ID: 1017515242

View in Genome Browser
Species Human (GRCh38)
Location 6:155150501-155150523
Sequence AGTGACTGAGTGGTGGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017515235_1017515242 20 Left 1017515235 6:155150458-155150480 CCAGGCTGGAAGGGTGTTGGGCG No data
Right 1017515242 6:155150501-155150523 AGTGACTGAGTGGTGGCTTGGGG 0: 1
1: 0
2: 1
3: 20
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017515242 Original CRISPR AGTGACTGAGTGGTGGCTTG GGG Intronic