ID: 1017523058

View in Genome Browser
Species Human (GRCh38)
Location 6:155219082-155219104
Sequence ACTAACTTCGAGAATATAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017523058 Original CRISPR ACTAACTTCGAGAATATAGG TGG (reversed) Intronic
905585644 1:39115461-39115483 ACTAAAATAGAGAATATAAGAGG + Intronic
909808158 1:79897366-79897388 TCTAACTTCTAGAAAATATGAGG + Intergenic
916258505 1:162815721-162815743 AATATCTTCCAGAATATAGAAGG - Intergenic
918297149 1:183167763-183167785 AGTAACTTCATAAATATAGGGGG + Intergenic
918701245 1:187611045-187611067 ATTAACATCAAGAATATAGGAGG + Intergenic
919225554 1:194695178-194695200 AATAACTTCTTGAATATATGAGG - Intergenic
924376101 1:243411042-243411064 AATAACTTGGAGAATAAAGGTGG + Intronic
1062853501 10:765089-765111 ACTAACATCCAGAATATATAAGG + Intergenic
1064823564 10:19367989-19368011 ACTAATATCCAGAATATATGAGG - Intronic
1067906911 10:50301506-50301528 ACTAACATCCAGAATATACAAGG + Intergenic
1077900605 11:6484569-6484591 CTTAACTTCCAGAAGATAGGAGG + Exonic
1079271307 11:18988633-18988655 AGTAACTTCAAGAATATAATGGG - Intergenic
1081324854 11:41731548-41731570 ACTAATATCCAGAATATATGAGG - Intergenic
1081491188 11:43570270-43570292 ACTAAGATTTAGAATATAGGGGG + Intronic
1086271667 11:85074697-85074719 AATGTCTTCAAGAATATAGGAGG + Intronic
1086379357 11:86236215-86236237 ACTAAGATAGAGAAAATAGGAGG - Intergenic
1086585953 11:88451196-88451218 ACTTTCATAGAGAATATAGGTGG - Intergenic
1086590645 11:88510020-88510042 ACCAACTTCCAGAATAAAGGCGG - Intronic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1090704722 11:129325891-129325913 GCTAATTTCTAGAATTTAGGTGG + Intergenic
1091525117 12:1292314-1292336 ACTAACTGCCTGCATATAGGAGG - Intronic
1093150029 12:15609861-15609883 ACTAACTTGAAGAATCTATGGGG - Intergenic
1097536807 12:60882298-60882320 AATAACTTAAAGAATATAGTTGG + Intergenic
1099032448 12:77544203-77544225 ACTAATTTCCAGAATCTATGAGG + Intergenic
1099192949 12:79579319-79579341 ACTAATATCCAGAATATATGAGG + Intronic
1100856666 12:98763236-98763258 AATAACTTCGAGAATATTCTGGG + Intronic
1101578456 12:106019775-106019797 ACTAAGTTAGAGAATGTAGGAGG - Intergenic
1105592106 13:21801963-21801985 AATAACTTAATGAATATAGGAGG - Intergenic
1107334730 13:39342577-39342599 ATTAAGTTTGAGAATATGGGTGG - Intergenic
1108030290 13:46222243-46222265 ACTAACATCTAGAATATACAAGG - Intronic
1109851724 13:68074748-68074770 TCTAACATCTAGAATATTGGAGG - Intergenic
1110985233 13:81958280-81958302 ACTAAATTCCAAAATATAGTTGG + Intergenic
1111347739 13:86983545-86983567 ACTAAATGCGGTAATATAGGTGG + Intergenic
1117282782 14:54256843-54256865 TCTAACTTCTTGAATATTGGAGG - Intergenic
1117533208 14:56678834-56678856 ACTAATATCCAGAATATACGAGG + Intronic
1120385662 14:83842321-83842343 ACTGACTTCAAGAATATAGATGG + Intergenic
