2:99626278-99626300 GAAAAGGTAGAAAATTCCTTTGG + Intronic
936649166 2:114406704-114406726 AAAAAGCCAGAAATCTGGTTTGG - Intergenic
936651460 2:114431613-114431635 GAAAAGGCAGAAATATTTTGTGG + Intergenic
937678698 2:124620498-124620520 TAATGGGTAGAAATATGATTTGG + Intronic
939536511 2:143437728-143437750 GAAAAGGTAGACATCTGGCTGGG + Intronic
939547792 2:143574730-143574752 GAATTGGTAGAAATATCTTTAGG + Intronic
939845816 2:147245025-147245047 GAAAAAGTAGAATGATGGCTAGG + Intergenic
939847672 2:147268181-147268203 GATAAGGTAGAAATTTAGGTAGG + Intergenic
940320877 2:152375152-152375174 GAAAAGGTAGTAGTATTCTTAGG - Intronic
940936563 2:159502134-159502156 GAAAATATAGAACTATGGGTAGG + Intronic
941531380 2:166675448-166675470 GAAAAGCCAGAAATATGACTGGG + Intergenic
942706140 2:178775074-178775096 GAAATGGTATAAAGATGGTATGG - Exonic
942822396 2:180130055-180130077 GAAAATTTTGAAATATGGTAAGG + Intergenic
943033082 2:182708730-182708752 ACATAGGTAGTAATATGGTTTGG - Intergenic
944237339 2:197452476-197452498 GAAGAGGGAGGAATATGGTAGGG - Intergenic
944929389 2:204500965-204500987 GAAGAGGGAGAAATATCTTTGGG + Intergenic
945123015 2:206477825-206477847 GAAAAGTTAGAAGAATGGCTGGG - Intronic
945163422 2:206917380-206917402 CAAAAGGTAGCAATGTGTTTTGG - Intergenic
946828204 2:223700862-223700884 CAAAAGGTAGAAATATTGGCTGG + Intergenic
947266511 2:228288218-228288240 GAAAAAGTAGGAATTAGGTTAGG - Intergenic
947805254 2:232962239-232962261 GAAAAGAAAGAAATATGGCTGGG + Intronic
1169405827 20:5320344-5320366 GCCAAGGTGGAAAGATGGTTTGG + Intergenic
1170116765 20:12868739-12868761 GAATAGGGAGAAATATGATTAGG + Intergenic
1170790585 20:19505914-19505936 GGAGAGGGAGAAATATGGATAGG - Intronic
1171418636 20:25001170-25001192 GAAAAAAAAGAAATATGGCTTGG - Intergenic
1172092324 20:32442422-32442444 AAAATGGTAGGAATATGGCTGGG - Intergenic
1174496804 20:50950985-50951007 GAAAAAGTATATATAAGGTTTGG - Intronic
1175018920 20:55823491-55823513 TAAAAGGCAGAAAAATGGGTAGG + Intergenic
1175029498 20:55938237-55938259 CAAAAGCTAGAAACATAGTTAGG - Intergenic
1175065313 20:56279634-56279656 GAGAGGGGAGTAATATGGTTTGG + Intergenic
1176634887 21:9182865-9182887 GAAAAGACAGACATGTGGTTAGG - Intergenic
1177085036 21:16693118-16693140 CAAAGGGTACAAATATAGTTAGG + Intergenic
1177266854 21:18797283-18797305 ACAAAGGTAGTGATATGGTTTGG + Intergenic
1177550236 21:22611367-22611389 AAGAAGGTAGAACTATGGTAGGG - Intergenic
1177638335 21:23814920-23814942 GAAAAGGAAGAAGAAAGGTTGGG + Intergenic
1178723766 21:35033296-35033318 GAAAAGCTGGAATTATGTTTTGG + Intronic
1179106974 21:38409708-38409730 AAAAAGGGAGAAATTTGGTGTGG + Intronic
1180415254 22:12703935-12703957 GAAAAGACAGACATGTGGTTAGG + Intergenic
1181894648 22:26096263-26096285 GTAATGGTAGAAATCTGGCTGGG - Intergenic
1182728322 22:32466946-32466968 GAAAAGGTAGAAAGATGTAGAGG - Intergenic
