ID: 1017524743

View in Genome Browser
Species Human (GRCh38)
Location 6:155232639-155232661
Sequence GGCTCAGCACAGAGTGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017524735_1017524743 30 Left 1017524735 6:155232586-155232608 CCTGGTTTGGGGAAACTCTGAGG 0: 1
1: 0
2: 2
3: 17
4: 158
Right 1017524743 6:155232639-155232661 GGCTCAGCACAGAGTGGGTCAGG 0: 1
1: 0
2: 1
3: 22
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017524743 Original CRISPR GGCTCAGCACAGAGTGGGTC AGG Intronic