ID: 1017522218

View in Genome Browser
Species Human (GRCh38)
Location 6:155212758-155212780
Sequence AAGAGTGAGCAGAGTGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 1, 2: 10, 3: 34, 4: 468}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017522211_1017522218 -4 Left 1017522211 6:155212739-155212761 CCTGCATCCCATGCCTGCCAAGA 0: 1
1: 4
2: 96
3: 200
4: 470
Right 1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG 0: 1
1: 1
2: 10
3: 34
4: 468
1017522209_1017522218 28 Left 1017522209 6:155212707-155212729 CCTGGCAGGCTGTGCTCAACTTG 0: 1
1: 9
2: 30
3: 135
4: 367
Right 1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG 0: 1
1: 1
2: 10
3: 34
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017522218 Original CRISPR AAGAGTGAGCAGAGTGGTGA GGG Intronic
900397690 1:2459951-2459973 GGGAGCGAACAGAGTGGTGAGGG - Intronic
902377329 1:16036028-16036050 GAGAGTGAGCACAGTGGGGGCGG - Intergenic
902382507 1:16059282-16059304 GAGAGTGAGCACAGTGGGGGCGG - Intronic
902852402 1:19170402-19170424 AAGAGAGAAGAGAGTGGGGAGGG + Intronic
903158959 1:21471046-21471068 AAGGGTGAGTGGGGTGGTGATGG - Intronic
903653399 1:24934421-24934443 AAGGGAGAGCAGGGTGGTGAGGG + Intronic
903981640 1:27192944-27192966 GAGAGTGAGCAGAGTGGGTGTGG - Intergenic
903985724 1:27226796-27226818 AAGGTTGAGCAGAGAAGTGAAGG + Intergenic
903987244 1:27237262-27237284 AAGAGAGAAGAGAGTGGTCACGG - Intronic
904078830 1:27859154-27859176 AAGGGGAAGCAGAGAGGTGACGG - Intergenic
904380131 1:30105006-30105028 ACAAGTGAGCTGAGTGGTCATGG - Intergenic
904466250 1:30709444-30709466 AAAAGTGCCCAGAGTGGTGCCGG + Intergenic
905345244 1:37306856-37306878 AAGAGACAGGAGAGTGGTGGTGG - Intergenic
905977020 1:42183261-42183283 AAGAGAGAGGAGAGCGGAGAGGG + Intronic
906211916 1:44016844-44016866 AAGAGTTAGCTGTGTGGTGGGGG - Intronic
906218367 1:44058077-44058099 AAAAGTCAGCAGAGTGATAATGG + Intergenic
906287187 1:44595178-44595200 AAGTGTGAGAAGCCTGGTGAAGG + Intronic
906481761 1:46203813-46203835 AAGAGTGAGTGGGGTGTTGATGG + Intronic
906518249 1:46452244-46452266 AAGAGGAAGCAGAGTGGGGCTGG + Intergenic
906866138 1:49422695-49422717 AAGAGTGAGCTGGGTGAAGAAGG - Intronic
907303694 1:53502701-53502723 CAGAGAGAGGAGAGTGGGGAGGG + Intergenic
907330289 1:53666581-53666603 AAGAGTGGGCAGAGTGGGGATGG - Intronic
909877919 1:80834037-80834059 TAGGGTGAGGAAAGTGGTGATGG - Intergenic
910042417 1:82868662-82868684 GAGAGTGAGGAGAGTGAGGAAGG + Intergenic
910601298 1:89035170-89035192 CACAGTGATCAGAGTGGTGAAGG + Intergenic
910602000 1:89042636-89042658 AAGAGTGAGCTGAGTGGGGAGGG + Intergenic
910606427 1:89090090-89090112 CACAGTGATCAGAGTGCTGAAGG + Intergenic
910727695 1:90356001-90356023 AATATTGGGCAGAATGGTGAGGG - Intergenic
910840413 1:91555823-91555845 GAGTGGGAGCAGAGTGGTCAGGG + Intergenic
911243463 1:95490831-95490853 TAGAGTGGCCGGAGTGGTGATGG + Intergenic
911288579 1:96028167-96028189 AAAGGCAAGCAGAGTGGTGAGGG + Intergenic
911520650 1:98926187-98926209 TAGAGTGTGCAGAGTGCTGAGGG - Intronic
912230219 1:107784141-107784163 AAGAGAGAGGAGAGGTGTGAAGG - Intronic
912977043 1:114340329-114340351 AAGAGGGCCCAGATTGGTGAGGG + Intergenic
913212114 1:116590439-116590461 AAGTGTGAAGAGAGTGGTGGAGG - Intronic
915018959 1:152761623-152761645 AAGAGTGAGCAGAGGCTTGGAGG - Exonic
917032743 1:170712514-170712536 AAGAGTGAGCAGAAGAGTAAAGG + Intronic
917138884 1:171814851-171814873 AAGGGTGAGAAGAGTGGTTTAGG + Intergenic
917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG + Intergenic
917660018 1:177169103-177169125 AAGAGAGAGGAAAGAGGTGATGG - Intergenic
918103176 1:181394142-181394164 AAGAATGGGAAGAGTGGTGGGGG + Intergenic
919777266 1:201202425-201202447 AGGAATAAGCAGAGAGGTGAGGG - Intronic
919990096 1:202703568-202703590 AGGGGTTAGGAGAGTGGTGATGG - Intronic
920343010 1:205287444-205287466 AAGAGGGAACAGGGTGGGGAGGG - Intergenic
920750813 1:208674771-208674793 GAGCGTGGGCGGAGTGGTGACGG - Intergenic
921961125 1:221035369-221035391 AAGTGTGAGCAGAGCACTGAGGG - Intergenic
922652437 1:227352820-227352842 AAGAGTCAGCACAGAGGTGGCGG - Intergenic
922957059 1:229611851-229611873 AAGAGTGAGCTGAGTTGCAAAGG - Intronic
923118753 1:230970295-230970317 AAGAGAGAGTGGAGTGGTGGAGG + Intronic
923760008 1:236833554-236833576 CAGAGATAGCAGAGTGGTTAAGG - Intronic
924240073 1:242031901-242031923 AAGTGGGAGGGGAGTGGTGAGGG + Intergenic
1063095432 10:2904609-2904631 AAGAGAGAGAAGAGAGGTCACGG + Intergenic
1064203436 10:13302743-13302765 AAAAGTTAGCAGGGTGGTGGCGG + Intergenic
1064579161 10:16776095-16776117 AGGTCTGAGAAGAGTGGTGAAGG + Intronic
