ID: 1017524743 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:155232639-155232661 |
| Sequence | GGCTCAGCACAGAGTGGGTC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 281 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 22, 4: 257} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1017524735_1017524743 | 30 | Left | 1017524735 | 6:155232586-155232608 | CCTGGTTTGGGGAAACTCTGAGG | 0: 1 1: 0 2: 2 3: 17 4: 158 |
||
| Right | 1017524743 | 6:155232639-155232661 | GGCTCAGCACAGAGTGGGTCAGG | 0: 1 1: 0 2: 1 3: 22 4: 257 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1017524743 | Original CRISPR | GGCTCAGCACAGAGTGGGTC AGG | Intronic | ||