ID: 1017519408

View in Genome Browser
Species Human (GRCh38)
Location 6:155188223-155188245
Sequence TTTATTGCTGGGCCCGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017519404_1017519408 22 Left 1017519404 6:155188178-155188200 CCTCGTGCGCTCAGAATGCAGGC 0: 1
1: 0
2: 1
3: 2
4: 71
Right 1017519408 6:155188223-155188245 TTTATTGCTGGGCCCGTGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017519408 Original CRISPR TTTATTGCTGGGCCCGTGCT TGG Intronic
902547030 1:17196565-17196587 TTCATTGCCTGGCCCATGCTAGG + Intergenic
904825283 1:33270259-33270281 TGTAGTGCTGGGCCAGTGCTGGG + Intronic
906812399 1:48841602-48841624 TTTATTGCTGGTTCAGTGCAAGG - Intronic
919858478 1:201721735-201721757 TTTTCTGCTGGCCCAGTGCTGGG - Intronic
922507511 1:226135131-226135153 TTGACAGCAGGGCCCGTGCTGGG + Intergenic
1063960070 10:11299564-11299586 TTTAATGATGGGACCGGGCTCGG - Intronic
1066310039 10:34187051-34187073 TTCACAGCTGGGCCAGTGCTGGG - Intronic
1068117559 10:52751412-52751434 TCTATTCCTGGGCATGTGCTGGG - Intergenic
1068737691 10:60432731-60432753 TTTATTCCTGTACCCATGCTGGG - Intronic
1075581299 10:123620458-123620480 TTCAGTGCTGGGCCCTTGCTTGG + Intergenic
1083032829 11:59609939-59609961 TTTATTGGTGGGCCAGTCTTGGG - Intronic
1083213589 11:61204499-61204521 TCTATTTCAGGGCCTGTGCTGGG + Intronic
1083216472 11:61223335-61223357 TCTATTTCAGGGCCTGTGCTGGG + Intronic
1083219354 11:61242161-61242183 TCTATTTCAGGGCCTGTGCTGGG + Intronic
1087562154 11:99803436-99803458 TTTAGTCCTGGGCCAGAGCTTGG - Intronic
1088154122 11:106783339-106783361 TCTATTGTTGGACCTGTGCTTGG - Intronic
1091595173 12:1873589-1873611 TTCAGTGCTGTGGCCGTGCTGGG + Intronic
1091760354 12:3083420-3083442 TTTTCTGCTGGGCCAGGGCTTGG + Intronic
1097043865 12:56172873-56172895 TTTATTGGGGGGCCCCTGCCCGG - Intronic
1101974834 12:109348045-109348067 TATAATGCTGGGCCTCTGCTAGG + Intronic
1102159593 12:110757700-110757722 TTTGTGCCTGGGCCCGTGCCTGG + Intergenic
1102657499 12:114494809-114494831 TTTATGGTTGTGCCTGTGCTGGG - Intergenic
1104326600 12:127804774-127804796 CTGACTGCTGTGCCCGTGCTAGG + Intergenic
1105049694 12:133037560-133037582 TTTATTGCGGGCCCGGCGCTGGG + Exonic
1108973025 13:56401339-56401361 ATTATAGCTGGGAACGTGCTGGG - Intergenic
1110725630 13:78819646-78819668 TTTATTTCTGGGACCATGCATGG - Intergenic
1113615702 13:111679042-111679064 TGTGTTCCTGGGCCCGTGCCAGG + Intergenic
1113621170 13:111763944-111763966 TGTGTTCCTGGGCCCGTGCCAGG + Intergenic
1114916313 14:27270828-27270850 TTTACTTCTGGGGCCCTGCTAGG + Intergenic
1127994796 15:64147203-64147225 TTCTTTTCTGGGCCCGGGCTGGG - Intergenic
1132105038 15:99057233-99057255 TTTGTTGCTGGTCCCTTGCTTGG - Intergenic
1133728620 16:8559485-8559507 TGGATTGCTGGGTCCTTGCTTGG - Intergenic
1133951845 16:10401564-10401586 TTTTTTGCTGTGTCCTTGCTTGG + Intronic
1140861354 16:79021091-79021113 TTTAATGCTAGTCCAGTGCTTGG + Intronic
1145984122 17:29032947-29032969 GGGATTGCTGGGCCCATGCTGGG - Intronic
1146621835 17:34404726-34404748 TTTTTTTCTGGGCCCTTGGTGGG - Intergenic
1147779947 17:42934094-42934116 TTCATTGCTGTGGCCGTGTTGGG - Intergenic
1151571873 17:74930500-74930522 TTTTTTGCTGGCCCGGTTCTGGG + Exonic
1151714302 17:75823635-75823657 TTGAGTGCTGGCCCAGTGCTGGG - Intronic
1158808056 18:60998952-60998974 TCTATTGCTAGGCCCTTCCTGGG - Intergenic
1160449975 18:78956236-78956258 CTAATTACTGGGCCTGTGCTGGG - Intergenic