1065282959 10:24158825-24158847 CAGAGTTAGCAGAGTGCTGCTGG + Intronic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1066497931 10:35960335-35960357 AATAGTCAGCAGAGCTGTGAGGG - Intergenic
1067371042 10:45682821-45682843 AAGAGGGAGGAGAGAGGGGAAGG + Intergenic
1067388740 10:45843329-45843351 AAGAGGGAGGAGAGAGGGGAAGG - Intronic
1067417325 10:46113627-46113649 AAGAGGGAGGAGAGAGGGGAAGG + Intergenic
1067445524 10:46341238-46341260 AAGAGGGAGGAGAGAGGGGAAGG + Intergenic
1067559181 10:47292900-47292922 AAGAGTTAGAGGAGTGGGGAAGG - Intergenic
1067874515 10:49992725-49992747 AAGAGGGAGGAGAGAGGGGAAGG + Intronic
1067932111 10:50572527-50572549 GAGAGAGAGGAGAGGGGTGATGG + Intronic
1069231850 10:66020382-66020404 AACAGAGACCAGAGGGGTGATGG + Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070135955 10:73693733-73693755 AAGAGGGAGGAGAGAGGGGAAGG - Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071329062 10:84542749-84542771 AACAGTGGGCTGAGTTGTGATGG + Intergenic
1071366927 10:84909053-84909075 AAGAGTGAGCAGAATTGAGTAGG - Intergenic
1072147873 10:92658820-92658842 TAGAGTCAGCAGACTGGTGGTGG + Intergenic
1072292503 10:93977125-93977147 AAGAGTGAGCAGCCAGGAGAAGG - Intergenic
1072996689 10:100251244-100251266 AAGAGTCAGCAGCATGGTAACGG - Intronic
1073258453 10:102170637-102170659 AAGAGAGAGGAGAGAGGAGAAGG - Intergenic
1073711259 10:106045338-106045360 GGGGGTGGGCAGAGTGGTGAGGG + Intergenic
1074993558 10:118734621-118734643 AAGAATAAGAAAAGTGGTGAGGG + Intronic
1075278038 10:121112955-121112977 AGAAGTCAGCAGAGTGGAGAGGG + Intergenic
1075329757 10:121565405-121565427 AAGAGAGAGCATAGTGCTGGCGG + Intronic
1075651250 10:124129355-124129377 AAGAGTGTGTGGAGTGGGGAAGG - Intergenic
1075719885 10:124578409-124578431 ATGAGTGAGCAGATCGGAGAAGG - Intronic
1075937313 10:126353412-126353434 AAGTGAGAGGACAGTGGTGAAGG + Intronic
1075955424 10:126519162-126519184 AAAGGTGAACAGAGTGGAGAGGG + Intronic
1076387306 10:130066571-130066593 AAGAGAGAGTAGAATGGTGCGGG - Intergenic
1076631940 10:131856721-131856743 AGGAGGGAGCAGAGAGGGGAGGG + Intergenic
1076742554 10:132494005-132494027 ACGAGGAAGCAGAGTGGGGAGGG - Intergenic
1077464607 11:2727711-2727733 CAGAGTGAGCTGAATGGAGAAGG + Intronic
1078089595 11:8256531-8256553 AGGAGTGAGCAGATTGGTCCAGG - Intronic
1078985379 11:16589199-16589221 AAGAGTGGAAAGAGAGGTGAGGG - Intronic
1079706939 11:23632822-23632844 AAGAGAGAGAGGAGTGGGGAGGG + Intergenic
1080134229 11:28835516-28835538 AAGAGGGAAGAGTGTGGTGATGG - Intergenic
1081343376 11:41954580-41954602 AAGAGTAAGCAGAGAGGTACAGG + Intergenic
1083178381 11:60967689-60967711 AGGAGTGATCAGAGTGGGAAAGG - Intergenic
1083699485 11:64466223-64466245 AAGAGTCAACCGAGTGGGGAGGG + Intergenic
1083952523 11:65964946-65964968 AAGTGGGAGCAGGGAGGTGAAGG + Intronic
1084370284 11:68737456-68737478 AAGTGTGAGGAGAGTGGTTTGGG - Intronic
1084536158 11:69758489-69758511 AAGAGCCAGCAGAGAGGGGATGG - Intergenic
1085006894 11:73100132-73100154 TGGAGTGAGAAGAGTGGTGGGGG - Intronic
1085306995 11:75492163-75492185 GAGAGAGGGCAGAGTGGGGATGG - Intronic
1085329227 11:75633829-75633851 AAGGGCGAGCAGAGTGGGGAGGG + Intronic
1085799405 11:79575050-79575072 AAGAGTGACCAGGATGATGAGGG + Intergenic
1086818377 11:91402500-91402522 AAGAGAGAGGAGAGTGGTCCAGG - Intergenic
1088187811 11:107193140-107193162 CAGGGTGGGCAGACTGGTGAAGG - Intergenic
1088223643 11:107594298-107594320 AATAGTTAGTAGAGTGGTGCTGG + Intronic
1088735170 11:112722901-112722923 AAGAGAGAGAAGAGTGGCTAAGG + Intergenic
1089395878 11:118136121-118136143 AGGAGTGCCCAGAGTGGCGATGG + Exonic
1090616338 11:128518942-128518964 AAGGTAGAGCAGAGTGTTGAAGG + Intronic
1091167014 11:133487608-133487630 AACATTGTGCAGAGTGGTGTGGG - Intronic
1091168272 11:133499487-133499509 AAGAGTGAGCACGGTGGCAAAGG - Intronic
1091343198 11:134835804-134835826 AAGAATGCTCAGAGAGGTGAAGG + Intergenic
1091419024 12:318868-318890 GAGAATGACCAGAGTGGGGAAGG + Intronic
1092782987 12:12004442-12004464 TAGAGTGAGGACAATGGTGATGG - Intergenic
1097247474 12:57614475-57614497 AAGAGAGAGCAGGGTGGGCAAGG - Intronic
1097618723 12:61914366-61914388 CAGTGGGAGCAGTGTGGTGAAGG - Intronic
1098448231 12:70589568-70589590 AAGAGTGATTAAAGTGGAGAGGG - Intronic
1098876037 12:75867397-75867419 AAGAGTGAGGAGGGTGGTTCTGG - Intergenic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1100863973 12:98836103-98836125 AAGAGCAAGGAGAGTAGTGAAGG - Intronic
1101144239 12:101826205-101826227 AAAAGGGAGCAGAGAGGTCACGG + Intronic
1102296893 12:111744137-111744159 AATAGTGAGCTGAGTGATGCTGG + Intronic
1102718926 12:114999700-114999722 CAGGGTCAGCAGGGTGGTGAGGG - Intergenic