1183158601 22:36094943-36094965 GAAGAAGTGGAAATATGGCTGGG - Intergenic
1185047046 22:48533765-48533787 GAAAAGGAAAAAAAAAGGTTTGG - Intronic
949393464 3:3589127-3589149 TAAAAGGTAGTAAAATGGATTGG + Intergenic
949611938 3:5711682-5711704 GAAAAAGTACTGATATGGTTTGG - Intergenic
949784978 3:7730867-7730889 GAAAAAGTAGAAATCTGATGTGG + Intronic
950396105 3:12735267-12735289 GAAACAGTAGAAAAATGGTCTGG - Intronic
950401981 3:12775960-12775982 GAAAAGGGAGTGATATGGTTTGG + Intergenic
951357124 3:21681195-21681217 GATAACGTAGGAATATGGTAAGG + Intronic
951764977 3:26187679-26187701 GATTTGGTAGAAGTATGGTTAGG + Intergenic
952056137 3:29449090-29449112 GACAAGTTAGCATTATGGTTTGG - Intronic
952117016 3:30195055-30195077 GAAAAGGTAAAAATATCAGTAGG - Intergenic
952833309 3:37583589-37583611 GCAAAGATAGAAATAAGATTGGG - Intronic
953541649 3:43824378-43824400 GGAAAGGTAGAGATATGGGTGGG - Intergenic
953570155 3:44065010-44065032 GAAAAGAAAGAACTAGGGTTTGG + Intergenic
954046320 3:47934257-47934279 GAAAGGGTAGAAATTTGACTGGG - Intronic
954493794 3:50933214-50933236 GAAAAGGTACTGATATGGTTTGG - Intronic
954603689 3:51892519-51892541 GAAGAGGTAGAAATATGGAAAGG + Intergenic
955853518 3:63247711-63247733 GAAAGGGAAGAAATGAGGTTTGG - Intronic
956189878 3:66598421-66598443 GAGAAGGCAGAAATAAGGTTTGG + Intergenic
956464744 3:69508150-69508172 GAAGAGGGAGAAATATGTTCAGG - Intronic
956846432 3:73187867-73187889 AAAAAGGTAGAGATACAGTTAGG - Intergenic
957102378 3:75844834-75844856 GAAAAGACAGACATGTGGTTAGG - Intergenic
957273517 3:78061604-78061626 GAGAAGGTTGAAATATAGGTTGG - Intergenic
957461631 3:80528857-80528879 TAAAAGGTGGTGATATGGTTGGG - Intergenic
957584993 3:82121579-82121601 GAAGAGGAAGAAATTTGGATGGG + Intergenic
958098497 3:88978481-88978503 AAAAAGGTATATATAGGGTTTGG + Intergenic
958528263 3:95290878-95290900 CAAAAGGGGGTAATATGGTTTGG - Intergenic
958747450 3:98154252-98154274 GAAAAGGAACAAAAAGGGTTGGG - Intergenic
958902803 3:99907637-99907659 AAAAAGCAAGGAATATGGTTTGG - Intronic
959134551 3:102400572-102400594 GAAAAGGGAGAGATATAGTCAGG - Intronic
959329805 3:104989357-104989379 AAAAAGAAAGAAATATGATTTGG + Intergenic
959509819 3:107198115-107198137 GAAAGGGGAGAAATGAGGTTTGG - Intergenic
960688362 3:120316588-120316610 AAAAAGTTAGAAAGATGGCTGGG + Intergenic
961436878 3:126925273-126925295 GAAAAGGTAAACACACGGTTTGG + Intronic
961750830 3:129093622-129093644 GAAAAGGTGGGGAAATGGTTAGG + Intronic
962433202 3:135339336-135339358 AAAAAAGTAGATATATGGATGGG + Intergenic
963520184 3:146354101-146354123 GAAAAGGGAGATATAGGGGTGGG - Intergenic
964503072 3:157369668-157369690 GAAATGGTAGATAGAGGGTTTGG + Intronic
964531245 3:157670384-157670406 GCAAGTGTAGAAAGATGGTTGGG - Intronic
964904448 3:161701934-161701956 GAAGAGGTAGAAAAATAGATAGG + Intergenic
965157796 3:165087173-165087195 GAATGGGTAGAAATATGTTTTGG + Intergenic
