ID: 1017516540

View in Genome Browser
Species Human (GRCh38)
Location 6:155161181-155161203
Sequence GCTCATTCCCGATCTGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017516535_1017516540 -5 Left 1017516535 6:155161163-155161185 CCCTGTGTATCCCTGTGTGCTCA 0: 1
1: 0
2: 4
3: 68
4: 499
Right 1017516540 6:155161181-155161203 GCTCATTCCCGATCTGAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 69
1017516536_1017516540 -6 Left 1017516536 6:155161164-155161186 CCTGTGTATCCCTGTGTGCTCAT 0: 1
1: 0
2: 4
3: 86
4: 668
Right 1017516540 6:155161181-155161203 GCTCATTCCCGATCTGAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017516540 Original CRISPR GCTCATTCCCGATCTGAGCC GGG Intronic
901127506 1:6939903-6939925 GCTCATGCCTGCTCTGTGCCCGG - Intronic
901689204 1:10961452-10961474 GCTCATCTCCGCTCTGAGCCCGG - Intronic
902627489 1:17684969-17684991 GCTCATTCCTGATCAGAGTGTGG - Intronic
904411589 1:30328220-30328242 GCTCATCCCTGATCTGGGCTGGG - Intergenic
905693411 1:39958601-39958623 GCTCCCTCCCTATCTCAGCCAGG - Intronic
909936908 1:81561838-81561860 GCTCATTTTAGATCTGGGCCAGG - Intronic
910878789 1:91903742-91903764 GCTTATTCCTGCTATGAGCCAGG - Intronic
911198700 1:95021963-95021985 GCTCATTTTGGATCTGAGGCTGG - Intronic
913129029 1:115821401-115821423 GCTGATTCACGATCTGAGGAAGG + Intergenic
916950947 1:169779814-169779836 GTTCATTGCAGATCTGGGCCAGG - Intronic
918252838 1:182719097-182719119 GCTCATTACCCATCTGTCCCAGG + Intergenic
1068860996 10:61847929-61847951 GCTAATTCCAGATCTGGGGCAGG - Intergenic
1069144050 10:64866891-64866913 GCTGATTCCGCATCTGAGGCAGG - Intergenic
1069826015 10:71255610-71255632 GCTCATTCCAGATCTGACTGGGG - Intronic
1074237144 10:111596974-111596996 ACTAATTCCAGATCTGAGACAGG - Intergenic
1074531078 10:114299296-114299318 TCTCTTTCCGGAGCTGAGCCAGG + Exonic
1076138453 10:128061042-128061064 GCTCATGCCCCAGCTGGGCCAGG - Intronic
1096600413 12:52724741-52724763 GCTCATGCCCAATCTGCCCCAGG - Intergenic
1097292166 12:57926578-57926600 GCTGATTCCACATCTGAGGCAGG + Intergenic
1097901101 12:64874727-64874749 CCTCATTCCTAATCAGAGCCTGG - Intronic
1108646242 13:52431816-52431838 GTTGATTCCGGATCTGAGGCAGG + Intronic
1118868568 14:69722568-69722590 GCTGATTCCAGAGCTGAGGCAGG + Intergenic
1121034223 14:90686396-90686418 TCTCATTCCTGATCTCAGGCGGG - Intronic
1121622435 14:95359931-95359953 GCTGAGTCCCTACCTGAGCCAGG + Intergenic
1128976776 15:72160108-72160130 GCTCTTGCCCTTTCTGAGCCTGG + Exonic
1130529722 15:84737255-84737277 TTTCATTCCTGATCTGAACCAGG + Intergenic
1136410772 16:30075876-30075898 CCTCCTTCCCGATCTCAGGCTGG + Intergenic
1137992249 16:53170479-53170501 GCTCATTCCAGGTCTAAGGCAGG - Intronic
1140563365 16:76010546-76010568 CCTCTTTCCCCTTCTGAGCCTGG - Intergenic
1141954611 16:87362120-87362142 GCTGATTCCAGATCTAGGCCGGG + Intronic
1142106270 16:88304557-88304579 GCACATTCCTGAGCTGAGTCGGG - Intergenic