1104317246 12:127714730-127714752 AAGGGTGATCAGCATGGTGATGG + Intergenic
1104464773 12:128981322-128981344 AATAGTAAGCAGAGCGGGGAAGG + Intronic
1105215359 13:18281061-18281083 AAGTGTGAAGAGAGTGGTGGAGG - Intergenic
1105960074 13:25325685-25325707 AAAAGTGAGTTGAGTGGTGGAGG + Intronic
1106129281 13:26926176-26926198 AAGAGTCAGCAAAGAGGAGAAGG + Intergenic
1108016891 13:46085925-46085947 AAGGGCGAGCTGAGCGGTGAGGG + Intronic
1108148816 13:47509135-47509157 AAGAGGGAGGAGAGAAGTGAAGG + Intergenic
1108176715 13:47799701-47799723 AAGAGTTAGAAAAGTGGTGTTGG + Intergenic
1108327010 13:49343618-49343640 AAGAGAGAGGAGAGAGGAGAGGG + Intronic
1108531335 13:51330052-51330074 AAGAGGGGGCCGAGTGGGGAAGG - Intergenic
1108886599 13:55192859-55192881 TAAAGTGAGCAGAGTGGAGAGGG - Intergenic
1109525361 13:63567293-63567315 AAGGGTGAGCAGAGTGGTGAGGG - Intergenic
1109620064 13:64892185-64892207 AAGAGAGGACAGAGTGGTTATGG - Intergenic
1111097926 13:83538897-83538919 AAGAGTGAGGAGAGTGGCGAAGG - Intergenic
1111253556 13:85638396-85638418 AAGGGTGAGCAGGGTGGTGAGGG + Intergenic
1113608876 13:111629253-111629275 AGGAGAGGCCAGAGTGGTGAGGG - Intronic
1113801228 13:113087391-113087413 AAGAGGGAGGAGAATGGGGAGGG + Exonic
1113887615 13:113669272-113669294 AAAATGAAGCAGAGTGGTGAGGG + Intronic
1114878577 14:26754788-26754810 AACAGGGATCAAAGTGGTGAAGG + Intergenic
1114983851 14:28200262-28200284 AAGAGTGATCAGAATATTGAGGG - Intergenic
1115995162 14:39188523-39188545 TAGAGGAAGCAGAGAGGTGAAGG + Intergenic
1116058428 14:39892938-39892960 GAGGGTGAGAAGAGTAGTGAGGG - Intergenic
1116371559 14:44140529-44140551 ATGAGAGAGGAGAGTGGAGAAGG + Intergenic
1118004977 14:61557559-61557581 GAGAGTGAACTGAGTGATGAAGG + Intronic
1118131253 14:62966511-62966533 ATGAGTGAGAGTAGTGGTGATGG - Intronic
1118893531 14:69927942-69927964 AAGAATAAACAGAGGGGTGAAGG + Intronic
1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG + Intergenic
1120355006 14:83421379-83421401 GAGAGAAAGCTGAGTGGTGAAGG - Intergenic
1120590165 14:86364921-86364943 AGGGGTGAGCAGAGTGGTGAGGG - Intergenic
1121431550 14:93891690-93891712 AAATGTGAGCAGAGTGTGGAAGG - Intergenic
1122826696 14:104374148-104374170 AAGAGGGAGCAGGAAGGTGAGGG - Intergenic
1122976578 14:105173342-105173364 TGGAGGGAGCAGAGTGGAGAGGG - Intronic
1124079427 15:26477651-26477673 AAGTGTGGGCAGAGGGGTGCAGG - Intergenic
1124627996 15:31320540-31320562 AAGATTGAGAAAACTGGTGAAGG - Intergenic
1124629483 15:31328305-31328327 AAGAATGTGCCGAGTGGCGAAGG - Intronic
1124720616 15:32108263-32108285 AAGAGTGTGTGGAGTTGTGAGGG - Intronic
1125148559 15:36503739-36503761 AAGAGAGAGAAGAGAGGTGTTGG + Intergenic
1126042674 15:44607958-44607980 AATACTGAGCAGAGTGGGAAGGG - Intronic
1126496233 15:49293741-49293763 TAGAGTGATGAGTGTGGTGATGG + Intronic
1126988097 15:54338384-54338406 AAAAGCGAGCATGGTGGTGAAGG + Exonic
1127300709 15:57650983-57651005 AATTATGAGCAGAGTGATGAAGG - Intronic
1127809381 15:62550118-62550140 GAGAGTGGTCAGAGTGGTTAAGG + Intronic
1128199624 15:65793197-65793219 CAGAGGGTGCACAGTGGTGAGGG + Intronic
1128338167 15:66801919-66801941 AAGAGGCAGCAGAGGGTTGAGGG + Intergenic
1129641619 15:77384946-77384968 AACAGTGAAGACAGTGGTGAGGG - Intronic
1130918915 15:88327733-88327755 GAGAGTGATCAGGATGGTGAAGG - Intergenic
1130964334 15:88685941-88685963 CAGAGGCAGCAGAGTGGAGATGG + Intergenic
1132098020 15:99002406-99002428 ACGAGTGAGCTTTGTGGTGATGG + Intronic
1134057532 16:11180016-11180038 ACCAGTGACCAGAGAGGTGAGGG - Exonic
1134130399 16:11645628-11645650 AAGAGGAGGCAGACTGGTGATGG + Intergenic
1135307845 16:21382263-21382285 AGGAGTGAGCAGCGTGTTCAGGG + Intergenic
1135522596 16:23188962-23188984 CAGAGTGAGCTGGGTGGAGAAGG + Intronic
1136304590 16:29361383-29361405 AGGAGTGAGCAGCGTGTTCAGGG + Intergenic
1137402099 16:48162247-48162269 CAGAGTGGGTAGAATGGTGAGGG + Intergenic
1137574660 16:49590849-49590871 CAGAGTGGCCAGAGTGGTGGTGG - Intronic
1137679458 16:50327052-50327074 ATCAGTGACCAGTGTGGTGAAGG + Intronic
1137864344 16:51877653-51877675 AAGTGTGAGCAGCTTGCTGAAGG - Intergenic
1137873952 16:51977471-51977493 AAGAATGAACAGAATGGTGATGG - Intergenic
1138321019 16:56111886-56111908 AAAAGTCAGGAGAGTGGTGCTGG + Intergenic
1139183234 16:64771456-64771478 AAGAGCGAGTGGAGCGGTGAGGG - Intergenic
1139524713 16:67507804-67507826 GACATTGAGCAGAGTGGAGAAGG - Intergenic
1139625694 16:68187045-68187067 AAGGGTGAGCAGAGTGGGAAGGG + Intronic
1141831067 16:86510267-86510289 AAGAGGGAGGAGAGAGGTGGGGG + Intergenic
1143069140 17:4275843-4275865 AAAAGTCAGCGGATTGGTGACGG - Intronic
1144670991 17:17132500-17132522 GAGAGGGAGCAGGGTGGGGATGG + Intronic
