ID: 1017510775

View in Genome Browser
Species Human (GRCh38)
Location 6:155112804-155112826
Sequence CAGCAGGACTCGAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017510775_1017510788 19 Left 1017510775 6:155112804-155112826 CCACCTGCCCTCGAGTCCTGCTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 1017510788 6:155112846-155112868 AGAGCTTCAGCTGTGTCCGGAGG No data
1017510775_1017510786 16 Left 1017510775 6:155112804-155112826 CCACCTGCCCTCGAGTCCTGCTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 1017510786 6:155112843-155112865 TCCAGAGCTTCAGCTGTGTCCGG 0: 1
1: 0
2: 0
3: 34
4: 504
1017510775_1017510780 -10 Left 1017510775 6:155112804-155112826 CCACCTGCCCTCGAGTCCTGCTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 1017510780 6:155112817-155112839 AGTCCTGCTGGCTCTCCCTTCGG 0: 1
1: 0
2: 2
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017510775 Original CRISPR CAGCAGGACTCGAGGGCAGG TGG (reversed) Intronic
900243597 1:1627928-1627950 GAGCAGCACTCACGGGCAGGGGG - Intronic
900357735 1:2272870-2272892 CAGCGAGCCTCGGGGGCAGGAGG - Intronic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900544417 1:3220533-3220555 CGGCAAGACTCGAGGCCAGGTGG - Intronic
900630704 1:3633685-3633707 CAGCAGGACACGAGAGAGGGTGG - Intronic
901000897 1:6148320-6148342 CAGGAGGCTTCTAGGGCAGGAGG - Intronic
904530805 1:31167834-31167856 CAGTAGGATTCCAGGGCGGGTGG - Intergenic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
906572783 1:46858694-46858716 CAGCAGAACTGGGGGGCAGGAGG + Intergenic
906598986 1:47107194-47107216 CAGCAGAACTGGGGGGCAGGAGG - Intronic
906772602 1:48498653-48498675 GAGCAGGACGCCACGGCAGGAGG - Intergenic
907049184 1:51318216-51318238 CAGCTGGATTCCAGTGCAGGAGG + Intronic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
913530670 1:119732275-119732297 AAGCAGGACTCCAGGGCAGCTGG - Intronic
914827080 1:151144350-151144372 CAGCAGCTCCTGAGGGCAGGGGG - Intronic
916250699 1:162735019-162735041 CAGCTGGACTCAACTGCAGGAGG + Intronic
918189894 1:182163967-182163989 CAGCAGGACAAGAGGTCAGGAGG + Intergenic
918416960 1:184320031-184320053 GAGCAGGACTGGAGGGGTGGGGG - Intergenic
919741694 1:200984834-200984856 AAGCAGGGCTGGAGGGCAAGTGG - Intronic
920215923 1:204361547-204361569 CAGCAGCACTCTTGGGGAGGGGG + Intronic
921176030 1:212595386-212595408 TAGCTGGACTTGAAGGCAGGGGG - Intronic
1063141277 10:3258508-3258530 CCACAGGACTCGAGGGCTGCTGG + Intergenic
1065890397 10:30116466-30116488 CAGCAGGACAAGCGGCCAGGAGG + Intergenic
1067063228 10:43088947-43088969 CGGCAGGACGGGAGGGCTGGGGG - Intronic
1067208169 10:44237189-44237211 CAACATGGCTCCAGGGCAGGTGG + Intergenic
1068060796 10:52064760-52064782 CAGCAGGAGCCGGGGACAGGAGG - Intronic
1068808140 10:61223864-61223886 TAGTAGGATTGGAGGGCAGGGGG + Intergenic
1068816429 10:61320178-61320200 CAGCAGGACTAGCGGGTAGGAGG - Intergenic
1069642459 10:69964504-69964526 CAGCAGGCCACGAGAGCTGGAGG - Intergenic
1069775897 10:70926955-70926977 CAGCAGGAGGCGAGGCCAGCTGG - Intergenic
1070258029 10:74826987-74827009 CGGCAGGGCTCTAGGGCAAGGGG + Intronic