966118832 3:176498968-176498990 GAAAAGGGTGTAATGTGGTTTGG - Intergenic
966322011 3:178711475-178711497 GAATAGGTAGAAATCTGTCTTGG - Intronic
966460538 3:180171189-180171211 AAAAAGGAAGAATTATGATTAGG + Intergenic
967260443 3:187636230-187636252 GAAAGGTGAGTAATATGGTTTGG - Intergenic
967323232 3:188214468-188214490 AAGATGGTAGAAATATGTTTTGG + Intronic
967558513 3:190889698-190889720 GAAAAGGTAAAAATATCTTGTGG - Intronic
969144904 4:5114099-5114121 GATGAGGTAGTGATATGGTTTGG - Intronic
970029135 4:11656624-11656646 GAAAAGGCAGCAATAAGGTGTGG + Intergenic
970984528 4:22140825-22140847 GAATAGGCAGTGATATGGTTTGG - Intergenic
971134969 4:23858492-23858514 GCAATGGTAGCAAGATGGTTAGG - Intronic
974157729 4:58095556-58095578 GAAAGGATAGGAATATGGTTTGG - Intergenic
975212069 4:71712476-71712498 GAAAATGGAGAAATATGTTGTGG + Intergenic
976176612 4:82360508-82360530 TAAAGGGTAGAAAGAAGGTTAGG - Intronic
976275329 4:83271154-83271176 GAAAAGAAAGAAACATAGTTAGG - Intronic
976427234 4:84919475-84919497 GAACATGTAGTAATATGGTTTGG + Intronic
976671611 4:87660799-87660821 AACGAGGTAGAAACATGGTTTGG + Intronic
977628676 4:99217329-99217351 GAAAAGGTACAAACATGGCCGGG - Intronic
977727122 4:100309209-100309231 ATAAAGGTAAACATATGGTTTGG - Intergenic
977754895 4:100657041-100657063 GGAAAGGTGGTGATATGGTTTGG + Intronic
978970660 4:114800306-114800328 GAAAAAATAAACATATGGTTTGG - Intergenic
979410515 4:120373019-120373041 GAAAATGAACAAATATAGTTGGG - Intergenic
979680992 4:123459480-123459502 TAAAAGTTAAAAATATGGCTGGG + Intergenic
979734002 4:124059645-124059667 TGAAAGGAAGAAATATGTTTGGG - Intergenic
980660085 4:135846574-135846596 CAAAAGGTAGAAATTTCATTAGG - Intergenic
980758139 4:137191906-137191928 GAAAAGATGGTGATATGGTTTGG - Intergenic
981256054 4:142661137-142661159 GAAAAGGGAGAAAAACGGGTGGG - Intronic
981547035 4:145904131-145904153 GAAAAGGTAGAAAAGTGGCAGGG - Intronic
981593753 4:146394958-146394980 GAAGAAGTAGAAATGTTGTTTGG - Intronic
982121409 4:152146815-152146837 AAAAGGGTAGCAATATGGATTGG - Intergenic
982742314 4:159070548-159070570 GTAAAGATACACATATGGTTTGG + Intergenic
982862344 4:160468703-160468725 GAACAGCAAGTAATATGGTTTGG - Intergenic
983278041 4:165642780-165642802 GAAAAGTTAAAAAAATGATTTGG - Intergenic
983486687 4:168340616-168340638 GTAAATGTAAAAATTTGGTTGGG - Intergenic
983564071 4:169131349-169131371 GAAAAGGAAGAAACTGGGTTTGG - Intronic
987141096 5:14947275-14947297 GAACAGGTAGTAGTATGGTGAGG - Intergenic
987448290 5:18049349-18049371 TAAAAGTTACAAATATGATTAGG - Intergenic
987792176 5:22581824-22581846 GAAAAGTTAAAAATGTGGTCAGG - Intronic
987964571 5:24855089-24855111 GAAAAGGGAGACATCTGGGTAGG - Intergenic
988173109 5:27684134-27684156 AAAAATGCAGTAATATGGTTTGG - Intergenic
988433927 5:31151127-31151149 GAACATCTAGAGATATGGTTTGG + Intergenic