1127612509 15:60650750-60650772 ATTAACTTCCAGAATAAAGGAGG + Intronic
1138637631 16:58354179-58354201 ACTAATATCCAGAATATAGAAGG - Intronic
1144358941 17:14472599-14472621 ACTAACATCCAGAATCTAGAAGG - Intergenic
1144801715 17:17933375-17933397 ACTAAGTAAGAGAATATAGCTGG + Intronic
1146117869 17:30158345-30158367 ACTAATATCCAGAATATAGAAGG - Intronic
1156721562 18:40076308-40076330 ACTAACATCCAGAAAATAAGTGG - Intergenic
1157007384 18:43599982-43600004 AATAGCTTTGAGAATAAAGGAGG + Intergenic
925424239 2:3735495-3735517 AGTAACTTTCAGAACATAGGAGG + Intronic
929072963 2:38052403-38052425 ACTAATTTCTAGAATATACAAGG - Intronic
931613352 2:64127755-64127777 ACTAACTTGGAAAATCTAGGTGG + Intronic
932454327 2:71837131-71837153 ACCAAATTACAGAATATAGGAGG + Intergenic
932920212 2:75905263-75905285 ATTAACTTCGATTATCTAGGTGG - Intergenic
935988952 2:108702178-108702200 ATTAAATTAGAGAATGTAGGTGG + Intergenic
936268407 2:111029381-111029403 ATTAACTTCGAGAGTATTGCTGG - Intronic
939058302 2:137389450-137389472 ACTAATATCCAGAATATAGAAGG - Intronic
940681268 2:156787986-156788008 ACTAACTTAAAGAGTATAGTAGG - Intergenic
940758550 2:157711082-157711104 ACTAACATCCAGAATATAGAAGG + Intergenic
943490688 2:188552049-188552071 ACTAACTTCCAGAATATACAAGG - Intronic
943970516 2:194399309-194399331 ACTAACGTCAAGAAAATACGAGG - Intergenic
944759511 2:202799495-202799517 ACTAATATCCAGAATATACGAGG - Intronic
1176350719 21:5793952-5793974 AATAACTTTTATAATATAGGCGG - Intergenic
1176357533 21:5914536-5914558 AATAACTTTTATAATATAGGCGG - Intergenic
1176545040 21:8192022-8192044 AATAACTTTTATAATATAGGCGG - Intergenic
1176563991 21:8375067-8375089 AATAACTTTTATAATATAGGCGG - Intergenic
1176694768 21:9961667-9961689 AATAATTTTGAGAATATATGAGG + Intergenic
1176957305 21:15120776-15120798 ACTAACTTGGAGGATATAATTGG - Intergenic
1177962550 21:27685612-27685634 ACAATCTTCCAGAAAATAGGAGG - Intergenic
1180123824 21:45772955-45772977 ACTAACATCCAGAATATAAAGGG - Intronic
1181957753 22:26600517-26600539 ACTAGCTGTGAGAATCTAGGTGG + Intronic
1183124668 22:35764619-35764641 ACTAATATCTAGAATAAAGGGGG - Intronic
1203249910 22_KI270733v1_random:108260-108282 AATAACTTTTATAATATAGGCGG - Intergenic
955851614 3:63225915-63225937 ACTAACATCAAGAATATACAAGG + Intergenic
957447502 3:80333201-80333223 ACTAACATCCAGAATATACAAGG - Intergenic
957823232 3:85406639-85406661 ACTAACGCAGAGAATATTGGAGG - Intronic
958436132 3:94098110-94098132 ACTAAAATCGAGAAGAGAGGGGG - Intronic
959547565 3:107614628-107614650 AATGATTTCAAGAATATAGGAGG - Intronic
960227373 3:115184214-115184236 ACTGACTTCAAGAATGAAGGCGG + Intergenic
967461259 3:189749299-189749321 ACTAATATCCAGAATATATGAGG + Intronic
968966387 4:3771034-3771056 ATTAACTTCGAGGATACAGCAGG + Intergenic