1145260446 17:21351729-21351751 AAGAGTGAGCAGTATGGTTTTGG + Intergenic
1146637760 17:34518826-34518848 AAGAGTGAGCAGAGGCCTAAGGG - Intergenic
1147389145 17:40098909-40098931 AGGAGTGAGAAGGGTGGTTAGGG + Intronic
1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG + Intergenic
1148391478 17:47276041-47276063 AAGAGAGAGCTGAATGGGGAGGG + Intronic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1149336855 17:55644282-55644304 AAGAGGGAGAAGAGTAGTAATGG + Intergenic
1149490497 17:57081640-57081662 AGGAATGAGAAGAGAGGTGAGGG - Intergenic
1149553558 17:57557477-57557499 AGAAGTGAGCTGGGTGGTGATGG - Intronic
1150104877 17:62455357-62455379 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1151515961 17:74595918-74595940 AAAAGTGATCAGACTGGGGAAGG - Intergenic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152034023 17:77860986-77861008 AAGAGCAAGCAAAGTGGGGATGG + Intergenic
1152377987 17:79928515-79928537 AAGAGGGAGCAGGCTGGGGAAGG - Intergenic
1152458389 17:80428815-80428837 AAGAGGGAGGAGAGTGGAGTGGG + Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1152721134 17:81924298-81924320 AAGTGAGAGCAGAGTGCTGGAGG - Intronic
1155110153 18:22706943-22706965 AAGAGACAGAAGAGGGGTGATGG + Intergenic
1156309959 18:35912570-35912592 AAGGGTGGACAGTGTGGTGAAGG - Intergenic
1156461952 18:37326210-37326232 AAGGGAGAGCAGAGGGGTCAGGG + Intronic
1157590056 18:48831087-48831109 GTGAGTGAGCAGAGTGGGGCTGG + Intronic
1158299469 18:56035288-56035310 CACACTGAGCAGAGGGGTGAAGG - Intergenic
1158749579 18:60243446-60243468 GAGAGTGAGGAGAGTGGTCTTGG - Intergenic
1159472025 18:68869199-68869221 AACAATGAGCAGAGAGATGATGG + Intronic
1161882551 19:6966596-6966618 AAGATTGAATAGAGTGGTCACGG - Intergenic
1162163243 19:8734616-8734638 AAGAGAAAGCAGATTGATGATGG + Intergenic
1162300403 19:9841821-9841843 AAGAGTGAGCAGGAGGGTGCAGG + Intronic
1162765322 19:12915843-12915865 AAGTGTGGGCAGGGTGGGGAAGG - Intronic
1163561455 19:18021748-18021770 AAGAATGATCAGAGAGGGGATGG + Intergenic
1164912365 19:32023313-32023335 AAGAAAGAGCAGAGGGGGGAGGG + Intergenic
1165213030 19:34250653-34250675 AAGAGTGAGGGGAGTGGGAAAGG - Intergenic
1165289732 19:34873641-34873663 AAGAGTGAGCAGAAAGTTGCTGG + Intergenic
1165431730 19:35776775-35776797 CAGAGTGATCAGAGCTGTGAAGG + Intronic
1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG + Intronic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166703844 19:44897398-44897420 AACACTGACCAGAGTGGTAATGG + Intronic
1167698185 19:51026985-51027007 CAGAGAGAGAAGAGTGGAGATGG - Intronic
1167780601 19:51596365-51596387 CAGAATGAGAAGAGGGGTGATGG + Intergenic
1167889590 19:52528665-52528687 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167894672 19:52571274-52571296 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167898741 19:52602198-52602220 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167903156 19:52637361-52637383 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167904552 19:52647982-52648004 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167909330 19:52689465-52689487 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167913841 19:52724758-52724780 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167921345 19:52785754-52785776 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167925852 19:52820612-52820634 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167930038 19:52856601-52856623 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167934173 19:52892833-52892855 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167937849 19:52922390-52922412 CAGACAGAGCAGAGTGGTGCTGG - Intergenic
1167940348 19:52941656-52941678 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167946366 19:52992323-52992345 CAGACAGAGCAGAGTGGTGCTGG - Intergenic
1167991825 19:53366703-53366725 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167995217 19:53396153-53396175 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167999475 19:53432949-53432971 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1168003847 19:53469710-53469732 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1168141586 19:54391544-54391566 AAGAGAATGCAGAGGGGTGAGGG + Intergenic
1168683636 19:58334916-58334938 CAGAGTGAGCAATGTGGTCATGG - Exonic
1168725278 19:58577853-58577875 AGGAGTGAGCAGAGTAGAGGAGG + Intergenic
925321804 2:2976144-2976166 AAGTGTGAGGAAGGTGGTGATGG + Intergenic
926109630 2:10173637-10173659 GAGAGCGAGGAGAGAGGTGATGG + Intronic
926369133 2:12162879-12162901 AAGAGAGAGCAGGTTGGTGGAGG + Intergenic