1070660948 10:78304835-78304857 CACCAGGACTGGTGGGCAGTGGG - Intergenic
1072050864 10:91701667-91701689 GAGCATGGCTGGAGGGCAGGTGG + Intergenic
1074870207 10:117570152-117570174 CACCAGGACTCCAAGCCAGGTGG - Intergenic
1075929815 10:126286274-126286296 CAGCAGGTCTGGCAGGCAGGAGG + Intronic
1077095196 11:796159-796181 GAGCAGGACCAGCGGGCAGGTGG - Exonic
1077420090 11:2445931-2445953 CAGGTGGACTCTGGGGCAGGGGG + Intronic
1079660912 11:23035563-23035585 CAGCAGGACGGAAGGGGAGGTGG - Intergenic
1079812389 11:25011097-25011119 CAGCAACCCTCGAGGGCATGGGG + Intronic
1079923313 11:26459133-26459155 CAGCTGGATTGGAGGGCATGAGG + Intronic
1080397456 11:31903085-31903107 CAGCAGGGGAAGAGGGCAGGAGG + Intronic
1083153800 11:60810296-60810318 CACCCGGACTCCAGGGCAGTGGG - Intergenic
1083160123 11:60849528-60849550 CAGCAGGACTCCAGGGGAAGAGG + Intronic
1083724204 11:64619886-64619908 CACCAGGCCTCAGGGGCAGGTGG + Intronic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084420577 11:69058588-69058610 CAGCAGGGCCCTGGGGCAGGCGG - Intronic
1084424475 11:69077010-69077032 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424552 11:69077259-69077281 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424584 11:69077367-69077389 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084575186 11:69984615-69984637 CAGCAGGCCTGGTGGGGAGGAGG + Intergenic
1085448086 11:76614687-76614709 CGCCAGGACTCCAGGGCAGGAGG - Intergenic
1087430466 11:98047019-98047041 CTGCAGCACTCTAGGGCAGTTGG - Intergenic
1088091722 11:106048256-106048278 CAGCAGGACTCTAGCTCAAGTGG + Intergenic
1088865699 11:113845612-113845634 CACCAGGGCTAGAGGGCAGTAGG + Intronic
1089208435 11:116784280-116784302 CTTCAGTACTCGGGGGCAGGGGG - Intronic
1089757076 11:120695116-120695138 CAGCAGGAGGAGAGGGCTGGGGG - Intronic
1091349172 11:134879384-134879406 GAGCAGGACTTGGGGGCAGGGGG + Intergenic
1091410035 12:233271-233293 CAGGAGGTGTCGAGGGCCGGAGG - Intronic
1092013727 12:5139138-5139160 CAGCAGCCCTGGAGAGCAGGAGG + Intergenic
1092840730 12:12538742-12538764 CGGCAGGACTCTAGTGAAGGGGG + Intronic
1096462267 12:51828628-51828650 CCACAGGACCCGAGGGCAGCAGG - Intergenic
1096668217 12:53181009-53181031 CGGCGGGACGCGCGGGCAGGGGG - Intronic
1097181037 12:57172023-57172045 CAGCTGGAGTAGAGTGCAGGGGG - Intronic
1097440258 12:59599204-59599226 AAGCAGAACTAGAGGGAAGGAGG + Intronic
1100131199 12:91495781-91495803 CGGCAGGCCTATAGGGCAGGAGG + Intergenic
1101804745 12:108053539-108053561 CATCAGGACTCAAGTGCAAGCGG + Intergenic
1102587557 12:113933653-113933675 CAGGGGGACCCGCGGGCAGGGGG + Intronic
1103459304 12:121090977-121090999 CCACAGGACTCCAGTGCAGGGGG + Intergenic
1105503645 13:20992234-20992256 CAGCAGCACGCAAGGGTAGGTGG + Intronic
1107677619 13:42813134-42813156 CAGGAGGAATAGAGAGCAGGAGG - Intergenic
1109944101 13:69408706-69408728 CCGCATGACTCGTGGACAGGCGG - Intergenic
1110905558 13:80884032-80884054 CAGGACCACTTGAGGGCAGGTGG + Intergenic
1112274176 13:98001027-98001049 CAGCTGCCCTCCAGGGCAGGTGG - Intronic
1113660712 13:112104940-112104962 CAGCGGGACGCGAGGGCGGGAGG + Intergenic
