ID: 1017520641

View in Genome Browser
Species Human (GRCh38)
Location 6:155198850-155198872
Sequence ACATGTGTGGAGGGCACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017520635_1017520641 -3 Left 1017520635 6:155198830-155198852 CCGAGGTCTCCATCAGTGGCACA 0: 1
1: 0
2: 3
3: 27
4: 282
Right 1017520641 6:155198850-155198872 ACATGTGTGGAGGGCACCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 131
1017520633_1017520641 13 Left 1017520633 6:155198814-155198836 CCGAGACTTTCTTGAGCCGAGGT 0: 1
1: 0
2: 6
3: 88
4: 135
Right 1017520641 6:155198850-155198872 ACATGTGTGGAGGGCACCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017520641 Original CRISPR ACATGTGTGGAGGGCACCCT GGG Intronic
900428038 1:2589339-2589361 AAATGCCTGGAGGGCCCCCTTGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
903340252 1:22649428-22649450 AAATTTGTGGAGGGCACTGTGGG - Intergenic
903558545 1:24210872-24210894 GCATGTGTGGCTGGCTCCCTGGG + Intergenic
904509422 1:30990860-30990882 ATATATGGTGAGGGCACCCTTGG + Intronic
905401549 1:37707266-37707288 ACTTCTGTGGCAGGCACCCTGGG - Intronic
908690538 1:66774695-66774717 TCATGTGGAGAGGGCTCCCTTGG - Intronic
910848852 1:91631488-91631510 ATATTTGTTGAGTGCACCCTAGG + Intergenic
912964394 1:114224727-114224749 CTATGTGTGGAGGGAAACCTGGG + Intergenic
918886837 1:190204495-190204517 ACATGAGTGGATGGAAACCTAGG + Intronic
919500835 1:198336548-198336570 ATATTTATGGAGTGCACCCTGGG - Intergenic
919727914 1:200895665-200895687 ACAGCTGTGGAGGGCGGCCTCGG + Intronic
921309114 1:213825227-213825249 AGCTGTGAGGAGGGGACCCTGGG - Intergenic
922001795 1:221486078-221486100 ACAGGAGTGGCAGGCACCCTGGG + Intergenic
922240650 1:223753370-223753392 TGATATGTGGAGGGCTCCCTGGG - Intronic
1063611728 10:7568569-7568591 ACATGTGTTGAAGGAACCCCAGG + Intronic
1063845207 10:10119935-10119957 ACATGTTTCCAGGTCACCCTTGG - Intergenic
1065390494 10:25176392-25176414 ACGTGTGAGGAAGGAACCCTTGG + Intronic
1069511012 10:69042582-69042604 ACAGGTTTGGAGGGCAGCCTGGG - Intergenic
1072408539 10:95177902-95177924 ACCTGTGTGGAGCACACACTCGG + Intergenic
1075864736 10:125707802-125707824 TCATATGTGGATGACACCCTTGG + Intergenic
1077801668 11:5545196-5545218 ACATTTGTGTAAGGCATCCTGGG + Exonic
1081527010 11:43934300-43934322 CTTTGTGTGGAGGGCCCCCTGGG + Intronic
1088422274 11:109661611-109661633 ACATGAGTGGATGCCAGCCTAGG - Intergenic
1090198057 11:124833890-124833912 ACAAGTGAGAAGGGCAGCCTTGG + Intergenic
1091037509 11:132246937-132246959 AAATGTCTGGAGTCCACCCTGGG - Intronic
1091721520 12:2817378-2817400 ACCTGTGTGGGGCTCACCCTAGG - Intronic
1094411065 12:30169533-30169555 ACAGGTCTGGAGGGCAACATGGG + Intergenic