1161525357 19:4751515-4751537 GTTATTGCTGGGCTCATGCCTGG - Intergenic
1161596491 19:5153625-5153647 TTCATTTCTGAGCCTGTGCTAGG + Intergenic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
933851879 2:86374046-86374068 AATAGTGCTGGGCACGTGCTTGG - Intergenic
937609530 2:123843362-123843384 TTTATTGCTGAGCATGTGGTGGG - Intergenic
942782530 2:179662212-179662234 TGCATTGCTGGGCCTGTGATAGG - Intronic
947835116 2:233169715-233169737 TTCATTCCTGGGCCCCAGCTAGG - Intronic
1171289244 20:23971588-23971610 TTTCTTACTGGGCCCCTGGTGGG + Intergenic
1172458161 20:35093651-35093673 TTTATTACAGGCCCCCTGCTAGG - Intergenic
1172672085 20:36641603-36641625 TTTCTTTCTGGGCCTCTGCTTGG + Intronic
1178833559 21:36076952-36076974 TTAATAGCTGGGCACCTGCTGGG - Intronic
1183194987 22:36347317-36347339 TTTAGTGCTGGTCCCTTGCCAGG - Intronic
1184007326 22:41719986-41720008 TCTATAGCTGGCCCTGTGCTGGG + Intronic
950161672 3:10765046-10765068 TTTAGCACTGGGCCTGTGCTGGG + Intergenic
956628863 3:71294553-71294575 TTTATTGGTGGGTGTGTGCTAGG - Intronic
959555242 3:107709845-107709867 TTTATAGCTTGGCCATTGCTTGG + Intronic
960149229 3:114233061-114233083 CTTTATGCTGGGCCTGTGCTGGG + Intergenic
960188602 3:114675331-114675353 TTTTTTGCTGGGCCGGGGGTGGG + Intronic
964275119 3:155001246-155001268 TGTACTGCTGGGACCATGCTGGG - Intergenic
965293527 3:166914664-166914686 TTTATTGCTGTGTCTCTGCTAGG + Intergenic
967485386 3:190024088-190024110 TTTAATGCAGGGGCCCTGCTTGG + Intronic
991400166 5:66243836-66243858 TTTATTCCTGGCCCTGTGTTGGG + Intergenic
996307211 5:122060973-122060995 TTTATTGTTGGGTTGGTGCTGGG - Intronic
998523515 5:142821529-142821551 TTTATTGCTGGGCCATGGCTGGG + Intronic
1001051679 5:168419092-168419114 TTTACTGCAGGGCGTGTGCTGGG + Intronic
1001790259 5:174450230-174450252 TTTTTTGTTGTGCCCTTGCTTGG - Intergenic
1002495682 5:179609975-179609997 TTTATTGCAGGGCCAATGATAGG - Exonic
1003424955 6:5992863-5992885 TTTAGGGCTTGGACCGTGCTGGG - Intergenic
1007849790 6:44792068-44792090 TTGAATGCTGGGACTGTGCTAGG + Intergenic
1012059660 6:94462721-94462743 ATTATAGCTGGGAACGTGCTGGG + Intergenic
1016038939 6:139411947-139411969 TCTCTTGCTGGGCCCTTGCAGGG + Intergenic
1017519408 6:155188223-155188245 TTTATTGCTGGGCCCGTGCTTGG + Intronic
1021629725 7:22632651-22632673 TCTGTTGGTGGGCCCCTGCTTGG - Intronic
1029439519 7:100579225-100579247 TGCAGTGCTGGGCCCGTGCTGGG - Intronic
1029671589 7:102036244-102036266 ATTCTTGCTGGGGCCGGGCTCGG - Intronic
1035602253 8:903571-903593 TCTACTGCTGGACCCCTGCTTGG + Intergenic
1036119662 8:6002086-6002108 TGTATTCCTGGCCCTGTGCTGGG + Intergenic
1041286417 8:56266488-56266510 CTTATTGCTGGGCCCTCTCTTGG + Intergenic
1041391754 8:57353266-57353288 TTTGTGTCTGGGCCTGTGCTGGG - Intergenic
1049852599 8:144841115-144841137 TTCATTGCTGGGGCAGGGCTGGG - Intronic
1052987588 9:34499457-34499479 TTTGTGGCTGGCCCTGTGCTAGG + Intronic
1054788947 9:69236727-69236749 TTTATTGCTGAGCCACTTCTGGG + Intronic
1056243368 9:84670227-84670249 TTGATTCCTGGGCCGGAGCTGGG + Intronic
1057707930 9:97411429-97411451 TTTATTGCTGATCGTGTGCTAGG + Intergenic
1058934113 9:109752083-109752105 TGTATTGCTAGGTCTGTGCTAGG + Intronic
1188598732 X:31934142-31934164 GTTATTTCTGGGGCAGTGCTTGG + Intronic
1200911434 Y:8534697-8534719 TTTATTTCTGGGGCTCTGCTTGG - Intergenic
1200919667 Y:8602018-8602040 TCTATTTCTGGGGCTGTGCTTGG - Intergenic