989300324 5:39884029-39884051 GAATAGGTAGCAAAATGGTGGGG - Intergenic
989691646 5:44152101-44152123 GAAAAGGAAAAAATATTTTTTGG - Intergenic
990365402 5:55065553-55065575 GAAAAGGTAGCAATAAGCTAGGG - Intergenic
991049107 5:62253805-62253827 AAAAAGGAAGTAAGATGGTTTGG - Intergenic
992188254 5:74264838-74264860 GACTAGGTAGAAATACAGTTTGG + Intergenic
992591355 5:78299458-78299480 AAATAGGTATCAATATGGTTTGG + Intergenic
993084371 5:83345426-83345448 GTATAGGTAGAAATATAGTTAGG + Intronic
993590717 5:89791685-89791707 TAAAAAGTAGATATATGGGTGGG - Intergenic
993699355 5:91099738-91099760 GAAAAGTTACAAATATGGAAAGG + Intronic
994247204 5:97491521-97491543 GAAAAGATAGAAATAGGTTAAGG - Intergenic
994412651 5:99427965-99427987 AAAAAGGTAGTATTATGGTTTGG + Intergenic
994481190 5:100337758-100337780 AAAAAGGTAGTATTATGGTTTGG - Intergenic
994542395 5:101116558-101116580 GGATAGGTAGTGATATGGTTTGG + Intergenic
994628807 5:102255519-102255541 GAAATAGTAGAAATATATTTTGG - Intronic
994781657 5:104096724-104096746 GAAAGGTTAGTGATATGGTTTGG - Intergenic
994803279 5:104408213-104408235 CAAGAGATATAAATATGGTTTGG - Intergenic
995439604 5:112175789-112175811 GAAAAAGTGGAAACATGGCTAGG - Intronic
995489950 5:112680192-112680214 GAAAATGTGGAAAAATGGGTAGG - Intergenic
996058166 5:119002871-119002893 AAAAAATTAGAAATATGGCTGGG - Intergenic
997025619 5:130057217-130057239 GAAATGCTAAAAATATGGCTGGG - Intronic
997730390 5:136168134-136168156 AAAAAGGCAGGAATATGGCTGGG - Intronic
998313300 5:141156519-141156541 GAAAAGGTGGAAATAGGAGTTGG - Intergenic
998591773 5:143486428-143486450 GCAAAGATAGAAGTATGCTTAGG + Intergenic
998633197 5:143923994-143924016 AGAAAGGTAGAAATAAGGTTTGG - Intergenic
1001341004 5:170845402-170845424 GAAAAAGTAGGAAAATGGTGTGG - Intergenic
1001376957 5:171268874-171268896 GCAAAGGAAGTAATGTGGTTGGG + Intronic
1001735705 5:173997684-173997706 GAACAGGTAGAAATTTGCCTGGG + Intronic
1001756999 5:174178230-174178252 GAAAGGGTAGAAATTTGACTTGG - Intronic
1002472256 5:179442520-179442542 TGAAAGGTAGACACATGGTTGGG + Intergenic
1004161598 6:13218913-13218935 GAAAAGGTAGAAAAAGGGAAAGG + Intronic
1005403456 6:25459785-25459807 GAAATGGTAGAAGTAATGTTTGG + Intronic
1006196926 6:32249611-32249633 GAAAAAGAAAAAAGATGGTTAGG - Intergenic
1006447913 6:34090308-34090330 GAAAAGGTAGGAGGTTGGTTTGG + Intronic
1006550926 6:34822560-34822582 GAAAAATTAGAAGTTTGGTTTGG + Intronic
1007860048 6:44899028-44899050 GAAAGGGTAGAAAGATGGCTGGG + Intronic
1007927886 6:45664369-45664391 GCAAAGGAAGAAATGTGGTAGGG - Intergenic
1008127392 6:47684346-47684368 GAAAAGGTAGACAAATAATTAGG - Intronic
1008856962 6:56100084-56100106 GTAAAGGTAGAAACTTGGCTAGG - Intronic
1010373788 6:75142413-75142435 AAACAGGTGGAAAAATGGTTAGG - Intronic
1010823401 6:80443359-80443381 GATAAAGTAGGAATATGGCTGGG + Intergenic