1115772250 14:36676537-36676559 CAGAAGGGTTGGAGGGCAGGAGG - Exonic
1115853594 14:37606374-37606396 GTGCAGGACTGAAGGGCAGGAGG + Intronic
1117145260 14:52830834-52830856 AATCAGGACTCTAGGGCCGGGGG - Intergenic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1120969060 14:90192287-90192309 CAGCGGGAGTGGGGGGCAGGAGG + Intergenic
1121924388 14:97914649-97914671 CAGCAGGACTGGAGGCTATGAGG - Intergenic
1122148125 14:99706268-99706290 CAACGGGAGTAGAGGGCAGGAGG + Intronic
1122970501 14:105150291-105150313 CCTCGGGACTGGAGGGCAGGGGG - Intronic
1123677322 15:22723526-22723548 CAGCTGTACTGGGGGGCAGGGGG - Intergenic
1124678674 15:31710530-31710552 CAGCAAGACCTCAGGGCAGGGGG + Intronic
1126350669 15:47742057-47742079 CAACAGGAGCCAAGGGCAGGAGG + Intronic
1128072658 15:64807299-64807321 CAGCAGGACTCAGGGGATGGGGG + Intergenic
1128380312 15:67107465-67107487 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1128869649 15:71144067-71144089 CAGCAGGACTCTCGTGCTGGAGG - Intronic
1129457386 15:75683113-75683135 CAGCAGGACTGGAGCCCTGGTGG - Intronic
1129726405 15:77903832-77903854 CAGCAGGACTGGAGCCCTGGTGG + Intergenic
1129856742 15:78830426-78830448 AAGCAGGGCTGGCGGGCAGGGGG + Intronic
1131378009 15:91941172-91941194 CAGCACTGCTCCAGGGCAGGTGG + Intronic
1132022225 15:98372582-98372604 CACCAGGACTGGAGGGCAAGTGG - Intergenic
1132049705 15:98596836-98596858 CAGGACGACTGGAGGGCAGCAGG - Intergenic
1132378335 15:101347844-101347866 CAACAGGAGTGGAGGGCAGCAGG + Intronic
1133282849 16:4676968-4676990 CTGCAGGACAGGATGGCAGGCGG - Intronic
1133302000 16:4788061-4788083 CAGCAGGAAACTTGGGCAGGGGG + Intronic
1134054030 16:11157870-11157892 CAGCAATACCCGAGGGCAGGCGG - Intronic
1135182559 16:20288399-20288421 CAGCAGCACTTGAAGGCAGGTGG - Intergenic
1136142224 16:28294782-28294804 CAGCTGGAGACGAGGGTAGGGGG + Intronic
1136381572 16:29898487-29898509 CAGCCAGACTCCAGGGAAGGAGG - Intronic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1139529905 16:67537878-67537900 CAGCAGGTCACGCTGGCAGGCGG + Intronic
1139961040 16:70717348-70717370 GAGGAGGACTTGAGGACAGGAGG + Intronic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1142048133 16:87939167-87939189 CAGCAGTACCCGTGGGCTGGGGG + Intergenic
1142182287 16:88677102-88677124 GAGCAGGACTCCAGGGAGGGGGG + Intergenic
1142319296 16:89370692-89370714 CGGCAGGACCCGAGAGCAGAAGG + Intronic
1142608518 17:1095577-1095599 CAGCAGGACTGGGGAGGAGGGGG - Intronic
1142690670 17:1604726-1604748 CAGCAGGAGGTGAGGGCAGGGGG - Intronic
1142850196 17:2701056-2701078 CAGAAGCACTGGAGTGCAGGTGG + Intronic
1143116477 17:4584413-4584435 CCGCTGGGCTCCAGGGCAGGGGG + Intronic
1144416229 17:15049976-15049998 CAGCAGGAAGTCAGGGCAGGCGG - Intergenic
1144580693 17:16457441-16457463 CAGCAAGACCAGAGGGCAGGAGG + Intronic
1144645667 17:16971979-16972001 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1144943153 17:18955254-18955276 CATCAGGACACGAGGGGAGCTGG - Intronic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1146537703 17:33667287-33667309 CAGCAGTATGGGAGGGCAGGAGG + Intronic
1146728631 17:35175400-35175422 CAGCCAGACTGGAGGGGAGGTGG + Intronic