1102446774 12:113009122-113009144 ACGTGGGTGGAGGGGACCGTTGG + Exonic
1103944683 12:124519447-124519469 AGATGTGAGGAAGGCACCCCTGG + Intronic
1104744733 12:131203762-131203784 ACAGGTGTGCAGGGCTCCCATGG - Intergenic
1104974406 12:132546010-132546032 CCATGTGCAGAGGGCATCCTTGG + Intronic
1112918583 13:104581540-104581562 ATATGTGAGCAGGGCTCCCTGGG - Intergenic
1114522506 14:23348054-23348076 ACATGGGTGGTGGGGACCCTGGG + Intronic
1117037954 14:51746464-51746486 ACAAGGGTGGTGTGCACCCTCGG - Intergenic
1120949750 14:90030148-90030170 ACATGTGAGCAGGGAAACCTGGG + Intronic
1121324918 14:93014250-93014272 GCGTGTGTGGAGGGCAGCATGGG - Intronic
1122427784 14:101621688-101621710 ACATGGATGGAGGGGCCCCTTGG - Intergenic
1123942605 15:25223876-25223898 TCATGGATGCAGGGCACCCTTGG - Intergenic
1125521227 15:40348833-40348855 AGAAGTGAGGAGGGCACCCACGG - Intergenic
1126859945 15:52873730-52873752 ACATCTATGGAGGGTGCCCTGGG - Intergenic
1129155059 15:73712530-73712552 ACCAGTGTGGAGGGGACACTGGG + Intronic
1129407078 15:75327133-75327155 ACAGATGTGGAGGCCACCATGGG - Intergenic
1134314945 16:13110150-13110172 CCATGTGTGGAGGGCATTCCAGG - Intronic
1134634009 16:15778594-15778616 ACATGTGTGGACCGGACCCCTGG - Intronic
1134894336 16:17871275-17871297 ACATGTGTTGATGGCTCCCTGGG - Intergenic
1136019526 16:27431093-27431115 ACTTGTGTGGAGGCCGGCCTAGG + Intronic
1140521335 16:75584614-75584636 ACTGGTGAGGAGGGAACCCTGGG - Intergenic
1142005546 16:87687993-87688015 TCCTGTGTGGAGGGCAGCCCTGG - Intronic
1146495519 17:33318719-33318741 TCGTGTGTGTAAGGCACCCTGGG + Intronic
1147864152 17:43542036-43542058 CCATGTGTGGAGGGCATGCATGG - Intronic
1150755625 17:67909772-67909794 TCAGCTGTGGAGGGCAGCCTGGG + Intronic
1151660249 17:75515095-75515117 ACACGGGCGGAGGGCGCCCTTGG + Intronic
1152908186 17:82981687-82981709 ACGTGTGAGGACGGCATCCTGGG - Intronic
1154005868 18:10526629-10526651 CCCTGTGTGGAGGGGACCATAGG + Intronic
1156032088 18:32724413-32724435 ACATGTATTGAGGGCTCTCTAGG - Intronic
1158882339 18:61792551-61792573 TCATGTGTGGAAGGCACTGTGGG - Intergenic
1160895537 19:1400355-1400377 ACAGGACGGGAGGGCACCCTGGG + Intronic
1163068947 19:14821792-14821814 ACAGGTGTGGAGGACACACTAGG - Intronic
1164494683 19:28749328-28749350 ACATGTGTGGGAGGGACCCAGGG - Intergenic
1164632017 19:29768203-29768225 CCCTGTGGGGAGGGCAGCCTGGG + Intergenic
1167160740 19:47765836-47765858 ACAAGGCTGGAAGGCACCCTAGG + Intergenic
1168152995 19:54458993-54459015 ACCTGTGTTGAGGCCACACTGGG + Intronic
934766177 2:96881393-96881415 ACAGCTGGGGAAGGCACCCTGGG + Intronic
938762559 2:134439032-134439054 ACATGAGTGGAGGGCAACAGTGG + Intronic
940251190 2:151678736-151678758 AGATATGTGGAGGGCACTGTGGG + Intronic