927333173 2:21890285-21890307 AACAGTGGGCAGAGAGATGAAGG + Intergenic
929638545 2:43551031-43551053 ATGAGTTAGAAGATTGGTGATGG - Intronic
930395595 2:50819949-50819971 ACAAGTGAGCAGAGTGGTGCTGG - Intronic
931476206 2:62590237-62590259 CAGAGGGAGCTGAGGGGTGAAGG + Intergenic
931515419 2:63048242-63048264 GAGAGGGAGGAGAGTGGAGAGGG - Intergenic
931720616 2:65064963-65064985 AAGAGAGAGAAGACTGGTGGAGG - Intronic
932081873 2:68722984-68723006 AAAAGAGAGCAGAGAGGTGATGG - Intronic
932312446 2:70754604-70754626 ATGAGTAAGGAGAGTGGTGGAGG - Intronic
932437893 2:71713637-71713659 TAGAGTAAGCAGAGAGGAGAAGG + Intergenic
932591861 2:73072167-73072189 ACGAGTGGGCAGGGTGGCGACGG - Intronic
933754844 2:85630106-85630128 AAGAGTGTGGGGGGTGGTGAGGG - Intronic
933878708 2:86646310-86646332 ATGCTTGAGCTGAGTGGTGAAGG - Intronic
934043328 2:88147883-88147905 ATGAGTGTCCAAAGTGGTGATGG - Intergenic
934298969 2:91765666-91765688 AAGTGTGAAGAGAGTGGTGGAGG + Intergenic
934511367 2:94946936-94946958 AAGAGGAAAGAGAGTGGTGAGGG - Intergenic
934522871 2:95030901-95030923 AAGAGTGACCAGAGAGGTCTGGG + Intronic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
937680806 2:124642228-124642250 AAGAGCCAGCAGAGTAGTAATGG - Intronic
938072308 2:128315182-128315204 AAGAGTGAGCAGAGCATTGGCGG - Intronic
938811257 2:134855052-134855074 AAGGGAGAGGAGAGGGGTGATGG - Intronic
938915373 2:135933462-135933484 ATGAGGGAGCTGAGTGGTTAAGG + Intronic
940282217 2:152000151-152000173 AAGAGTGAGGTGGGTGGTGGAGG - Intronic
941275276 2:163483170-163483192 AAGTGAGAGCAAAGTGATGAAGG + Intergenic
943072770 2:183161165-183161187 CAGAGTTAGCAGAGTGCTGCTGG + Exonic
943426884 2:187749144-187749166 AAGGGCAAGCAGAATGGTGAGGG + Intergenic
943808870 2:192159253-192159275 AACAGAGAGGAGAGTGTTGAGGG + Intronic
943909778 2:193548329-193548351 AAGGGTGAGAAGAGGAGTGAGGG + Intergenic
944285193 2:197941737-197941759 GAGAGAAAGCAGAATGGTGAGGG - Intronic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
945097137 2:206230651-206230673 AAGAGAGGGCAGGGTTGTGAGGG + Intergenic
945991027 2:216395417-216395439 ATGAGTGAGCAGATTGGAGCAGG + Intergenic
946626319 2:221615341-221615363 AATAATTAGCTGAGTGGTGATGG - Intergenic
947174720 2:227353498-227353520 ACAAGTCAGCAGAGTGGTAAGGG - Intronic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948377928 2:237534329-237534351 AAGAGAGGGGAGAGTGGGGAGGG - Intronic
948478806 2:238238131-238238153 CAGAGTGAGCAGTGTGATGGTGG - Intergenic
948637560 2:239349177-239349199 AAGAGTGAGCCGGGTGGGCAGGG + Intronic
948782029 2:240327752-240327774 AAAGGCGAGCAGAGTGGCGAGGG - Intergenic
948930416 2:241128318-241128340 AAGAGAGAGGAGGCTGGTGAGGG + Intronic
949061098 2:241957858-241957880 AAGAGAGAGGAAAGTGGAGAGGG - Intergenic
1168835274 20:873440-873462 AGCAGTGAGCAGAGCGATGAGGG - Intronic
1170381509 20:15764900-15764922 TAGAGTGAGCAGAGAGCAGAAGG - Intronic
1170603631 20:17860034-17860056 AAGAGTGGGCAGGGTGGAGCAGG - Intergenic
1171334288 20:24369826-24369848 AAAAGTGAGAAGAGTGATGTTGG + Intergenic
1172450604 20:35020063-35020085 AAGAGTGAGGAGAGGAGTTAAGG - Intronic
1172718698 20:36983115-36983137 AAGAGAGAGCAGAGGAGAGAAGG - Intergenic
1173583338 20:44163004-44163026 ATAAGTGAGCAGGGTGGTGGGGG - Intronic
1175279590 20:57794168-57794190 GAGAGTGAGGAGGGTGGGGATGG + Intergenic
1175343505 20:58251280-58251302 AACAGAGACCAGAGGGGTGATGG + Intergenic
1175470755 20:59225789-59225811 AAGAGTTAGGAGAATGGTGTGGG + Intronic
1175891569 20:62318210-62318232 AAGAGGGAGGAGAGAGGAGAAGG + Intronic
1175938733 20:62527340-62527362 AAGAGCGAGCCGTGTGGTAAAGG - Intergenic
1177262717 21:18750811-18750833 AAGGGTGAGCACAGCGGTAAGGG - Intergenic
1178226491 21:30725311-30725333 AAGAGAGAGAAAAGTGGGGAGGG + Intergenic
1182030968 22:27159174-27159196 GCGAGTGAACAGAGGGGTGAGGG + Intergenic
1182143730 22:27984090-27984112 GACAGGGAGCAGAGTGGAGATGG - Intronic
1182760372 22:32717729-32717751 AAGAGTGTGGAGAGAGGTGAAGG + Intronic
1184047757 22:41982083-41982105 AAGCAGGATCAGAGTGGTGAAGG - Intronic
1184968744 22:48000096-48000118 AGGAGTGGGGAGAGTGGAGATGG - Intergenic
1185181557 22:49366375-49366397 GAGAGTGTGCAGAGCGGTGCCGG + Intergenic
1185233581 22:49698607-49698629 CAGAGTGAGGGGAGTGCTGAGGG + Intergenic
1185385736 22:50530663-50530685 CAGAGTCAGGAGAGTGGGGAGGG - Intronic
949395082 3:3606358-3606380 AAGATTGAGCAGAGTGTTTGGGG - Intergenic
949825974 3:8166283-8166305 ATGAGTGAGCAGAGCTGAGATGG + Intergenic
951974099 3:28484011-28484033 AATATTGAGAAGAGTGGTGAGGG + Intronic
953003700 3:38958138-38958160 ATCACTGAGCAGAGTGGGGAAGG - Intergenic