1147164265 17:38585123-38585145 TGGCAGGAAGCGAGGGCAGGAGG + Intronic
1149038559 17:52159719-52159741 CAGAAGGTCTCGTGGGGAGGCGG + Intronic
1149451176 17:56751256-56751278 GAGCTGGCCTGGAGGGCAGGAGG - Intergenic
1149547062 17:57511494-57511516 CAGCAGGACTTGAGCCCAGATGG - Intronic
1150295524 17:64005415-64005437 CAGCTCCACTGGAGGGCAGGGGG - Intronic
1151466503 17:74289163-74289185 CAGCAGGGCTGGAGGGCAACAGG - Intronic
1151875242 17:76864261-76864283 CAGCAGGACCCAGGGGCAGGGGG + Intergenic
1151904173 17:77036825-77036847 CAACAAGCCTCTAGGGCAGGTGG + Intergenic
1151977249 17:77489791-77489813 CAGCAGGAGTCAGGGGCAGGGGG + Intronic
1152215256 17:79028139-79028161 AGGCAGGAGTCGAGGGGAGGAGG + Intronic
1152323368 17:79621707-79621729 CTGCAGGACTCAGGGGCACGTGG + Intergenic
1152626052 17:81388441-81388463 CTCCAGGGCTGGAGGGCAGGTGG + Intergenic
1152688357 17:81706024-81706046 CAGCACCACCCGAGGGCAGGGGG - Intronic
1152784272 17:82239910-82239932 CTGCTGGCCACGAGGGCAGGTGG - Exonic
1153201831 18:2655497-2655519 GAGCAGGGCTCGGGGGCAGCGGG - Intergenic
1155154709 18:23148624-23148646 CAGCTGGACTCTGGGGCAGCCGG + Intronic
1157476854 18:48029215-48029237 GAGAAGGACTGGAGGGCTGGTGG + Exonic
1158580910 18:58681958-58681980 CAGCAGTGGTGGAGGGCAGGAGG + Intronic
1158900014 18:61953766-61953788 GAGCAGGACACCAAGGCAGGAGG - Intergenic
1159905181 18:74083339-74083361 CAGCAGGGCTCGACGGAAGCAGG + Intronic
1160366446 18:78329872-78329894 GAGCAGAACTGGAGAGCAGGTGG + Intergenic
1160396425 18:78575694-78575716 CAGCTGGGCTAGAGGGGAGGGGG - Intergenic
1160694692 19:477856-477878 GAGCAGGACGAGAGGACAGGGGG - Intergenic
1160969730 19:1762256-1762278 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1161003728 19:1924316-1924338 CAGCAGGAATGAAGGGGAGGAGG - Exonic
1161156858 19:2736289-2736311 CAGCAGGACACTGGGGCAGAGGG + Intronic
1161216121 19:3095759-3095781 CACCAGGACTCTAAGGAAGGGGG - Intronic
1161242377 19:3229475-3229497 CCGCAGGAGTGGAGGCCAGGAGG + Intronic
1161431205 19:4233377-4233399 CCGCAGGACTGGAGGACAGGTGG - Intronic
1162091052 19:8280438-8280460 GAGCAGGAGCCCAGGGCAGGGGG + Intronic
1162093286 19:8295276-8295298 GAGCAGGAGCCCAGGGCAGGGGG + Intronic
1162781995 19:13011389-13011411 GAGCTGGACTCGGGGGCAAGTGG - Intronic
1163123413 19:15231726-15231748 CCACGGGACTCGGGGGCAGGTGG - Intronic
1163304252 19:16467809-16467831 CAGCAGGGCTCTGCGGCAGGAGG + Intronic
1163329500 19:16627745-16627767 CAGCGGCCCTCGAGGGGAGGTGG + Intronic
1163643583 19:18475740-18475762 CAGCAGGTGTCCAGGGCTGGAGG + Intronic
1163732214 19:18955646-18955668 CATCAGGCCTCCAGGTCAGGGGG + Intergenic
1164641722 19:29831217-29831239 CAGCAGGACTCAAGCTCGGGAGG + Intergenic
1165022150 19:32934108-32934130 GAGCAGGACTCAGGGGCTGGTGG + Intronic
1165289753 19:34873788-34873810 CATCAGGCCTCAAGGCCAGGTGG - Intergenic
1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG + Exonic
1166420452 19:42632329-42632351 GAGCAGGACCTGAGGGCAGTGGG - Intronic
1166423334 19:42654897-42654919 GAGCAGGACCTGAGGGCAGTGGG + Intronic
1166894007 19:46012213-46012235 CAGTGGGACTCTTGGGCAGGAGG - Intronic
