ID: 1017524748

View in Genome Browser
Species Human (GRCh38)
Location 6:155232674-155232696
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017524748_1017524753 -8 Left 1017524748 6:155232674-155232696 CCTATGGCTCAACACAGAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 109
Right 1017524753 6:155232689-155232711 AGAGTGGGTCGGCATGCGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1017524748_1017524756 11 Left 1017524748 6:155232674-155232696 CCTATGGCTCAACACAGAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 109
Right 1017524756 6:155232708-155232730 AGGGAGAGGGATCTCCCGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 137
1017524748_1017524755 -2 Left 1017524748 6:155232674-155232696 CCTATGGCTCAACACAGAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 109
Right 1017524755 6:155232695-155232717 GGTCGGCATGCGGAGGGAGAGGG 0: 1
1: 0
2: 1
3: 14
4: 202
1017524748_1017524757 12 Left 1017524748 6:155232674-155232696 CCTATGGCTCAACACAGAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 109
Right 1017524757 6:155232709-155232731 GGGAGAGGGATCTCCCGCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 115
1017524748_1017524754 -3 Left 1017524748 6:155232674-155232696 CCTATGGCTCAACACAGAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 109
Right 1017524754 6:155232694-155232716 GGGTCGGCATGCGGAGGGAGAGG 0: 1
1: 0
2: 0
3: 21
4: 272
1017524748_1017524752 -9 Left 1017524748 6:155232674-155232696 CCTATGGCTCAACACAGAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 109
Right 1017524752 6:155232688-155232710 CAGAGTGGGTCGGCATGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017524748 Original CRISPR CCCACTCTGTGTTGAGCCAT AGG (reversed) Intronic