ID: 1017524730

View in Genome Browser
Species Human (GRCh38)
Location 6:155232565-155232587
Sequence GGACATCAGTCAGAAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017524730_1017524736 -2 Left 1017524730 6:155232565-155232587 CCTAGTTCTTCTGACTGATGTCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 1017524736 6:155232586-155232608 CCTGGTTTGGGGAAACTCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 206
1017524730_1017524739 30 Left 1017524730 6:155232565-155232587 CCTAGTTCTTCTGACTGATGTCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 1017524739 6:155232618-155232640 TTGGATTCAGTCCAGGCTGATGG 0: 1
1: 0
2: 2
3: 12
4: 145
1017524730_1017524738 23 Left 1017524730 6:155232565-155232587 CCTAGTTCTTCTGACTGATGTCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 1017524738 6:155232611-155232633 ATGAGACTTGGATTCAGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 154
1017524730_1017524737 11 Left 1017524730 6:155232565-155232587 CCTAGTTCTTCTGACTGATGTCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 1017524737 6:155232599-155232621 AACTCTGAGGACATGAGACTTGG 0: 1
1: 0
2: 53
3: 1625
4: 1789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017524730 Original CRISPR GGACATCAGTCAGAAGAACT AGG (reversed) Intronic