953126110 3:40093140-40093162 AAGAGAGAGCCCAGTAGTGATGG + Intronic
954683570 3:52358771-52358793 GAGAGGGAGCAGAGGGGTGCAGG - Intronic
954930928 3:54280687-54280709 AAGAGAGAACAGAGTCGGGAAGG - Intronic
955755336 3:62219978-62220000 AGGAGTGTTCAGAGTGGTCAAGG + Intronic
955829380 3:62985029-62985051 AAGGGTAAGCAGAGTCCTGAGGG - Intergenic
956091953 3:65677510-65677532 AACACTGAGCAGAGTGCTTAAGG + Intronic
956386653 3:68726252-68726274 CAGAGTGAGCGAAGTAGTGAGGG - Intergenic
957179444 3:76858000-76858022 AAGAATGAGGAGAGTCTTGAAGG - Intronic
958747789 3:98158316-98158338 GATACTGAGCAGAGTGTTGAAGG - Intergenic
958753086 3:98216084-98216106 GATACTGAGCAGAGTGTTGAAGG - Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
961352141 3:126310920-126310942 GAGAGAGAGCAGGGTGGAGATGG - Intergenic
961817343 3:129558001-129558023 AGGGGTGGGCAGAGGGGTGATGG - Intronic
961903766 3:130241367-130241389 AAGTTTGAGGAGAGAGGTGAGGG - Intergenic
962203510 3:133417585-133417607 AGGAGTGAGTAGAGGGGAGATGG - Intronic
962702893 3:138016507-138016529 AAAAATGAGCAGAGTGGAGAGGG + Intronic
962886384 3:139631818-139631840 CAGAGTTAGCATGGTGGTGAGGG - Intronic
965984528 3:174735921-174735943 AAGGGTGAACAGAGTGGTGAGGG + Intronic
966318599 3:178676424-178676446 AGGGGAGAGGAGAGTGGTGAAGG - Intronic
966473620 3:180320004-180320026 AAAAGTGAACAGGATGGTGAAGG + Intergenic
967203172 3:187093492-187093514 TAGAGTGGGCCTAGTGGTGATGG + Intergenic
967292607 3:187935946-187935968 AATAGTGAGAAGAGGGATGAGGG + Intergenic
967680438 3:192356169-192356191 AGGAGGAAGCAGAGTGGTGGTGG - Intronic
967978411 3:195048492-195048514 AAGAGTGAGCAGACTGATACTGG + Intergenic
968264763 3:197354468-197354490 CAGAGAGAGCAGAGTGTTAAAGG + Intergenic
968505847 4:971205-971227 ATGAGTGGGCAGGGTGGTGGGGG - Intronic
968605184 4:1532064-1532086 GAGAGTCAGCAGAGTGGAGCAGG - Intergenic
968914216 4:3490146-3490168 ATGAATGAGCAGGGTGGGGAAGG - Intronic
969043141 4:4316829-4316851 AAGAGTGATCAGAATGGTCATGG - Intronic
969453616 4:7288591-7288613 AAGAGAGAGGAGAGAGGAGAGGG + Intronic
972287217 4:37660685-37660707 AAGAGTAAGGAGATTGGTCAGGG + Intronic
972915242 4:43868977-43868999 AACAGTGAGCAATGTGGAGAAGG + Intergenic
973553214 4:52056138-52056160 AAGAGTGAGGAGAGGGCTGAGGG - Intronic
974272511 4:59669327-59669349 AAGTGGGAGCAGAGTGGAAAAGG + Intergenic
974439372 4:61897527-61897549 AAGAGTAGGCAGAGTGCAGAGGG - Intronic
974549527 4:63353000-63353022 AAGAGAGAGCAGAGAGGAAAGGG - Intergenic
974551384 4:63379671-63379693 AAGGGTGAGCAAGGTGGAGATGG - Intergenic
975393141 4:73843496-73843518 AAGAGTGGGGAGAGTGGGGCTGG - Intronic
975411544 4:74057792-74057814 AAGTGGGAGGAGAGTGGGGAGGG + Intergenic
975586844 4:75958698-75958720 AAGTGTGAGCAAAGTCTTGAAGG - Intronic
976934497 4:90612863-90612885 AAGAAGGGTCAGAGTGGTGAGGG + Intronic
976956686 4:90910116-90910138 AAGAGAGAGCAAAGTGGGAAGGG + Intronic
977451935 4:97209980-97210002 AAGAGTAATGAGAATGGTGATGG + Intronic
977487216 4:97664880-97664902 AAGGGCAAGCAGAGTGGCGAGGG + Intronic
977529039 4:98177848-98177870 CAGAGTGAACAAAGTGGTTAAGG - Intergenic
978145014 4:105362382-105362404 ACAACTGAGCAAAGTGGTGAAGG - Intergenic
980166518 4:129234593-129234615 AAGACAGAGCAGAGTTGTAAAGG + Intergenic
981803767 4:148688821-148688843 AAGAGTGAGCTGAGTTCGGATGG + Intergenic
981949790 4:150392377-150392399 AAGAGAGAGCAGAGTGAGTAGGG + Intronic
982655160 4:158139341-158139363 ATGAGTGAGCTGAGTGGAGCTGG - Intronic
983428882 4:167622174-167622196 AAAAGTTAGCCGAGGGGTGAGGG - Intergenic
983583298 4:169330217-169330239 AAGTGGGAGCAGTGGGGTGAAGG - Intergenic
985010154 4:185573857-185573879 CAGCGTGCACAGAGTGGTGAGGG + Intergenic
988493161 5:31722245-31722267 CAGAGTGTGCGGTGTGGTGAGGG - Intronic
988941798 5:36154427-36154449 AATGTTGAGCAGAGTTGTGATGG + Intronic
988958042 5:36338805-36338827 AAGAATGAGCTGACTGGTGCAGG - Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
993072272 5:83179971-83179993 AAGTGTAAGAATAGTGGTGAAGG + Intronic
995019239 5:107348021-107348043 AAGAGAGAGTAGAGAGGAGAAGG - Intergenic
995197459 5:109388138-109388160 AAGAGTGAGCAGAGAAATTAAGG - Intronic
995517438 5:112968099-112968121 AAGAGTGATCAGGCTGGGGATGG - Intergenic
995649704 5:114356692-114356714 ATGAATGAGCATATTGGTGATGG - Intergenic
996183662 5:120451086-120451108 AAGGGTGAGTGGAGTGCTGAGGG + Intergenic
997593433 5:135090232-135090254 ATGAGCCAGCAGAGTGTTGAAGG + Intronic
998138860 5:139688768-139688790 AAGAATGACCAGTGTTGTGATGG - Intergenic
998266734 5:140672618-140672640 AAGTGTGAGCTGAGCGTTGACGG - Exonic
998547563 5:143043850-143043872 AAGATTGAGTAGTGTAGTGAAGG + Intronic
