ID: 1017515235

View in Genome Browser
Species Human (GRCh38)
Location 6:155150458-155150480
Sequence CGCCCAACACCCTTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017515235_1017515243 26 Left 1017515235 6:155150458-155150480 CCAGGCTGGAAGGGTGTTGGGCG No data
Right 1017515243 6:155150507-155150529 TGAGTGGTGGCTTGGGGCTCTGG No data
1017515235_1017515237 -4 Left 1017515235 6:155150458-155150480 CCAGGCTGGAAGGGTGTTGGGCG No data
Right 1017515237 6:155150477-155150499 GGCGAGCATGGAGAGACAATTGG 0: 1
1: 0
2: 0
3: 11
4: 165
1017515235_1017515242 20 Left 1017515235 6:155150458-155150480 CCAGGCTGGAAGGGTGTTGGGCG No data
Right 1017515242 6:155150501-155150523 AGTGACTGAGTGGTGGCTTGGGG 0: 1
1: 0
2: 1
3: 20
4: 225
1017515235_1017515239 13 Left 1017515235 6:155150458-155150480 CCAGGCTGGAAGGGTGTTGGGCG No data
Right 1017515239 6:155150494-155150516 AATTGGAAGTGACTGAGTGGTGG No data
1017515235_1017515241 19 Left 1017515235 6:155150458-155150480 CCAGGCTGGAAGGGTGTTGGGCG No data
Right 1017515241 6:155150500-155150522 AAGTGACTGAGTGGTGGCTTGGG 0: 1
1: 0
2: 1
3: 15
4: 222
1017515235_1017515238 10 Left 1017515235 6:155150458-155150480 CCAGGCTGGAAGGGTGTTGGGCG No data
Right 1017515238 6:155150491-155150513 GACAATTGGAAGTGACTGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 208
1017515235_1017515240 18 Left 1017515235 6:155150458-155150480 CCAGGCTGGAAGGGTGTTGGGCG No data
Right 1017515240 6:155150499-155150521 GAAGTGACTGAGTGGTGGCTTGG 0: 1
1: 0
2: 1
3: 23
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017515235 Original CRISPR CGCCCAACACCCTTCCAGCC TGG (reversed) Intronic