ID: 1017524751 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:155232685-155232707 |
| Sequence | ACACAGAGTGGGTCGGCATG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 109 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 100} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1017524746_1017524751 | -7 | Left | 1017524746 | 6:155232669-155232691 | CCAGGCCTATGGCTCAACACAGA | 0: 1 1: 0 2: 0 3: 9 4: 113 |
||
| Right | 1017524751 | 6:155232685-155232707 | ACACAGAGTGGGTCGGCATGCGG | 0: 1 1: 0 2: 0 3: 8 4: 100 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1017524751 | Original CRISPR | ACACAGAGTGGGTCGGCATG CGG | Intronic | ||