1167305838 19:48708827-48708849 CAGCAGGGATAAAGGGCAGGAGG + Intergenic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1168507999 19:56952493-56952515 CAGCAGGACGTGAGGGTGGGTGG - Intergenic
925204418 2:1994275-1994297 CAGGAGGACTCGCTGGGAGGAGG - Intronic
925204435 2:1994328-1994350 CAGGAGGACTCGCTGGGAGGAGG - Intronic
925204453 2:1994381-1994403 CAGGAGGACTCGCTGGGAGGAGG - Intronic
925204472 2:1994434-1994456 CAGGAGGACTCGCTGGGAGGAGG - Intronic
925267296 2:2574941-2574963 CAGCAGGATTGGAGGCCAGCAGG - Intergenic
926732901 2:16050616-16050638 CAGCAGATCTTCAGGGCAGGGGG - Intergenic
927140219 2:20125111-20125133 CAGCAGGAGTCAAGCCCAGGCGG - Intergenic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
929411811 2:41705162-41705184 AAGCAGGAGTGGTGGGCAGGAGG - Intergenic
929564383 2:42975450-42975472 AAGCAGGACTGGAGGGCTGGAGG - Intergenic
929572124 2:43029250-43029272 CAGGAGGACCCAAGGCCAGGAGG + Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932577741 2:72972044-72972066 CATCAGGCCTCGGGGTCAGGGGG - Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933736432 2:85499044-85499066 GAGGATGACTCGAGGCCAGGAGG - Intergenic
934763080 2:96866928-96866950 CAGCAGGCCACTAGGACAGGTGG + Intronic
934771854 2:96912432-96912454 CACCAAGACTCGAGGGCTGGTGG + Intronic
935046882 2:99490322-99490344 GAGCAGGACGGGCGGGCAGGCGG - Intergenic
936739796 2:115491290-115491312 CAGGAGGTATCCAGGGCAGGGGG + Intronic
937288514 2:120767921-120767943 CAGAAGGACTCGATGCCTGGTGG + Intronic
937901659 2:127024713-127024735 CTGCAAGACTCGTGGGAAGGAGG + Intergenic
938143044 2:128812161-128812183 CAGCAGGGCTTTGGGGCAGGTGG - Intergenic
938240266 2:129737934-129737956 CAGGAGGGCAGGAGGGCAGGAGG - Intergenic
938318412 2:130345795-130345817 CAGTAGGACCAAAGGGCAGGTGG - Exonic
939671812 2:145022193-145022215 CAGCTGAACTCCAGGGAAGGTGG - Intergenic
941891139 2:170583011-170583033 TGGCAGCACTCCAGGGCAGGGGG - Intronic
945075093 2:206030941-206030963 GAGCAGGACTGGAGAGCATGAGG + Intronic
947625217 2:231614504-231614526 AAACAGGACTCGGGGGCAGCCGG - Intergenic
947722576 2:232378786-232378808 CAGCATGTCTGGAGGGCAGCAGG - Exonic
948236252 2:236393350-236393372 CTGCAGGCCTCCAAGGCAGGGGG + Intronic
1169088153 20:2840104-2840126 CAGCAGGCCTCCAGGGCACTGGG + Intronic
1170320299 20:15089672-15089694 CAGCAGGACTCAAGGGCAAAGGG - Intronic
1170732213 20:18985221-18985243 GACAAGGACTCCAGGGCAGGTGG + Intergenic
1172407426 20:34700084-34700106 CTGCAGGACTGGAGGTCAAGAGG - Intronic
1172663378 20:36582718-36582740 CGGCATGACTCTAGAGCAGGTGG - Intronic
1173916540 20:46712287-46712309 CAGCAGGTCTCTGGTGCAGGAGG + Intronic
1174118078 20:48241639-48241661 CAGGAGGACAACAGGGCAGGAGG - Intergenic
1174421418 20:50401417-50401439 CTTCAGGAATCGAGGGGAGGAGG - Intergenic
1174557898 20:51408883-51408905 CAGCAGGACTGGGGTGGAGGTGG + Intronic
1175390594 20:58624920-58624942 CGGCAGGGCTGGAGAGCAGGGGG + Intergenic
1175586245 20:60142764-60142786 GAGCAGGACTCAAGGTCAAGAGG - Intergenic
1175764038 20:61580914-61580936 CAGCAGGACCCGAGGACCTGAGG + Intronic
