ID: 1017524738

View in Genome Browser
Species Human (GRCh38)
Location 6:155232611-155232633
Sequence ATGAGACTTGGATTCAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017524730_1017524738 23 Left 1017524730 6:155232565-155232587 CCTAGTTCTTCTGACTGATGTCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 1017524738 6:155232611-155232633 ATGAGACTTGGATTCAGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 154
1017524735_1017524738 2 Left 1017524735 6:155232586-155232608 CCTGGTTTGGGGAAACTCTGAGG 0: 1
1: 0
2: 2
3: 17
4: 158
Right 1017524738 6:155232611-155232633 ATGAGACTTGGATTCAGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 154
1017524729_1017524738 24 Left 1017524729 6:155232564-155232586 CCCTAGTTCTTCTGACTGATGTC 0: 1
1: 0
2: 2
3: 8
4: 162
Right 1017524738 6:155232611-155232633 ATGAGACTTGGATTCAGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017524738 Original CRISPR ATGAGACTTGGATTCAGTCC AGG Intronic