974497245 4:62647887-62647909 GCTAACATCCAGAATCTAGGAGG - Intergenic
975711017 4:77159228-77159250 TCAATCTTCAAGAATATAGGTGG - Intronic
981863931 4:149391343-149391365 ACTAAATTCAAGAATAAAAGGGG - Intergenic
985284499 4:188321669-188321691 ACTAATATCCAGAATTTAGGAGG + Intergenic
988261481 5:28891834-28891856 ACTAACATCGAGAATCTACCAGG + Intergenic
990841914 5:60091263-60091285 ACTAACATCCAGAATATACAAGG + Intronic
991106312 5:62846535-62846557 ACTAACATCCAGAATATACAAGG - Intergenic
995992045 5:118252092-118252114 ACTAATATCCAGAATATATGAGG + Intergenic
999788050 5:154910345-154910367 ACTAACCTGGACAACATAGGGGG - Intronic
1003118795 6:3302970-3302992 ATTAACATCTAGAATATATGAGG + Intronic
1005855394 6:29858241-29858263 ACTAACATCTAGAATATACAAGG + Intergenic
1009788230 6:68365826-68365848 ACTAATATCCAGAATATACGAGG - Intergenic
1013391980 6:109694698-109694720 ACTAATATCCAGAATATATGAGG + Intronic
1016303621 6:142658930-142658952 ACTAATTTCAAGAATATTTGAGG + Intergenic
1017523058 6:155219082-155219104 ACTAACTTCGAGAATATAGGTGG - Intronic
1020707954 7:11569293-11569315 ACTAACGTCTAGAATATACAAGG + Intronic
1021451803 7:20789157-20789179 ACTTCCTTCCAGAAGATAGGAGG - Intergenic
1021861642 7:24911722-24911744 ACTAATTTAGGGAACATAGGTGG + Intronic
1022398618 7:30014355-30014377 TCTAACTTGGAGAAAATAGAGGG + Exonic
1022549263 7:31222122-31222144 ACTAATATCCAGAATATATGGGG - Intergenic
1024928700 7:54646394-54646416 ACTGAGATGGAGAATATAGGAGG + Intergenic
1026658792 7:72280530-72280552 ATTAACTTGGAGAAAAAAGGAGG - Intronic
1029234924 7:99107257-99107279 AATAACTTAAAGAATATAAGTGG + Intronic
1029792278 7:102857341-102857363 ACTAACATCCAGAATATACAAGG + Intronic
1031728723 7:125270113-125270135 ACTAATATCCAGAATATACGAGG - Intergenic
1034160294 7:148989197-148989219 ACTAACATCCAGAATCTACGAGG + Intergenic
1037140463 8:15513035-15513057 CCTAACTTCTTGAATATATGGGG - Intronic
1041508412 8:58627088-58627110 ACTAACATCCAGAATCTACGAGG - Intronic
1041584861 8:59504420-59504442 ACTAACATCGAGAATCTATAAGG + Intergenic
1044888106 8:96801351-96801373 ACTTACTTCAAGCATAAAGGAGG + Intronic
1048235589 8:132686717-132686739 ACTTACTTTGAGAAAAGAGGAGG + Intronic
1052297411 9:26912588-26912610 ACTAACTTCTGGAAAATGGGAGG + Intronic
1203466306 Un_GL000220v1:91521-91543 AATAACTTTTATAATATAGGCGG - Intergenic
1188469725 X:30524703-30524725 ACTAATATCAAGAATATACGGGG - Intergenic
1189455542 X:41185368-41185390 AATCACTTCAAAAATATAGGGGG - Intronic
1191941693 X:66488222-66488244 ACAAATTTCCAGAATATAGAAGG + Intergenic
1195228282 X:102820453-102820475 ACTAATTTATAGAAAATAGGAGG - Intergenic
1196244380 X:113382505-113382527 ACTAATTTCAAGAATCTACGAGG + Intergenic
1199471065 X:148197144-148197166 ATTAACCTAGATAATATAGGTGG - Intergenic
1201352596 Y:13061035-13061057 ACTAATATCCAGAATATACGGGG + Intergenic