ID: 1017524753

View in Genome Browser
Species Human (GRCh38)
Location 6:155232689-155232711
Sequence AGAGTGGGTCGGCATGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017524748_1017524753 -8 Left 1017524748 6:155232674-155232696 CCTATGGCTCAACACAGAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 109
Right 1017524753 6:155232689-155232711 AGAGTGGGTCGGCATGCGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1017524746_1017524753 -3 Left 1017524746 6:155232669-155232691 CCAGGCCTATGGCTCAACACAGA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1017524753 6:155232689-155232711 AGAGTGGGTCGGCATGCGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017524753 Original CRISPR AGAGTGGGTCGGCATGCGGA GGG Intronic