999099898 5:149014851-149014873 GAGAGTGAGGAGAGTTGTGGAGG - Intronic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
999804195 5:155066829-155066851 AAAAGGAAGCAGAGAGGTGAAGG - Intergenic
999884962 5:155911958-155911980 TAGAGTGGGCAATGTGGTGAAGG - Intronic
999887039 5:155935850-155935872 AAGGGTGAGCGGAGTTGTCAGGG + Intronic
1000300478 5:159951742-159951764 AATACGGAGCAGAGTGGTGAGGG + Intronic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001148316 5:169204139-169204161 AAGAGAGAGCATAGTTGTGAAGG + Intronic
1002393862 5:178938327-178938349 AAGCGTAAGCAGACTGGTGATGG + Intergenic
1003343723 6:5246048-5246070 AAAAGGGAGCAGGGTGGTGTTGG + Intronic
1003738738 6:8909193-8909215 AGGAGTCAGCGGAGTGGTGCAGG + Intergenic
1004101593 6:12617716-12617738 AAAACTGAGCAGAGAGGTGAAGG + Intergenic
1004623317 6:17350599-17350621 ATGACTGATCAGAGTAGTGAAGG - Intergenic
1005588202 6:27297666-27297688 AAGAGTTAAAAGAGTGCTGAGGG + Intronic
1005667712 6:28075023-28075045 AAGAGAGAGGATATTGGTGAGGG + Intergenic
1006202920 6:32312817-32312839 AAGAGTGATCAGAGTGGAAGTGG - Intronic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1008875193 6:56318463-56318485 GAGAGTTATAAGAGTGGTGAAGG - Intronic
1009534198 6:64860353-64860375 AAGGTTGAGCAGAGTGGCAAGGG + Intronic
1010514605 6:76758238-76758260 AAGAGTGGAGGGAGTGGTGATGG + Intergenic
1011270604 6:85575726-85575748 AACAATGAGAAGAGTGGTTATGG + Intronic
1011333172 6:86233283-86233305 AAGAGAGGGAAGAGTGGTAAGGG - Intergenic
1011494263 6:87923165-87923187 AGGAGGGAGCAGACAGGTGAAGG - Intergenic
1011775123 6:90721609-90721631 AAGAGTGAGGAGGGAAGTGAAGG + Intergenic
1012107793 6:95187476-95187498 AAGAGTGAGAAGAGTGGTAGTGG - Intergenic
1012701870 6:102467963-102467985 AAGAATGAGCAGAGTGTTTTAGG - Intergenic
1013985650 6:116190192-116190214 AAGGTTGAGAAGTGTGGTGATGG - Intronic
1014069282 6:117162279-117162301 CAGAGTGGGCAGCGTGGAGACGG - Intergenic
1014153311 6:118083917-118083939 AAGAGACAGCAGAGTGGCCAAGG - Intronic
1015007503 6:128300928-128300950 AAGATAGAGCAGTGTGGTGGGGG - Intronic
1015286135 6:131488565-131488587 CAGAGTCAGTTGAGTGGTGAGGG + Intergenic
1015434105 6:133166029-133166051 AAAAGTGAGCAGAGATTTGAAGG + Intergenic
1015524498 6:134162826-134162848 AAGAGTGAGCAGAATGGTGTTGG + Intergenic
1015979185 6:138821740-138821762 AACAGTGAGCAGAGCGGAAAAGG + Intronic
1016630885 6:146229449-146229471 AAGAGAGAGCAGAATAGAGAGGG + Intronic
1016896951 6:149062836-149062858 AAGATTGAGCAAGGTAGTGAGGG + Intronic
1016943266 6:149502273-149502295 AAGAGGGGGCAGAGGGGTGAGGG + Intergenic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1017537881 6:155367798-155367820 TAGAGTGGGCAGAGGGGTTATGG + Intergenic
1018678336 6:166242193-166242215 TCGAGTGAGCAGAGTGTTGCTGG - Intergenic
1018714901 6:166524699-166524721 TAGAGTGTGCAGAGTGCTGCCGG - Intronic
1019448368 7:1083085-1083107 AAGAGTGGGCAGGGTGGTGCTGG - Intronic
1020011246 7:4807056-4807078 AAGAGCCAGCAGAGGGGTGGAGG - Intronic
1020498364 7:8885708-8885730 AATAGCTAGCAGGGTGGTGAAGG + Intergenic
1021541848 7:21768453-21768475 AACAGTGAGCTGTCTGGTGAAGG + Intronic
1022509347 7:30925348-30925370 AGGAGTGGGGAGAGTTGTGATGG + Exonic
1022569946 7:31442525-31442547 ATGAGAGAGCAGAGAGGAGACGG + Intergenic
1022675075 7:32491998-32492020 AAGAGTAAGGAGAATGTTGATGG - Intronic
1023557294 7:41436576-41436598 AAGGAAGGGCAGAGTGGTGAGGG + Intergenic
1023719749 7:43080512-43080534 AAGAGTAAGCATGGTGATGATGG + Intergenic
1023821012 7:43980512-43980534 AAGAGGCAGGAGGGTGGTGAAGG + Intergenic
1024572203 7:50732596-50732618 AAGGGTGCCCAGAGTGGTGAGGG + Intronic
1025014450 7:55427639-55427661 AAGAGTGAGCAGATTGGGAGGGG + Intronic
1026445343 7:70479793-70479815 TAGGGTTAGCACAGTGGTGAGGG - Intronic
1027328286 7:77065062-77065084 AAGAGGCAGGAGGGTGGTGAAGG - Intergenic
1028133817 7:87206346-87206368 AAGACTGAGCAAAGTGATGTGGG - Intronic
1028165162 7:87530055-87530077 AAGAGATAGCAGAGAGGTAAAGG + Intronic
1028487249 7:91373506-91373528 AAGAGTGGGCTGACTGGTCAAGG + Intergenic
1028640908 7:93040598-93040620 AAGGGTGAGCAGAGCGGTGAGGG - Intergenic
1028744999 7:94317977-94317999 AAGAGTGAGGGGAGTGCTGCAGG - Intergenic
1029216452 7:98953897-98953919 ACGAGAGAGCAGAGTGGGAATGG - Intronic
1029749285 7:102533951-102533973 AAGAGGCAGGAGGGTGGTGAAGG + Intergenic
1029767228 7:102633055-102633077 AAGAGGCAGGAGGGTGGTGAAGG + Intronic
1030153153 7:106426325-106426347 AAGAGGGAGGAGAGTGGGGAAGG - Intergenic
1030555856 7:111022761-111022783 AAGGATCAGCAGATTGGTGACGG - Intronic
1030723240 7:112894195-112894217 AAGAGTGGGGAGAGAGGAGAGGG + Intronic
