ID: 1017524479

View in Genome Browser
Species Human (GRCh38)
Location 6:155230468-155230490
Sequence TGACCAGTGCCGAAAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017524479_1017524485 24 Left 1017524479 6:155230468-155230490 CCCCCCACTTTCGGCACTGGTCA 0: 1
1: 0
2: 2
3: 5
4: 100
Right 1017524485 6:155230515-155230537 TGTCTTCCCAGCCAGACTCAAGG 0: 1
1: 1
2: 0
3: 33
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017524479 Original CRISPR TGACCAGTGCCGAAAGTGGG GGG (reversed) Intronic
900236895 1:1597344-1597366 TGACCAGGGCAGAAGGTGGCTGG + Intergenic
904053481 1:27655331-27655353 TGATCAGAGCAGAGAGTGGGAGG + Intergenic
904755294 1:32765579-32765601 GGATCAGTGGCGAAGGTGGGAGG + Intronic
908117446 1:60953905-60953927 TGACCAGTGAGGACAGTAGGGGG + Intronic
911584477 1:99674789-99674811 TGAACAATCCAGAAAGTGGGAGG + Intronic
912056070 1:105599363-105599385 TGACATGTGCCCAAGGTGGGGGG + Intergenic
913565687 1:120069896-120069918 TGACCAGTGCAGAAGGGGCGTGG + Intergenic
913632442 1:120723658-120723680 TGACCAGTGCAGAAGGGGCGTGG - Intergenic
914286283 1:146229270-146229292 TGACCAGTGCAGAAGGGGCGTGG + Intergenic
914547311 1:148680012-148680034 TGACCAGTGCAGAAGGGGCGTGG + Intergenic
914619202 1:149390348-149390370 TGACCAGTGCAGAAGGGGCGTGG - Intergenic
914679639 1:149930003-149930025 TCACCAGTGCAGTGAGTGGGTGG - Intronic
915632297 1:157161830-157161852 AGACCAGTGCCCAAGGTGGTTGG + Intergenic
915776945 1:158500772-158500794 TCACCAGTGCTGAAGGTGGGAGG - Intergenic
916468538 1:165097211-165097233 TGTCCATTGCTGAAAGTAGGGGG - Intergenic
917727976 1:177845786-177845808 TGACCTGTGCTGTAAGTGAGGGG + Intergenic
1068809072 10:61235305-61235327 TGACAAGTGCCCAAGGTGGTTGG - Intergenic
1075063198 10:119271216-119271238 TGACCAGCGCCCAAAGGGCGTGG - Intronic
1075596735 10:123736971-123736993 TGCCCACTGCGGAAGGTGGGAGG - Intronic
1083634170 11:64111215-64111237 TGAGCAGTGCCCTAAGTAGGGGG - Intronic
1090652848 11:128822767-128822789 TTACCAGTGTCCAAAGTGGCAGG + Intergenic
1099051812 12:77789929-77789951 TGTCCTGGGCCGAATGTGGGTGG + Intergenic
1099637518 12:85233399-85233421 TGACCAGTGACAGAAGTGTGTGG + Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104757112 12:131276222-131276244 TGACATGTGCCCAAAGTGGTCGG + Intergenic
1113511993 13:110863832-110863854 TGCCCGGTGACGAAAGTAGGAGG - Intergenic
1114401919 14:22417997-22418019 TGACCAGGGTGGAAGGTGGGAGG - Intergenic
1134049426 16:11126608-11126630 TGAGCTGTGGCAAAAGTGGGAGG - Intronic
1135488384 16:22885844-22885866 CGACCAGTGACCACAGTGGGTGG - Intronic
1135988031 16:27198537-27198559 TGACATGTGCCGAAGGTGGTTGG - Intergenic
1140211358 16:72973195-72973217 AGACCAGGGCCGACAGTGAGGGG - Intronic
1149689993 17:58567527-58567549 TGACAGGTGCCTAAAGTGGAAGG - Intronic
1152020814 17:77779412-77779434 TTACCAGTGCCCACAGCGGGAGG + Intergenic
1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG + Intronic
1159153362 18:64549867-64549889 TGTCCATTGCGGGAAGTGGGTGG + Intergenic
1159918232 18:74204551-74204573 TGACCTGTGCTGAAGGTGGTCGG - Intergenic
1161532933 19:4800964-4800986 AGACCCGGGCCGAATGTGGGTGG + Exonic
1161966799 19:7553619-7553641 TGATCAGGGCCCAAAGTGGAGGG + Intronic
1164209079 19:23082175-23082197 TCACCAGAGACTAAAGTGGGAGG - Intronic
1165342404 19:35222477-35222499 TCACCAGGGCCGAGAGTGTGTGG - Intergenic
925235450 2:2273364-2273386 AGACCAATACAGAAAGTGGGTGG + Intronic
925946068 2:8865009-8865031 TTACCAGTGGGGAAAGTGGACGG - Intronic
927751797 2:25676127-25676149 TGACCAATTCAGAAACTGGGGGG + Intergenic
927892878 2:26763531-26763553 TGAACTGTGCCCAAGGTGGGCGG + Intergenic
933196822 2:79399984-79400006 TGACATGTGCCCAAAGTGGTTGG + Intronic
934706394 2:96484569-96484591 TGACCATTGGCTAAAATGGGGGG - Intergenic
937370335 2:121293260-121293282 TCCCCAGTGCTGGAAGTGGGTGG - Intergenic
941239487 2:163018002-163018024 AGACCAATGCAGAAGGTGGGTGG - Intergenic
941524840 2:166594591-166594613 TGTCCAGTGCTGAAAGCGGGGGG - Intergenic
