ID: 1017502106

View in Genome Browser
Species Human (GRCh38)
Location 6:155035074-155035096
Sequence AAGGTAGAAATATGGTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017502100_1017502106 5 Left 1017502100 6:155035046-155035068 CCACGAAGCTTTCACAGTTAAGG 0: 1
1: 0
2: 0
3: 1
4: 86
Right 1017502106 6:155035074-155035096 AAGGTAGAAATATGGTTTGGAGG No data
1017502099_1017502106 16 Left 1017502099 6:155035035-155035057 CCTATATGGGTCCACGAAGCTTT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1017502106 6:155035074-155035096 AAGGTAGAAATATGGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017502106 Original CRISPR AAGGTAGAAATATGGTTTGG AGG Intronic
No off target data available for this crispr