1011238069 6:85239571-85239593 GATTAGGTATAGATATGGTTTGG + Intergenic
1011342283 6:86329925-86329947 GAAAAGGTAGAAACATGCAGTGG + Intergenic
1012068383 6:94578554-94578576 ATAAAGGTAGTGATATGGTTTGG - Intergenic
1012254260 6:97014848-97014870 GCAAAGGTTGTGATATGGTTAGG + Intronic
1012682811 6:102204249-102204271 GAAAAGGGATAAATGTGTTTTGG - Intergenic
1013278972 6:108616590-108616612 AAAAAGTTATAAATATGGCTGGG - Intronic
1013706926 6:112847137-112847159 GAAAAGTTAGAAAGATAGTACGG + Intergenic
1014823919 6:126026324-126026346 CTAAAGGTAGAAATATGCTTCGG - Intronic
1015689299 6:135903533-135903555 TGAAATGTAGAAATTTGGTTTGG - Intronic
1016174371 6:141061003-141061025 AGAAAGGTAGAAAGATAGTTTGG - Intergenic
1016529654 6:145043517-145043539 GAAAAGGTAGAAGTCTGTGTAGG - Intergenic
1017502105 6:155035071-155035093 GAAAAGGTAGAAATATGGTTTGG + Intronic
1017831393 6:158133320-158133342 GAATAGGTAGAAAAATGGAAAGG + Intronic
1018433198 6:163739451-163739473 GAACATTTAGAAATATGGATAGG + Intergenic
1018860123 6:167705122-167705144 GAAAAAGTAGATTTCTGGTTTGG - Intergenic
1020157510 7:5738411-5738433 GAAAATTAAGAAATATGGCTGGG + Intronic
1020378839 7:7519401-7519423 GAAAAGGGAGTGATATGCTTTGG - Intronic
1020769847 7:12376453-12376475 TAAAATGTAGAAATATATTTAGG + Intronic
1021316556 7:19155485-19155507 GATAAGGTAGAAAGATGCTGGGG + Intergenic
1021914074 7:25414211-25414233 GAAAGGATAGACATGTGGTTGGG - Intergenic
1022246960 7:28569904-28569926 AAAAATGTATATATATGGTTGGG + Intronic
1022586538 7:31618541-31618563 GAAAAGGTAGAGATGATGTTAGG + Intronic
1023073623 7:36461741-36461763 TAAGAGGTAGAAATATGGTCAGG - Intergenic
1023264251 7:38389775-38389797 GAAAAGATAGGAAGATGCTTTGG - Intronic
1023313102 7:38908007-38908029 GACTAGGTAGAAATTTGGTTTGG - Intronic
1023527447 7:41119307-41119329 TAAAAGATAGTGATATGGTTTGG - Intergenic
1023551270 7:41372452-41372474 GAGATGGTAAAAATTTGGTTAGG - Intergenic
1024436995 7:49368712-49368734 GAAAAGATATAATAATGGTTAGG - Intergenic
1025147669 7:56518869-56518891 GATGAGGTAGAAAAATGGGTTGG + Intergenic
1025970998 7:66325352-66325374 AAAATGGTAGTGATATGGTTAGG - Intronic
1026331362 7:69355224-69355246 GAAAAGGCAGAAGGCTGGTTTGG + Intergenic
1027821561 7:83052102-83052124 GAAAATCTAGATATTTGGTTTGG + Intronic
1028033423 7:85948719-85948741 GAAAAGATAGAAAGAGGGATTGG - Intergenic
1028676962 7:93476133-93476155 TAAATGGTCCAAATATGGTTTGG - Intronic
1029788210 7:102814946-102814968 GAAAAGGGAGAAATATCATTAGG - Intronic
1030856823 7:114568532-114568554 GATATGTTTGAAATATGGTTAGG + Intronic
1031442441 7:121811289-121811311 GTAGAGGTAGTGATATGGTTTGG - Intergenic
1031849925 7:126851331-126851353 GAAAAGGTAGAATCAGGGTGGGG - Intronic
1032430803 7:131859889-131859911 TAAAAGGAAGCAAGATGGTTTGG + Intergenic
1032991231 7:137396698-137396720 GAAAAGGTATAAAGATGAGTTGG - Intronic