1176390111 21:6158932-6158954 CAGGAGGCTTCAAGGGCAGGTGG - Intergenic
1178391017 21:32198522-32198544 CAACAGCACCCGAGGGGAGGCGG - Intergenic
1178976027 21:37221579-37221601 CACCAAGACTCCAGAGCAGGTGG + Intergenic
1179502849 21:41820904-41820926 CAGCAGGGCTCGGGGGCAGCTGG - Intronic
1179577560 21:42317449-42317471 CAGCAGGTCATGAGGGCCGGAGG - Intergenic
1179733355 21:43379308-43379330 CAGGAGGCTTCAAGGGCAGGTGG + Intergenic
1179903536 21:44407215-44407237 GAGGAGGACTTGAGCGCAGGAGG - Intronic
1179907666 21:44432592-44432614 CAGGAGGACCCGGGTGCAGGAGG - Intronic
1181041723 22:20195497-20195519 AAGCAGGGCTCACGGGCAGGGGG - Intergenic
1181441221 22:22936030-22936052 CAGCAGGACCCCAGGGAGGGGGG + Intergenic
1181811873 22:25408125-25408147 CTGCAGGAATCAAGGGAAGGGGG + Intergenic
1182069754 22:27455259-27455281 TAGCAGGACTGGGGAGCAGGGGG - Intergenic
1182098567 22:27642161-27642183 CAGCAGGGGTCGAGGGCAGGGGG + Intergenic
1183358042 22:37369844-37369866 CACCAGGAAAAGAGGGCAGGGGG - Exonic
1183360921 22:37383086-37383108 CAGCTGTACCCAAGGGCAGGAGG - Intronic
1183785162 22:40025000-40025022 CAGCAGGAGGCGAGGGCGGAGGG - Intronic
1184773916 22:46613770-46613792 CAGCCCGCCTCCAGGGCAGGAGG - Intronic
1184900858 22:47445627-47445649 CAGGAGGACAGGAGGTCAGGAGG - Intergenic
1184987690 22:48146564-48146586 CCGGAGGACTTGAGTGCAGGAGG + Intergenic
1185331667 22:50254783-50254805 CAGCAGGTCTGGGGGCCAGGAGG + Intronic
950190409 3:10972570-10972592 CAGCAGGAGTCGGAGGGAGGGGG + Intergenic
952711126 3:36433032-36433054 CAGCAGAGCCCCAGGGCAGGAGG + Intronic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954199432 3:49015373-49015395 CAGCATGCCTTGAGGGGAGGAGG + Exonic
955523794 3:59800813-59800835 CAACAGGACAGGAGTGCAGGAGG + Intronic
956534016 3:70255570-70255592 CTGCAGGACTAGGAGGCAGGAGG - Intergenic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
961673248 3:128549676-128549698 CAGCAGGCCTCTAGGGTGGGTGG + Intergenic
964287244 3:155131717-155131739 GAGCAGGACGCTAGAGCAGGAGG - Intronic
964411778 3:156405299-156405321 CAGGAAGACTGGAGAGCAGGAGG - Intronic
966912391 3:184566708-184566730 CAGCGGGGCAGGAGGGCAGGGGG - Intronic
967104197 3:186242262-186242284 GGGCAGGGCTGGAGGGCAGGAGG - Intronic
967268182 3:187710177-187710199 AATCAGGAGTTGAGGGCAGGAGG - Intronic
967977010 3:195041123-195041145 CAGCAGGTCTCGAAGGCTGGAGG + Intergenic
969138575 4:5050665-5050687 CCGCAGGACTGCAAGGCAGGGGG + Intergenic
969282959 4:6183575-6183597 CACCAGGACTCCATGGAAGGTGG - Intronic
969593777 4:8136780-8136802 CAGCTGGACCCGAGGCCACGTGG - Intronic
975650985 4:76592819-76592841 CAGCAGGATTCGAGGTAGGGAGG + Intronic
976394058 4:84537106-84537128 CAGGAGGACTCAATGGTAGGAGG - Intergenic
977427587 4:96888023-96888045 CAGCAGGAATCTAGAGCTGGTGG - Intergenic
977571394 4:98633008-98633030 CAGCAGGAAGCCAGGGCAGTTGG + Intronic
980802085 4:137765214-137765236 AGGAAGGACTGGAGGGCAGGTGG - Intergenic
982171653 4:152667501-152667523 GAGCAGGACTCGAGAAGAGGAGG + Intronic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
983749140 4:171242657-171242679 CATCAGGAATTTAGGGCAGGAGG + Intergenic