944256134 2:197625307-197625329 ACATGTTTGAAGGGCTCCCAGGG + Intronic
1171264929 20:23763485-23763507 ACATGTCTGGAGGTCTGCCTGGG - Intergenic
1171937379 20:31287777-31287799 AAAAGTGTGGATGCCACCCTGGG - Intergenic
1172010922 20:31845169-31845191 ACAGGTGCTGAGGGCACCCGGGG - Exonic
1175918681 20:62439750-62439772 ACCTGCTTGGAGGCCACCCTGGG - Intergenic
1176419371 21:6501637-6501659 ACATATGTTCAGGGCAACCTAGG + Intergenic
1178159570 21:29896004-29896026 AGTTGTGGGGAGGGCACTCTGGG - Intronic
1178777246 21:35563972-35563994 TCCTGTGTGGAAGGCCCCCTGGG - Intronic
1179572738 21:42287408-42287430 ACATGAGTGGCTGGCACCCTGGG - Intronic
1179694864 21:43109959-43109981 ACATATGTTCAGGGCAACCTAGG + Intergenic
1183746683 22:39695718-39695740 CCATGTGTGGATGGCAGCATTGG + Intergenic
1184362127 22:44024819-44024841 TCACGTGTGCAGGGCACTCTGGG + Intronic
953192473 3:40700848-40700870 AAGTCCGTGGAGGGCACCCTTGG - Intergenic
953884307 3:46706825-46706847 ACATTTGCTGAGTGCACCCTGGG + Intronic
955910179 3:63851973-63851995 AAACCTATGGAGGGCACCCTAGG - Intronic
961469324 3:127101387-127101409 TCAGCTGTGGCGGGCACCCTGGG - Intergenic
961649580 3:128410721-128410743 AGATGTGTGGGGCCCACCCTAGG - Intergenic
969125377 4:4944006-4944028 ACATTTGTGCAGTGCTCCCTGGG + Intergenic
969466440 4:7359883-7359905 ACAAGTGAGGAGGGCAGCCTGGG + Intronic
969790726 4:9492795-9492817 ACAGGGGTGGTGGGCACCCCCGG - Intergenic
982091099 4:151880640-151880662 ACCTGTGGGGAGGGCACCTAGGG - Intergenic
987721361 5:21636934-21636956 GCATATGTGGACGGCATCCTGGG + Intergenic
989448763 5:41562543-41562565 AGATGTGTGGAAGGCAGGCTTGG - Intergenic
991562232 5:67965815-67965837 TCATGTGTTGAGGGGACCCATGG - Intergenic
992210684 5:74476901-74476923 ACATCTGTGGAGAGGACGCTTGG + Intergenic
995011424 5:107260433-107260455 ACAGGTGTTGGGGGGACCCTGGG + Intergenic
996707048 5:126508039-126508061 AGATGTGTGGAGGCCAGGCTTGG - Intergenic
996917230 5:128726320-128726342 ACATGTGTGGAAAGGACCCGGGG - Intronic
997555599 5:134795448-134795470 ACATCTGTGAATAGCACCCTAGG + Intronic
999114204 5:149148339-149148361 ACATGTGAGCAGGACACCCCAGG + Intronic
1000012841 5:157248954-157248976 ACGTGTGTGGAGGCCAGCCGGGG - Exonic
1000635283 5:163636997-163637019 ACATGTGTGGGGCACCCCCTGGG + Intergenic
1001070181 5:168579211-168579233 CCAGGTTGGGAGGGCACCCTTGG - Intronic
1001271181 5:170312828-170312850 GCATGTGTTGAGAGCACCCTAGG + Intergenic
1001432749 5:171675972-171675994 TCATGTCTGGAGGGCACTCCTGG - Intergenic
1001467238 5:171978347-171978369 ATATATGTGGAGGGCACCACTGG - Intronic
1001553367 5:172620115-172620137 ATTTGTGTGGATGGCACTCTAGG + Intergenic
1002060820 5:176624936-176624958 ACAGGAGTGGAGGGCAGCGTGGG + Intronic
