ID: 1017524735

View in Genome Browser
Species Human (GRCh38)
Location 6:155232586-155232608
Sequence CCTCAGAGTTTCCCCAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017524735_1017524738 2 Left 1017524735 6:155232586-155232608 CCTGGTTTGGGGAAACTCTGAGG 0: 1
1: 0
2: 2
3: 17
4: 158
Right 1017524738 6:155232611-155232633 ATGAGACTTGGATTCAGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 154
1017524735_1017524741 24 Left 1017524735 6:155232586-155232608 CCTGGTTTGGGGAAACTCTGAGG 0: 1
1: 0
2: 2
3: 17
4: 158
Right 1017524741 6:155232633-155232655 GCTGATGGCTCAGCACAGAGTGG 0: 1
1: 0
2: 1
3: 28
4: 266
1017524735_1017524739 9 Left 1017524735 6:155232586-155232608 CCTGGTTTGGGGAAACTCTGAGG 0: 1
1: 0
2: 2
3: 17
4: 158
Right 1017524739 6:155232618-155232640 TTGGATTCAGTCCAGGCTGATGG 0: 1
1: 0
2: 2
3: 12
4: 145
1017524735_1017524743 30 Left 1017524735 6:155232586-155232608 CCTGGTTTGGGGAAACTCTGAGG 0: 1
1: 0
2: 2
3: 17
4: 158
Right 1017524743 6:155232639-155232661 GGCTCAGCACAGAGTGGGTCAGG 0: 1
1: 0
2: 1
3: 22
4: 257
1017524735_1017524742 25 Left 1017524735 6:155232586-155232608 CCTGGTTTGGGGAAACTCTGAGG 0: 1
1: 0
2: 2
3: 17
4: 158
Right 1017524742 6:155232634-155232656 CTGATGGCTCAGCACAGAGTGGG 0: 1
1: 0
2: 5
3: 26
4: 249
1017524735_1017524737 -10 Left 1017524735 6:155232586-155232608 CCTGGTTTGGGGAAACTCTGAGG 0: 1
1: 0
2: 2
3: 17
4: 158
Right 1017524737 6:155232599-155232621 AACTCTGAGGACATGAGACTTGG 0: 1
1: 0
2: 53
3: 1625
4: 1789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017524735 Original CRISPR CCTCAGAGTTTCCCCAAACC AGG (reversed) Intronic