984717272 4:182937499-182937521 CTGCAGGACACGAGGGCAGGAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985549690 5:526712-526734 TGGCAGGACTCGTGGGCAGTGGG - Intergenic
985789931 5:1920431-1920453 GAGCAAGACTCGAGGGCATGTGG - Intergenic
986711746 5:10492890-10492912 CAGAGGGACTCCAGGGCACGTGG + Intergenic
989297221 5:39843515-39843537 CAGCAGGACTCAAGTCCAGGAGG - Intergenic
991396443 5:66209287-66209309 CAGCAGGACTTGGTGGCAGTGGG - Intergenic
997248168 5:132369537-132369559 CAGCGGGACTCGAGGCCTTGGGG - Intergenic
997715122 5:136036811-136036833 CAGCAAGACTCCAGAGAAGGAGG + Intronic
999127846 5:149259501-149259523 CAGCAGGAGCCGAGGACTGGCGG - Exonic
999244922 5:150148994-150149016 CAGCAGGAGGCCAGGGAAGGAGG + Intronic
1001089239 5:168725119-168725141 CAGAAGGACTACATGGCAGGAGG + Intronic
1002105233 5:176876708-176876730 GAGCAGGACGGGAGGGCAGTGGG + Intronic
1002707766 5:181174238-181174260 CAGCAGGATTCGCGGGCCAGAGG + Intergenic
1003122325 6:3328670-3328692 CATCAGGACTCCAGGGCATGGGG - Intronic
1003871984 6:10411183-10411205 CCGCAGGTCCCGAGGGTAGGGGG + Intronic
1005308713 6:24538650-24538672 CTTCAGGAGTCCAGGGCAGGCGG + Intergenic
1005452989 6:25992125-25992147 CCGCAGGACTCGTGGTCAGAAGG + Intergenic
1007762476 6:44141116-44141138 CAGCAGGGCTTGAGGGTAGGGGG - Intronic
1012991986 6:105935323-105935345 CAGCAGTGCTCCTGGGCAGGAGG + Intergenic
1014761521 6:125362683-125362705 CCCCTGGACTGGAGGGCAGGAGG + Intergenic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1018884054 6:167917455-167917477 CAGAAGGACTAGAGGAGAGGAGG + Intronic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1020110035 7:5442898-5442920 CAGCATGACTCGAGGGCGGGTGG - Intronic
1023171948 7:37398650-37398672 CAGCAGTACACGTGAGCAGGGGG - Intronic
1024272618 7:47654083-47654105 CAGCAGAACTGAAGGGCAAGAGG - Intergenic
1025085593 7:56020693-56020715 CTGCAGGGCGGGAGGGCAGGAGG + Intronic
1027269670 7:76512705-76512727 CAGCAGTAGCCGGGGGCAGGGGG - Intronic
1027569689 7:79848390-79848412 CATCAGGACTGGGGGGCAGTAGG - Intergenic
1028268716 7:88759842-88759864 CAGCAGGACGCAGGGGGAGGCGG - Exonic
1028270927 7:88788180-88788202 CATGAGGACTGGAGGCCAGGTGG + Intronic
1029403939 7:100362057-100362079 GAGCAGGAATGGAGAGCAGGGGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1032783327 7:135182054-135182076 CAGCAGGACATGTGGGCAGAGGG - Intergenic
1033425667 7:141241646-141241668 CAGCAAGATTTGAGGGCACGTGG + Intronic
1033653808 7:143360879-143360901 CTGCAGGACTCAGGGGAAGGAGG + Intronic
1035464432 7:159065318-159065340 CCGCAGGAGACGGGGGCAGGAGG + Intronic
1036917045 8:12814243-12814265 CAGCAGAACTTGAGGGCTGAAGG - Intergenic
1037771233 8:21801296-21801318 CTGCAGGACTGGGAGGCAGGAGG + Intronic
1037883743 8:22585649-22585671 CAGCAGGATGGGAGGGGAGGGGG - Intronic
1039165517 8:34675307-34675329 CAGCAGGAGGCTAGGGAAGGAGG - Intergenic
1039842513 8:41304083-41304105 CAGCAGGAGGCCAGGGCAGGCGG + Intronic
1040568403 8:48587287-48587309 CTGGAGAACTCGAGGGCTGGAGG + Intergenic
1042960114 8:74294239-74294261 GAGCAGGAGCTGAGGGCAGGTGG - Intronic