1033441592 7:141385016-141385038 ACAAATGTAGAAAGATGGTTTGG - Intronic
1033481883 7:141750626-141750648 GCAAAGGGATAAATATGCTTTGG + Intronic
1033636238 7:143213877-143213899 GGAAGGGGAGATATATGGTTTGG - Intergenic
1033913712 7:146297411-146297433 GAAAAGGAAGAAATATAGATGGG + Intronic
1034144683 7:148858507-148858529 GAAAAAGTAGAATTATATTTGGG - Intronic
1034770955 7:153776204-153776226 CAAAGGGTAGTGATATGGTTTGG + Intergenic
1035330263 7:158092056-158092078 GGATAGGTAGAGAGATGGTTGGG + Intronic
1035934362 8:3820262-3820284 GGGAAGGTAGAAATATGTGTAGG + Intronic
1037068349 8:14612146-14612168 GAAAAGGTGTTGATATGGTTTGG + Intronic
1038063169 8:23934797-23934819 AAAAACGCAGAAATATTGTTCGG - Intergenic
1038104701 8:24419488-24419510 GAAAAGAAAGAAACATGGCTAGG + Intergenic
1039324473 8:36469465-36469487 GAGAAGATAGATATATGGATGGG + Intergenic
1040288819 8:46113939-46113961 GAAAAGGTAGAGGCATGCTTGGG + Intergenic
1040665976 8:49633507-49633529 GCAAAGGTAGAAACTTGTTTGGG - Intergenic
1040838997 8:51763836-51763858 GAAGAGGAGGAAATATGATTTGG - Intronic
1041166424 8:55097049-55097071 GAATAGGTAGTGATATGGTTTGG + Intergenic
1041602560 8:59737576-59737598 TAAAAGGTTGTGATATGGTTTGG + Intergenic
1041620555 8:59963117-59963139 CAAAAGGAAGAAGTATGATTTGG - Intergenic
1042693988 8:71535553-71535575 GAAAAGATATAAATTAGGTTAGG + Intronic
1042728501 8:71904342-71904364 GAATAATTAGAGATATGGTTTGG - Intronic
1043741659 8:83821233-83821255 GAAAAGATAGAGAAATAGTTGGG - Intergenic
1044555690 8:93559497-93559519 GAAGAGGAAGCAATATGGTTTGG + Intergenic
1045047237 8:98291200-98291222 TATAAGGTAGAAATATGGTTTGG - Intronic
1046138019 8:110056232-110056254 GAAAAGGCAGAAAAATATTTTGG - Intergenic
1047122134 8:121916372-121916394 AAAAAGGTAGTTATATTGTTGGG + Intergenic
1047216400 8:122879676-122879698 GCAGAGGTAGAAATAGGGCTGGG - Intronic
1047409628 8:124613871-124613893 TAAAAGTTAGGGATATGGTTGGG + Intronic
1048012640 8:130470435-130470457 GTAAAGGCAGCAATATGGTTTGG - Intergenic
1048121923 8:131591223-131591245 CAAAAGGTAAAAATAGGGCTGGG - Intergenic
1048145976 8:131843738-131843760 GGAAAGGAAGATATTTGGTTAGG + Intergenic
1048560656 8:135533522-135533544 GCAAAGGTGTAAATATGGGTGGG + Intronic
1048988268 8:139747098-139747120 GAAAAGGTAGAGACATTGCTTGG - Intronic
1049348124 8:142149611-142149633 GGAAATGTAGAAATAAGTTTGGG + Intergenic
1050835189 9:10068590-10068612 AAAGAGGGACAAATATGGTTTGG - Intronic
1051000753 9:12279203-12279225 GAAAAGCCAGTAATATGGGTTGG - Intergenic
1051660301 9:19419943-19419965 GAAACGGGAGAAAGATGGGTGGG - Intronic
1052821889 9:33144177-33144199 GAAAAGGTAGATATTTAGTCAGG - Intronic
1053276220 9:36785547-36785569 AAAAAGGAGGAAATGTGGTTTGG + Intergenic
1055259499 9:74416347-74416369 GAAAAGGTAAAAATATGCAATGG - Intergenic
1055876107 9:80943434-80943456 GAAAAGGTAGAAAAACAGTAAGG + Intergenic
