ID: 1017524751

View in Genome Browser
Species Human (GRCh38)
Location 6:155232685-155232707
Sequence ACACAGAGTGGGTCGGCATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017524746_1017524751 -7 Left 1017524746 6:155232669-155232691 CCAGGCCTATGGCTCAACACAGA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1017524751 6:155232685-155232707 ACACAGAGTGGGTCGGCATGCGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017524751 Original CRISPR ACACAGAGTGGGTCGGCATG CGG Intronic