1045325142 8:101112362-101112384 CAGCAGGAGCGGAGGCCAGGAGG + Intergenic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1049099202 8:140567304-140567326 CATCACGCCACGAGGGCAGGAGG + Intronic
1049190467 8:141284768-141284790 AAGAAGGACTGAAGGGCAGGAGG + Intronic
1049242955 8:141548071-141548093 AAGCAGGGCTCCAGGGCATGGGG - Intergenic
1049433704 8:142576714-142576736 CACCAGGACCCATGGGCAGGTGG + Intergenic
1049471883 8:142778573-142778595 CAGCAGGAGGCGAGCGCTGGCGG - Intergenic
1049512509 8:143036325-143036347 CAGCTGGACGGGAGGGCAGCTGG + Intergenic
1049564391 8:143330722-143330744 GAGGAGGGCTCAAGGGCAGGAGG + Intronic
1049715829 8:144091050-144091072 CATCAGGAGGCCAGGGCAGGCGG - Intergenic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053841023 9:42188434-42188456 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1054119482 9:61194830-61194852 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054352586 9:64030767-64030789 CTGCAGGAGTCCAGGGCCGGTGG - Intergenic
1054588272 9:66987732-66987754 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1055986303 9:82058926-82058948 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056301283 9:85244420-85244442 AAACAGGACTAGAAGGCAGGAGG + Intergenic
1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1056611839 9:88130733-88130755 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1057718051 9:97510914-97510936 CAGCATGGTTTGAGGGCAGGTGG + Intronic
1058951770 9:109910670-109910692 CAGCAGGGCATGAGGGCAGAGGG + Intronic
1060474516 9:123976703-123976725 CACCAGGACTCCAGGGGAAGCGG + Intergenic
1060476847 9:123993420-123993442 CACCAGGACTCCAGGGGAAGCGG - Intergenic
1060531146 9:124347640-124347662 CAGAAGGACTAGAGAGGAGGAGG - Intronic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1061043660 9:128153211-128153233 CAGCAGTGCTGGGGGGCAGGGGG - Intronic
1061262663 9:129488609-129488631 CAGCCGGCCGCGAGGGCGGGAGG - Intergenic
1061818363 9:133209072-133209094 CAGGCGGACTCCTGGGCAGGGGG - Intronic
1061920615 9:133780391-133780413 CTGGGGGACTCGGGGGCAGGAGG + Intronic
1061995681 9:134181587-134181609 CAGCAGGACCCGTGGGCAGGTGG - Intergenic
1062053200 9:134457760-134457782 CAGGATGACCCCAGGGCAGGAGG - Intergenic
1062103397 9:134739804-134739826 CAGCAGGATGCAGGGGCAGGCGG + Intronic
1062242088 9:135546286-135546308 CAGGTGGACTCCTGGGCAGGGGG + Intronic
1062386003 9:136311816-136311838 CAGCAGGGCTGGGGGGCCGGGGG - Intergenic
1187555941 X:20351239-20351261 CATCAGGATTCCAGGGCAGAGGG - Intergenic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1194073005 X:89350772-89350794 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1197064353 X:122220842-122220864 CAGCTGGACTCCAAGGCTGGGGG - Intergenic
1197530351 X:127616623-127616645 AAGCAGAACTGGTGGGCAGGTGG - Intergenic
1198529367 X:137535438-137535460 CAACTGGACTCGAGGTCATGAGG + Intergenic
1200727245 Y:6686512-6686534 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1200728397 Y:6702287-6702309 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1201424376 Y:13832241-13832263 CAGCAGGATGCGGGTGCAGGTGG + Intergenic