942237574 2:173927056-173927078 TGACCAGGGCAGCAAGAGGGTGG + Intronic
943956748 2:194201454-194201476 TGACCACTGCAAAAAGTGGATGG - Intergenic
947576693 2:231280968-231280990 AGTCCAGTGCCGAAGGAGGGCGG + Intronic
1174588288 20:51625419-51625441 TGGCCAGTGCCAAGAGTGGAAGG + Intronic
1177814527 21:25961320-25961342 TGACATGTGCCCAAAGTGGTTGG - Intronic
1178118014 21:29437069-29437091 TGACATGTGCCCAAAGTGGTTGG + Intronic
1178306230 21:31492663-31492685 TGACCTGTGCCCAAGGTGGTCGG - Intronic
1179358277 21:40682292-40682314 TGACCAATACAGAAAGTGGATGG + Intronic
1183427325 22:37746692-37746714 TGACTGGTGCCGCAAGTGTGAGG - Intronic
950679638 3:14576005-14576027 TGGCCAGTGCTGGAAATGGGAGG + Intergenic
954330957 3:49890055-49890077 TGACCACTGTGGAAAGGGGGAGG + Exonic
957437697 3:80200330-80200352 AAACCATTGCGGAAAGTGGGTGG - Intergenic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
966178849 3:177169706-177169728 TGACCAGTGAAGAAAGAGTGAGG - Intronic
967483601 3:190004320-190004342 GGACCAGCGCAGAAAGTGGCTGG + Intronic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
967937345 3:194739539-194739561 TGACCAGTGCCTGCAGTGTGGGG + Intergenic
968469305 4:771551-771573 GGCCCAGTCCCCAAAGTGGGTGG - Intergenic
968752855 4:2399214-2399236 TAACCAGTGCACAATGTGGGGGG + Intronic
969189474 4:5505413-5505435 TGACAAGTGTAGAAACTGGGAGG + Intergenic
970384043 4:15538123-15538145 TGACCAGTGCCCCAGGTGAGTGG + Exonic
971707041 4:30058392-30058414 CTACCAGTGCCAGAAGTGGGTGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
974166594 4:58212600-58212622 TGACAAGTGCCCAAGGTGGTCGG - Intergenic
978438344 4:108709425-108709447 TGCCCAGAGCCGCGAGTGGGTGG - Intergenic
979417357 4:120460391-120460413 AGACCAATGCAGAAGGTGGGTGG + Intergenic
985333697 4:188869040-188869062 AGAGCAGTGCCGATAGTGGCAGG - Intergenic
986784958 5:11105510-11105532 TGACCAGTGCCGAAGCCGAGAGG + Intronic
993410580 5:87567910-87567932 AGACCAACGCAGAAAGTGGGTGG - Intergenic
997089973 5:130845222-130845244 TGACAGGTACTGAAAGTGGGTGG + Intergenic
997241763 5:132312830-132312852 TGACCAGTGCAGGAAGGTGGGGG + Intronic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
1000732236 5:164849269-164849291 TGATCAGTGTCAAAAGTGGCAGG + Intergenic
1004080425 6:12386937-12386959 TCACCAGTGCAGAAAGTGCATGG - Intergenic
1007211588 6:40197069-40197091 TCACCACTGCAGAAAGTGGCAGG - Intergenic
1008375483 6:50786533-50786555 AGACCAGTGACGAAAGTGGGTGG + Intergenic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1015053392 6:128869675-128869697 TGAGCAGTGCCTGGAGTGGGTGG - Intergenic
1017402110 6:154076565-154076587 TGACCAGTTCCAAAAGTGCTGGG - Intronic
1017524479 6:155230468-155230490 TGACCAGTGCCGAAAGTGGGGGG - Intronic
1018572919 6:165229613-165229635 TGACTAGTGCCAAAATTTGGAGG + Intergenic
1022568911 7:31431920-31431942 TGACTTGTGCCCAAAGTGGTAGG + Intergenic
1026610887 7:71858855-71858877 TGACATGTGCCCAAAGTGGTCGG - Intronic
1032520134 7:132537612-132537634 TGACCAGACCCGGAAGAGGGTGG + Intronic
1038458383 8:27693985-27694007 TGACTTGTGCCCAAAGTGGTTGG - Intergenic
1038727022 8:30090679-30090701 TGACCTGTGTCCAAAGTGGTTGG - Intergenic
1042947360 8:74168657-74168679 TGACTGGTGCCGAAGCTGGGAGG + Intergenic
1043367157 8:79546130-79546152 TGTCCAGTGCTGAAAGTAGCTGG - Intergenic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1049070687 8:140353317-140353339 TGAGGAGTGACGAAAGGGGGGGG - Intronic
1051314331 9:15811844-15811866 TAACCAGTACCTAAAGTGTGAGG + Intronic
1053509544 9:38676132-38676154 TGACCAGTTCCTAAAGTGGAAGG - Intergenic
1054930362 9:70629205-70629227 TGACCAGTGCCGGGGGGGGGGGG + Intronic
1062181972 9:135195737-135195759 GGACCACTGCAGACAGTGGGTGG + Intergenic
1062666610 9:137676696-137676718 TGAGCAGTGGGGGAAGTGGGTGG + Intronic
1195292017 X:103438550-103438572 TGACATGTGCCCAAAGTGGTCGG - Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic
1199190329 X:144963030-144963052 TGACCAGTGGAGAAAGTTGATGG - Intergenic