ID: 1017504024

View in Genome Browser
Species Human (GRCh38)
Location 6:155051105-155051127
Sequence GGTTCTGATTGAGAACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017504022_1017504024 4 Left 1017504022 6:155051078-155051100 CCTGGAGCAAAGAAAAGCTGGTT 0: 1
1: 0
2: 0
3: 24
4: 244
Right 1017504024 6:155051105-155051127 GGTTCTGATTGAGAACAAGCTGG No data
1017504020_1017504024 13 Left 1017504020 6:155051069-155051091 CCTAGTGGGCCTGGAGCAAAGAA 0: 1
1: 0
2: 4
3: 18
4: 221
Right 1017504024 6:155051105-155051127 GGTTCTGATTGAGAACAAGCTGG No data
1017504018_1017504024 24 Left 1017504018 6:155051058-155051080 CCTGACTGGTACCTAGTGGGCCT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1017504024 6:155051105-155051127 GGTTCTGATTGAGAACAAGCTGG No data
1017504017_1017504024 25 Left 1017504017 6:155051057-155051079 CCCTGACTGGTACCTAGTGGGCC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1017504024 6:155051105-155051127 GGTTCTGATTGAGAACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017504024 Original CRISPR GGTTCTGATTGAGAACAAGC TGG Intronic
No off target data available for this crispr