1002599942 5:180348345-180348367 ACAGGTGTGGAGAGTCCCCTGGG + Intronic
1005421294 6:25654089-25654111 ACATGAGCGGAGGACAGCCTGGG + Intronic
1007163612 6:39812258-39812280 CCATGTATGGAGGGCTCACTAGG + Intronic
1016359208 6:143250028-143250050 GCATGTGTGGCAGGCACCATGGG + Intronic
1016641535 6:146354792-146354814 ACATGCCTGGAAGGAACCCTGGG + Intronic
1016839921 6:148515943-148515965 TCATGTGTGAAGGGCCCACTGGG - Intronic
1016987713 6:149907566-149907588 ACAGCTGTGCAGGGCTCCCTAGG + Intergenic
1017520641 6:155198850-155198872 ACATGTGTGGAGGGCACCCTGGG + Intronic
1018784596 6:167098389-167098411 ACGTTTGTGCAGGGCACACTGGG - Intergenic
1019996734 7:4729481-4729503 ACAGGCGAGGACGGCACCCTCGG - Intronic
1023860639 7:44216061-44216083 ACAGGTGTGGAGGGGAGCCAAGG + Intergenic
1024208479 7:47183769-47183791 ACAGGTGTGTAGGGCACTGTGGG - Intergenic
1024419739 7:49150217-49150239 AAATGTGTTCAGGGCACTCTGGG + Intergenic
1032459045 7:132095768-132095790 ACATGTGTGGAGACCTCTCTAGG + Intergenic
1032623716 7:133565190-133565212 ACATGTGTGGTGGGCTCGATAGG + Intronic
1035048248 7:155983244-155983266 GCATGTGCAGAGGGCTCCCTGGG + Intergenic
1035607819 8:940593-940615 ACAGCTGGGGAGGGCAGCCTGGG + Intergenic
1036618947 8:10410200-10410222 GCATGTGTGGCGGGGACGCTTGG + Intronic
1037299064 8:17432281-17432303 ACATGTGAGTAGGGCAGACTGGG - Intergenic
1037330962 8:17743235-17743257 ACATGTATTGAGGGCACACTAGG + Intronic
1041176485 8:55202412-55202434 ACGTTTGTGGAGGGGCCCCTTGG - Intronic
1043049118 8:75362300-75362322 ACATGTATGGAGGGACCCCACGG - Intergenic
1043174285 8:77004515-77004537 ATGTGTGTGGAGGGGACTCTGGG + Intergenic
1046765205 8:118061584-118061606 AGATGTGTGGAGGCCATCATGGG - Intronic
1048349374 8:133603778-133603800 ACATGTCTCCAGGGCACCCTGGG + Intergenic
1049584443 8:143426385-143426407 CCATGTGTGGAAAGCACCTTTGG - Intronic
1054853236 9:69870881-69870903 ACAGGAGAGAAGGGCACCCTAGG + Intronic
1058449044 9:105079216-105079238 ACATGTGTGGAGTGGATCTTGGG - Intergenic
1058871878 9:109209235-109209257 ATATGTTTGGAGGTCCCCCTGGG - Intronic
1059414437 9:114154490-114154512 ACATGTGCGGTGGGCACTCTCGG + Intergenic
1059504181 9:114782916-114782938 ACCTGTGAGGATGGCATCCTTGG + Intergenic
1062386871 9:136315935-136315957 ACATGTGTGGAGGGGGCCACTGG + Intergenic
1186220919 X:7348396-7348418 ACAGGGGTGGAGGGCTTCCTAGG + Intronic
1189377423 X:40476319-40476341 ACTTGTATGAATGGCACCCTGGG + Intergenic
1190059748 X:47203061-47203083 ACCTGTGGGGAGGGCATCATTGG + Intronic
1195813831 X:108863503-108863525 ACATATGTGGAGGGCTCCTAGGG + Intergenic
1198493269 X:137165203-137165225 ATATGTGGGGAGGGCAGCCATGG - Intergenic
1199507343 X:148578819-148578841 TAATGTGTGGAGGGCATCCAGGG + Intronic