1031277863 7:119753921-119753943 ACTAGTGAGCAGAATGGTGGTGG + Intergenic
1031357100 7:120800554-120800576 AAGAGGAAACATAGTGGTGAGGG - Intronic
1032015711 7:128379246-128379268 AACAAGAAGCAGAGTGGTGAGGG + Intergenic
1032034048 7:128508575-128508597 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1032991878 7:137403012-137403034 CAGAGTGTGCAGGGTGGCGAAGG + Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1034318369 7:150155795-150155817 AGGAATGAGCAGAGAGGGGAGGG - Intergenic
1034434428 7:151056561-151056583 AAAGGTGAGGAGAGTGGTGTTGG - Exonic
1034774382 7:153811437-153811459 AGGAATGAGCAGAGAGGGGAGGG + Intergenic
1037554427 8:20008427-20008449 AAGTATGAGCAGGGTGGTGGTGG + Intergenic
1038556287 8:28520287-28520309 AAGTGTGACTAGATTGGTGATGG - Intronic
1039233105 8:35470820-35470842 AAGAATGAGCAGAGTTGGTATGG + Intronic
1043420268 8:80090428-80090450 AAGAGGAAGCACAGTGGGGATGG + Intronic
1044021617 8:87112148-87112170 AAGAGTGAGCAGGCAGATGATGG - Intronic
1044093967 8:88039394-88039416 TAGAGTGGAGAGAGTGGTGATGG - Exonic
1044503053 8:92984158-92984180 AAGACAGGGCAGAGTGGTAATGG - Intronic
1044828722 8:96224236-96224258 TAGAGATAGCAGAGTGGGGAGGG + Intergenic
1045231098 8:100308980-100309002 AAGAGGGAAGAGAGTGGTTAAGG - Intronic
1045479326 8:102579755-102579777 GAGAGTGAGGAGTGGGGTGAGGG - Intergenic
1045730119 8:105228235-105228257 AAGTGGGAGGAGAGTGGTCACGG + Intronic
1045905127 8:107336078-107336100 AAGAGTTGGCAGAGAGGTGAAGG + Intronic
1046040705 8:108900289-108900311 ATGAGTGAGCTTAGTGATGAAGG + Intergenic
1046101346 8:109617328-109617350 AAGGGGGAACAGAGTGCTGATGG + Intronic
1047242550 8:123105530-123105552 AAGAGAGAGAAGAGTGGTGATGG - Intronic
1048183311 8:132215890-132215912 AAGAGGGAGCAGAGAAGAGAAGG - Intronic
1048874273 8:138824714-138824736 AACTGTGAGCAGAGTGGTGTTGG - Intronic
1048976399 8:139675255-139675277 AAGGGTGAGCAAAGAGGTGCTGG - Intronic
1049453470 8:142675224-142675246 CAGAGGGTGCAGAGTGGTGGGGG + Intronic
1050678079 9:8079038-8079060 AAGTGGGAGCAAAGTGGTGGGGG + Intergenic
1051029549 9:12658122-12658144 AAGGGCAAGCAGAGTGGTGAGGG + Intergenic
1052656264 9:31365522-31365544 AGGAGAGAGGAGAGAGGTGAGGG - Intergenic
1052727134 9:32242725-32242747 AAGAGGGATTTGAGTGGTGATGG + Intergenic
1053010151 9:34628274-34628296 AAGAGTGAGCAGATCAGAGAGGG + Intergenic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1056311248 9:85343136-85343158 AAGTGTGTGTGGAGTGGTGATGG - Intergenic
1056931384 9:90880806-90880828 GTGAGTGAGCAGAGTGGAAACGG - Intronic
1056934714 9:90907356-90907378 AAGAGGGGGAAGAGAGGTGATGG - Intergenic
1057894390 9:98895840-98895862 AAGAGTGAGGAAAGTGGTGAAGG - Intergenic
1057966405 9:99508221-99508243 AAGAGAGACCAGAGTAGGGAAGG - Intergenic
1058634108 9:107019709-107019731 ATGAGTAGGCAGAGAGGTGAAGG + Intergenic
1059318886 9:113450857-113450879 AAGTTTCAGCAGTGTGGTGAGGG + Intronic
1059636025 9:116171496-116171518 AAGGGTGGACAGAGTGGTGGGGG - Intronic
1060180966 9:121533492-121533514 AAGTTTCAGCGGAGTGGTGAGGG + Intergenic
1060397520 9:123326576-123326598 AGGAGAGAGGAGAGTGGGGAGGG - Intergenic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1061199048 9:129125681-129125703 AAGAGTCAGCAGACTAGTCATGG + Intronic
1061202832 9:129147351-129147373 GCAGGTGAGCAGAGTGGTGAGGG - Intronic
1185773419 X:2783335-2783357 GAGAGAGAGAAGAGTGGGGAGGG + Intronic
1185874018 X:3687582-3687604 GTGAGTGTGCAGGGTGGTGATGG - Intronic
1185922983 X:4114571-4114593 AGGAGTGAGCAGTGAGGAGAAGG - Intergenic
1186807081 X:13151006-13151028 AAGAGAAAGCAGATTGTTGATGG - Intergenic
1187760393 X:22577335-22577357 ACTAGTGAGCTGAGTGATGAGGG - Intergenic
1188815921 X:34714127-34714149 AAGAGTGAGTAGCATGGTGGCGG - Intergenic
1188976864 X:36686158-36686180 CAGACAGAGCAGAGTGGAGATGG - Intergenic
1189198830 X:39174626-39174648 AACAGTCTGCAGAGTTGTGATGG - Intergenic
1189865590 X:45323805-45323827 AAGAGTGGGAAGGGTGGGGATGG - Intergenic
1191607236 X:63076158-63076180 AAGAATGGGCTGATTGGTGATGG - Intergenic
1192050783 X:67722091-67722113 GAGAGAGAGTAGAGTGGGGATGG - Intronic
1197094825 X:122581319-122581341 AAAAGTGAGCAAAGATGTGATGG + Intergenic
1197665421 X:129217966-129217988 CAGAGTGACAAGAATGGTGAGGG - Intergenic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic
1199533148 X:148872005-148872027 GACAGTAAGCAGAGTGGTTAGGG + Intronic
1199617055 X:149664771-149664793 AAGAGCTAGCAGAGTAGAGAAGG - Intergenic
1199625586 X:149738477-149738499 AAGAGCTAGCAGAGTAGAGAAGG + Intergenic
1201302966 Y:12526055-12526077 GAGAGGGAGCAGCGTGGTGAAGG + Intergenic
1202189118 Y:22222788-22222810 ACGGGAGAGCAGGGTGGTGAGGG + Intergenic