ID: 1017524739

View in Genome Browser
Species Human (GRCh38)
Location 6:155232618-155232640
Sequence TTGGATTCAGTCCAGGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017524735_1017524739 9 Left 1017524735 6:155232586-155232608 CCTGGTTTGGGGAAACTCTGAGG 0: 1
1: 0
2: 2
3: 17
4: 158
Right 1017524739 6:155232618-155232640 TTGGATTCAGTCCAGGCTGATGG 0: 1
1: 0
2: 2
3: 12
4: 145
1017524730_1017524739 30 Left 1017524730 6:155232565-155232587 CCTAGTTCTTCTGACTGATGTCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 1017524739 6:155232618-155232640 TTGGATTCAGTCCAGGCTGATGG 0: 1
1: 0
2: 2
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017524739 Original CRISPR TTGGATTCAGTCCAGGCTGA TGG Intronic