1151378610 17:73709093-73709115 ACTACTTCCCGATCTCAGCCAGG + Intergenic
1151942476 17:77301107-77301129 GCTCCTTCCCACTTTGAGCCTGG - Intronic
1152583164 17:81177944-81177966 TCTCCTTCCCTGTCTGAGCCTGG + Intergenic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
1162780251 19:13002898-13002920 GCTCTTGCCCGATCTGTGCCAGG - Intronic
1163826870 19:19528916-19528938 GCTCATGGCCGAGGTGAGCCCGG - Exonic
925928820 2:8691049-8691071 GCTGATTCCCGATCTAGGACAGG + Intergenic
942520974 2:176803602-176803624 GCTGATTCCAGATCTCAGACAGG + Intergenic
944463140 2:199973229-199973251 GCTGATTCCAGCTCTGAGGCAGG - Intronic
947198410 2:227592698-227592720 GCTGATTCCAGATCTGGGACAGG - Intergenic
1182844541 22:33419491-33419513 GCTCATTCCAGCTCTCAGCATGG + Intronic
954957847 3:54537810-54537832 GCTCACTCCGGACCTGAGCTGGG + Intronic
955588764 3:60511755-60511777 GCTAATTCCAGATCTGAAGCAGG + Intronic
969585538 4:8089355-8089377 TTTCCTTCCCCATCTGAGCCTGG + Intronic
971266896 4:25103621-25103643 GCTCGTGCCCTATCTCAGCCAGG - Intergenic
972082175 4:35166591-35166613 ACTCATTCTGGATCTTAGCCAGG - Intergenic
981569351 4:146134948-146134970 CTTCAGTCCCTATCTGAGCCGGG - Intergenic
987064462 5:14274910-14274932 GCTGATTCCAGACCTGAGGCAGG - Intronic
990563221 5:57004253-57004275 TCACATTCCCTATCTGAGCTAGG - Intergenic
993496022 5:88610123-88610145 GCTGATTCCAGGTCTGAGGCAGG - Intergenic
997467643 5:134098966-134098988 GCTCCTTCAGGATCAGAGCCTGG - Intergenic
1005765570 6:29008088-29008110 GCTGATTCCAGGTCTGAGGCAGG - Intergenic
1007098631 6:39229535-39229557 GCTCCTCCCCGGTCGGAGCCCGG - Intergenic
1012100543 6:95080215-95080237 GCTTATTTCAGAACTGAGCCAGG + Intergenic
1015314668 6:131805181-131805203 GCTCATGCCTCATCTGTGCCAGG - Intergenic
1017516540 6:155161181-155161203 GCTCATTCCCGATCTGAGCCGGG + Intronic
1023365049 7:39455692-39455714 GCTCCTTCCCACTCTTAGCCCGG - Intronic
1030239748 7:107308961-107308983 GCTGATTCCAGATCTGGGGCAGG - Intronic
1033239329 7:139664089-139664111 CCTCATGCCCAATCTGATCCAGG + Intronic
1034654353 7:152717354-152717376 GCTAGTTCCCAATCTGAGGCAGG - Intergenic
1035333452 7:158111279-158111301 GCTCATTTCTGATGTGAACCAGG + Intronic
1039890894 8:41684511-41684533 GCTCAGTCCCCATCTGGTCCAGG + Intronic
1045524467 8:102930011-102930033 CCTCATCCGAGATCTGAGCCAGG - Intronic
1048829199 8:138459663-138459685 CCTCAGTCCAGATCTGAGTCAGG - Intronic
1051113953 9:13673120-13673142 GCCCATGCCAGATATGAGCCGGG - Intergenic
1060427076 9:123514912-123514934 GCTGACTCCAGATCTGAGACAGG + Intronic
1187910720 X:24108987-24109009 GCTGATTCCACATCTGAGACAGG - Intergenic
1192859912 X:75056523-75056545 GTTGATTCCCGATCTGGGTCAGG - Intronic
1199577812 X:149331116-149331138 GCTAATTCCAGATCTGGGTCAGG + Intergenic
1200612263 Y:5338723-5338745 GCTCAAGCCCGATCTGGGACTGG - Intronic
1200812718 Y:7502032-7502054 GCTCCTTGCCAAGCTGAGCCAGG + Intergenic