1056275578 9:84991531-84991553 GGAGAGGGAGAAAAATGGTTTGG - Intronic
1056735481 9:89206001-89206023 GAAATGTGAGAAATATAGTTGGG + Intergenic
1058214264 9:102214153-102214175 GAAAAAAAAGAAATATGGTCAGG + Intergenic
1058951897 9:109911847-109911869 GAGAAGGTATAGATAGGGTTGGG + Intronic
1059049615 9:110909639-110909661 GAAAAGTTTGAAATATTGTGAGG - Intronic
1059437055 9:114283325-114283347 GAAAATGTAGTAAAATGGCTAGG + Intronic
1059694335 9:116716413-116716435 AACCAGGTAGAAACATGGTTTGG - Intronic
1060011455 9:120046372-120046394 TCAAAGGTTGAATTATGGTTAGG - Intergenic
1060416228 9:123432617-123432639 GGAAAAGGAGAAATATGCTTTGG + Intronic
1060613568 9:124990550-124990572 GAAAGGGTAGAAATGTGAGTTGG + Intronic
1186024566 X:5295254-5295276 GATGAGGGAGAAATTTGGTTGGG + Intergenic
1186137831 X:6538082-6538104 GAAGAGTTCGAAATGTGGTTGGG - Intergenic
1186838894 X:13465319-13465341 GAAGAGATAGTGATATGGTTTGG + Intergenic
1187358129 X:18597985-18598007 GAACAGGTAGAGATATGTATAGG + Intronic
1188112363 X:26207472-26207494 TCAAAAGTAGAAATATGGCTGGG - Intergenic
1189253892 X:39622483-39622505 GCAAAGGTACTGATATGGTTTGG - Intergenic
1189854035 X:45205172-45205194 GAAAGGGTAGAAGTATGGAAAGG - Intergenic
1190158416 X:48012347-48012369 GAGAAGGTAAAAATAGGTTTAGG + Intronic
1190591120 X:52002273-52002295 GAAAAGGTAGAAAAATATATAGG + Intergenic
1191173791 X:57478747-57478769 GAAAAGCAAGAAATATGGAAAGG - Intronic
1192348683 X:70335932-70335954 AAAGAGGTAGAAATAAGGGTGGG - Intronic
1193155662 X:78170815-78170837 CAAAGGGTAGAAATATGTTGAGG + Intergenic
1194831465 X:98627805-98627827 AAAAAGGTAGAAAAATGCATTGG + Intergenic
1195453062 X:105037372-105037394 GAAAAGATAGAAAAAGGGTTGGG + Intronic
1196472579 X:116045470-116045492 CAAAAGGTAAAAATGTGGGTTGG + Intergenic
1196692016 X:118570150-118570172 GAAAAGGTAAAATTATGGGATGG - Intronic
1196753492 X:119138181-119138203 GAGAAGGCAGAAGTTTGGTTTGG + Intronic
1197363350 X:125534199-125534221 GAAAATATAAAAATATGGCTGGG - Intergenic
1197406241 X:126054840-126054862 GAAAATATAGATATATAGTTTGG + Intergenic
1198096986 X:133389685-133389707 GGAAAGGTAGAAAGATGGGATGG + Intronic
1198634791 X:138684575-138684597 AAATAGGTTAAAATATGGTTTGG + Intronic
1198842468 X:140872726-140872748 GAAAACCTAGTGATATGGTTTGG - Intergenic
1198857932 X:141037819-141037841 GAAAAGGTGGAAATGAGCTTAGG - Intergenic
1198904764 X:141549551-141549573 GAAAAGGTGGAAATGAGCTTAGG + Intergenic
1199366103 X:146985450-146985472 GAGGAGGGAGAATTATGGTTTGG + Intergenic
1199386119 X:147225333-147225355 GAAAAGGGTGAAATATTCTTGGG + Intergenic
1200807953 Y:7451918-7451940 GAAAAAGGAGAAATGAGGTTGGG - Intergenic
1201171232 Y:11267780-11267802 GAAAAGACAGACATGTGGTTAGG - Intergenic
1201703384 Y:16908632-16908654 GGAAGGGTAGTAATTTGGTTTGG - Intergenic
1202034204 Y:20615048-20615070 GAACAGTTAGACATAGGGTTTGG - Intergenic