ID: 1017520641

View in Genome Browser
Species Human (GRCh38)
Location 6:155198850-155198872
Sequence ACATGTGTGGAGGGCACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017520635_1017520641 -3 Left 1017520635 6:155198830-155198852 CCGAGGTCTCCATCAGTGGCACA 0: 1
1: 0
2: 3
3: 27
4: 282
Right 1017520641 6:155198850-155198872 ACATGTGTGGAGGGCACCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 131
1017520633_1017520641 13 Left 1017520633 6:155198814-155198836 CCGAGACTTTCTTGAGCCGAGGT 0: 1
1: 0
2: 6
3: 88
4: 135
Right 1017520641 6:155198850-155198872 ACATGTGTGGAGGGCACCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017520641 Original CRISPR ACATGTGTGGAGGGCACCCT GGG Intronic